CN113913499A

CN113913499A - Method for detecting target mutation by using Cas12j effector protein

Info

Publication number: CN113913499A
Application number: CN202011567811.1A
Authority: CN
Inventors: 梁亚峰; 段志强
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2022-01-11

Abstract

The invention provides a method for detecting a target mutation by using a Cas12j effector protein. The method is a method of detecting the presence or absence of a mutation of interest in a target nucleic acid using a Cas12j effector protein, comprising contacting a sample with a type V CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/Cas effector protein and a guide sequence that hybridizes to a mutant target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector, wherein the target mutation is positioned at positions 1-20, preferably positions 9-10 from the 5' end of the gRNA guide sequence.

Description

Method for detecting target mutation by using Cas12j effector protein

Technical Field

The invention relates to the field of nucleic acid detection, and relates to a method for detecting target mutation by using a CRISPR (clustered regularly interspaced short palindromic repeats) technology, in particular to a method for detecting target mutation by using Cas12j effector protein.

Background

The method for specifically detecting Nucleic acid molecules (Nucleic acid detection) has important application values, such as pathogen detection, genetic disease detection and the like. In the aspect of pathogen detection, each pathogenic microorganism has a unique characteristic nucleic acid molecule sequence, so that nucleic acid molecule detection for a specific species, also called Nucleic Acid Diagnostics (NADs), can be developed, and is important in the fields of food safety, detection of environmental microbial contamination, infection of human pathogenic bacteria, and the like. Another aspect is the detection of Single Nucleotide Polymorphisms (SNPs) in humans or other species. Understanding the relationship between genetic variation and biological functions at the genomic level provides a new perspective for modern molecular biology, and SNPs are closely related to biological functions, evolution, diseases and the like, so the development of detection and analysis techniques of SNPs is particularly important.

The detection of specific nucleic acid molecules established today usually requires two steps, the first step being the amplification of the nucleic acid of interest and the second step being the detection of the nucleic acid of interest. The existing detection technologies include restriction endonuclease methods, Southern, Northern, dot blot, fluorescent PCR detection technologies, LAMP loop-mediated isothermal amplification technologies, recombinase polymerase amplification technologies (RPA) and the like. After 2012, CRISPR gene editing technology arose, a new nucleic acid diagnosis technology (SHERLOCK technology) of targeted RNA with Cas13 as a core was developed by the zhanfeng team based on RPA technology, a diagnosis technology (DETECTR technology) with Cas12 enzyme as a core was developed by the Doudna team, and a new nucleic acid detection technology (HOLMES technology) based on Cas12 was also developed by the royal doctor of the institute of physiology and ecology of plants in the shanghai of the chinese academy of sciences. Nucleic acid detection techniques developed based on CRISPR technology are playing an increasingly important role.

The invention applies the CRISPR nucleic acid detection technology to the detection of whether the target nucleic acid has mutation in the target region and the detection of whether the target nucleic acid has the target mutation, and particularly provides a high-efficiency detection method.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting whether a target mutation site exists in a target nucleic acid and detecting whether a mutation exists in a target region by using a Cas12j effector protein.

Method for detecting target mutation

In one aspect, the invention provides a method of detecting the presence or absence of a target mutation site in a target nucleic acid using a Cas12j effector protein, the method comprising contacting the target nucleic acid with a type V CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/Cas effector protein and a guide sequence that hybridizes to a mutant target nucleic acid containing a mutation of interest, the guide sequence comprising a base that pairs with the target mutation site; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector.

In one embodiment, the target mutation is a site where the wild-type target nucleic acid is not identical to the mutant target nucleic acid within the region targeted by the gRNA targeting sequence; since the guide sequence of the gRNA hybridizes to the mutant target nucleic acid, including the base pairing with the target mutation site, the target mutation site also refers to a site where the guide sequence of the gRNA does not coincide with the wild-type target nucleic acid sequence to which it is targeted.

In one embodiment, the guide sequence of the gRNA comprises at least 13 bases, e.g., 13-30 bases, e.g., 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 bases.

In one embodiment, the mutation of interest comprises a single base mutation, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen base mutations, or more base mutations; the target mutation may be a continuous base mutation or a discontinuous base mutation; preferably, the target mutation comprises a single base mutation or a two base mutation, and preferably, the two base mutations are mutations in two consecutive bases.

In one embodiment, the base that pairs with the mutation site of interest is located at one or more of positions 1-20, specifically 1 st, 2 nd, 3 rd, 4 th, 5 th, 6 th, 7 th, 8 th, 9 th, 10 th, 11 th, 12 th, 13 th, 14 th, 15 th, 16 th, 17 th, 18 th, 19 th, and 20 th, of the 5' end of the gRNA targeting sequence; preferably, one or more of positions 7-16 of the 5 'terminus, more preferably, positions 9 and/or 10 of the 5' terminus.

In one embodiment, the mutation of interest is a single base mutation, and the base pairing with the mutation site of interest is located at positions 1 to 20, specifically,

positions

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20, of the 5' end of the gRNA targeting sequence; preferably, the 7 th to 16 th positions of the 5 'end, more preferably, the 9 th or 10 th positions of the 5' end;

in the above method, the intensity of the detectable signal for detecting the mutant-type target nucleic acid is significantly different from the signal for detecting the wild-type target nucleic acid; specifically, the detectable signal for detecting the mutant-type target nucleic acid is significantly stronger than that for detecting the wild-type target nucleic acid, and in this case, the presence or absence of the target mutation site in the target nucleic acid can be determined based on the intensity of the detectable signal.

In one embodiment, the detectable signal of the wild-type target nucleic acid and the detectable signal of the mutant-type target nucleic acid may be different detectable signals, or the detectable signal of the wild-type target nucleic acid and the detectable signal of the mutant-type target nucleic acid may be the same detectable signal.

Preferably, the method further comprises the step of detecting the wild-type target nucleic acid for control, and the method further comprises the step of providing a standard wild-type target nucleic acid.

Preferably, the method further comprises the step of detecting the mutant target nucleic acid for control, and the method further comprises the step of providing a standard mutant target nucleic acid.

In one embodiment, the present invention also provides the use of the above-described type V CRISPR/CAS effector proteins, grnas (guide RNAs), and single-stranded nucleic acid detectors in the preparation of a reagent, composition, or kit for detecting the presence or absence of a mutation site of interest in a target nucleic acid.

In one embodiment, the target mutation site includes a substitution (substitution), insertion or deletion, preferably. The mutation is a point mutation.

In one embodiment, the target nucleic acid is a target nucleic acid for which the presence of a 500bp upstream (5 'end) to 500bp downstream (3' end) of the mutation site of interest, preferably a 300bp upstream (5 'end) to 300bp downstream (3' end) of the mutation site of interest, a 200bp upstream (5 'end) to 200bp downstream (3' end) of the mutation site of interest, more preferably a 100bp upstream (5 'end) to 100bp downstream (3' end) of the mutation site of interest, has been confirmed by an amplification method, the amplification method comprises common amplification methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and the like, preferably PCR method, the confirmation of the existence of the target mutation site upstream and downstream fragments is realized by a method for confirming the existence of an amplification product in a conventional mode such as electrophoresis, qPCR and the like after amplification. The method can confirm that an amplification product is obtained, but cannot confirm a specific sequence, particularly, cannot confirm the presence or absence of a mutation site of interest.

Method for detecting mutation in target region

In one aspect, the invention provides a method for detecting the presence or absence of a mutation in a target region using a Cas12j effector protein, the method comprising contacting a sample with a type V CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/Cas effector protein and a guide sequence that hybridizes to a wild-type target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector.

In one embodiment, the target region refers to the position of the target nucleic acid targeted at positions 1-20 of the 5' end of the gRNA targeting sequence, and the presence of a mutation refers to the presence of a single base mutation, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty base mutations within the target region; the mutation may be a continuous base mutation or a discontinuous base mutation.

In one embodiment, the target region refers to the position of the target nucleic acid targeted from position 7 to position 16 at the 5' end of the gRNA targeting sequence; the existence of the mutation refers to that the target region contains single base mutation, two, three, four, five, six, seven, eight, nine and ten base mutations, and the mutation can be continuous base mutation or discontinuous base mutation.

In one embodiment, the target region refers to the position of the target nucleic acid targeted from positions 9 to 10 at the 5' end of the gRNA targeting sequence; the existence of mutation refers to the fact that a target region contains single base mutation or two base mutation, and the existence of mutation refers to the fact that the 9 th position and/or the 10 th position of the target nucleic acid at the 5' end of the gRNA guide sequence has mutation.

In the above method, the wild-type target nucleic acid and the mutant-type target nucleic acid may generate significantly different detectable signals; specifically, the detectable signal for detecting the mutant-type target nucleic acid is significantly weaker than that for detecting the wild-type target nucleic acid, and in this case, the presence or absence of the target mutation site in the target nucleic acid can be determined based on the strength of the detectable signal.

In other embodiments, the present invention also provides the use of the above-described type V CRISPR/CAS effector proteins, grnas (guide RNAs), and single-stranded nucleic acid detectors in the preparation of a reagent, composition, or kit for detecting the presence or absence of a mutation in a target nucleic acid in a target region; preferably, the target region is the position of the target nucleic acid targeted from position 1 to position 20 at the 5 ' end of the gRNA targeting sequence, preferably, the target region is the position of the target nucleic acid targeted from position 7 to position 16 at the 5 ' end of the gRNA targeting sequence, and preferably, the target region is the position of the target nucleic acid targeted from position 9 to position 10 at the 5 ' end of the gRNA targeting sequence.

In one embodiment, the target nucleic acid is a target nucleic acid whose presence of a fragment of 500bp upstream (5 'end) to 500bp downstream (3' end) of the target region, preferably a fragment of 300bp upstream (5 'end) to 300bp downstream (3' end) of the target region, a fragment of 200bp upstream (5 'end) to 200bp downstream (3' end) of the target region, more preferably a fragment of 100bp upstream (5 'end) to 100bp downstream (3' end) of the target region is confirmed by an amplification method including a common amplification method such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc., preferably a PCR method, in which presence of a fragment upstream and downstream of the target mutation site is confirmed by a conventional method such as electrophoresis, qPCR, etc., and which can confirm the presence of an amplification product, however, the specific sequence, particularly the presence or absence of the mutation site of interest, cannot be confirmed.

Reagents, kits, compositions

In one aspect, the present invention provides a reagent, kit or composition for detecting the presence or absence of a mutation site of interest in a target nucleic acid using a Cas12j effector protein, the reagent, kit or composition comprising the above-described CRISPR/Cas effector protein type V, a gRNA (guide RNA) comprising a region binding to the CRISPR/Cas effector protein and a guide sequence hybridized to a mutant target nucleic acid containing a mutation of interest, the guide sequence comprising a base pairing with the mutation site of interest, and a single-stranded nucleic acid detector.

In one aspect, the present invention provides a reagent, kit or composition for detecting whether a target nucleic acid has a mutation in a target region using a Cas12j effector protein, the reagent, kit or composition comprising the above-described V-type CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region binding to the CRISPR/Cas effector protein and a guide sequence hybridizing to a wild-type target nucleic acid, the target region being the position of the target nucleic acid targeted at positions 1 to 13 and 20 from the 5 ' end of the gRNA guide sequence, preferably, the target region being the position of the target nucleic acid targeted at positions 7 to 16 from the 5 ' end of the gRNA guide sequence, preferably, the target region being the position of the target nucleic acid targeted at positions 9 to 10 from the 5 ' end of the gRNA guide sequence.

Single-stranded nucleic acid detector

In some embodiments, the single-stranded nucleic acid detector does not hybridize to the gRNA.

In one embodiment, the single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, which do not exhibit a reporter signal when in an initial state (i.e., non-cleaved state) and exhibit a detectable signal when cleaved, i.e., exhibit a detectable difference after cleavage from before cleavage.

In some embodiments, the single-stranded nucleic acid detector is provided with different reporter groups at its 5 'end and 3' end, respectively, which can exhibit a detectable reporter signal when the single-stranded nucleic acid detector is cleaved; for example, a single-stranded nucleic acid detector is provided with a fluorescent group and a quenching group at both ends thereof; or a first molecule (such as FAM or FITC) and a second molecule (such as biotin) connected to the 3' end are respectively arranged at two ends of the single-stranded nucleic acid detector.

When a fluorescent group and a quencher group are disposed at both ends of the single-stranded nucleic acid detector, respectively, a detectable fluorescent signal can be exhibited when the single-stranded nucleic acid detector is cleaved. The fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460. The quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

When a first molecule (such as FAM or FITC) and a second molecule (such as biotin) are respectively arranged at two ends of the single-stranded nucleic acid detector, the reaction system containing the single-stranded nucleic acid detector is matched with the flow strip to detect the characteristic sequence (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line.

In one embodiment, the single stranded nucleic acid detector comprises one or more of: 1) base modified nucleotides, 2) sugar modified nucleotides, 3) altered chemical bonds, 4) modified backbones.

In one embodiment, the nucleotide is one or more of ribonucleotide, deoxyribonucleotide, and nucleic acid analog; the base of the ribonucleotide is selected from one or more of adenine A, uracil U, cytosine C, guanine G, thymine T and hypoxanthine I; the base of the deoxyribonucleotide is selected from A, T, C, G, U, I or any of the bases.

In one embodiment, the base modification is the result of a chemical modification of the adenine, cytosine, guanine, uracil, or thymine component of a nucleotide. Other similar base modifications will be readily apparent to those skilled in the art and such other methods are intended to be within the scope of the present invention.

In one embodiment, the base-modified nucleotides further comprise an abasic spacer (single-stranded nucleic acid detectors comprising locked nucleic acids are also described in chinese application CN 2020108880363); the Spacer without base is selected from one or more of dSpacer, Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, inserted Abasic Site (dSpacer Abasic furan) and rAbasic Site (rSpacer Abasic furan).

In one embodiment, the glycosyl modified nucleotides include, 2' -fluoro modification, 2' oxymethyl modification, locked nucleic acid (single stranded nucleic acid detector comprising locked nucleic acid is also described in chinese application CN 2020105609327), bridge nucleic acid, morpholine nucleic acid, ethylene glycol nucleic acid, hexitol nucleic acid, threose nucleic acid, arabinose nucleic acid, 2' methoxyacetyl modification, 2' -amino modification, 4 ' -thio RNA, Peptide Nucleic Acid (PNA), cyclohexenyl nucleic acid (CENA), and combinations thereof; the base of the glycosyl modified nucleotide is selected from one or any more of A, U, C, G, T, I bases.

In one embodiment, the altered chemical bond comprises a modified nucleic acid backbone and a non-natural internucleoside linkage, and nucleic acids having a modified backbone comprise those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

In one embodiment, the single stranded nucleic acid detector may be linear or circular.

In one embodiment, the detection method can be used for quantitative detection of the characteristic sequence to be detected. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.

CRISPR/CAS effector proteins

Further, the type V CRISPR/CAS effector protein is selected from the group consisting of:

(1) a protein shown as SEQ ID No. 1;

(2) derived proteins which are formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.1 or active fragments thereof and have basically the same functions;

(3) a protein having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence shown in SEQ ID No. 1.

In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

Target nucleic acid

In the present invention, the target nucleic acid includes ribonucleotide or deoxyribonucleotide, and includes single-stranded nucleic acid, double-stranded nucleic acid such as single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, DNA-RNA hybrid, or nucleic acid modification.

In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like.

In one embodiment, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, or the like.

In one embodiment, the method further comprises the step of obtaining the target nucleic acid from the sample.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant virus or an animal virus, e.g., papilloma virus, hepatic DNA virus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2(COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-CoV.

In some embodiments, the target nucleic acid is derived from a cell, e.g., from a cell lysate.

In one embodiment, the target nucleic acid is a target nucleic acid whose presence of a fragment of 500bp upstream (5 'end) to 500bp downstream (3' end) of the target region, preferably a fragment of 300bp upstream (5 'end) to 300bp downstream (3' end) of the target region, a fragment of 200bp upstream (5 'end) to 200bp downstream (3' end) of the target region, more preferably a fragment of 100bp upstream (5 'end) to 100bp downstream (3' end) of the target region is confirmed by an amplification method including a common amplification method such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc., preferably a PCR method, in which presence of a fragment upstream and downstream of the target mutation site is confirmed by a conventional method such as electrophoresis, qPCR, etc., and which can confirm the presence of an amplification product, however, the specific sequence, particularly the presence or absence of the mutation site of interest, cannot be confirmed. Detectable signal

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). After contacting with the gRNA and the target nucleic acid, the V-type CRISPR/CAS effector protein is excited to have trans activity, so that the single-stranded nucleic acid detector can be cut more efficiently, and a detectable signal is reflected.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing.

The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Ratio of

In one embodiment, the Cas protein and gRNA are used in a molar ratio of (0.8-1.2): 1.

in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50 nM.

In one embodiment, the gRNA is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, and more preferably, 50 nM.

In one embodiment, the target nucleic acid is used in a final concentration of 5-100nM, preferably, 10-50 nM.

In one embodiment, the single stranded nucleic acid detector is used at a final concentration of 100-.

Applications of

In another aspect, the invention also provides an application of Cas12i in preparing a composition, a reagent or a kit for detecting whether a target nucleic acid has a target mutation.

In another aspect, the invention also provides the application of Cas12i in preparing a composition, a reagent or a kit for detecting whether a target nucleic acid has a mutation in a target region.

In another aspect, the invention also provides the use of Cas12i as described above to detect the presence or absence of a mutation of interest in a target nucleic acid and to detect the presence or absence of a mutation in a region of interest in a target nucleic acid.

In another aspect, the present invention also provides the use of the above-described composition, reagent or kit for detecting the presence of a mutation of interest in a target nucleic acid and for detecting the presence of a mutation of a target nucleic acid in a region of interest.

In another aspect, the present invention also provides the use of the above-described mutant base in a non-target region to improve the efficiency of detecting the presence or absence of a mutation in a target nucleic acid in the target region.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, by computerized algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics package, Genetics, and Genetics Computer Group), with reference to, for example, the teachings of Smith and Waterman,1981, adv.Appl.Math.2:482Pearson Lipman,1988, Proc.Natl.Acad.Sci.USA85:2444, Thompson et al, 1994, Nucleic Acids Res 22:467380, etc. The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.

As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with extremely high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin to avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to a protein (such as an antibody) by a covalent bond, and an avidin molecule bonded to an enzyme reacts with a biotin molecule bonded to a specific antibody, so that not only is a multi-stage amplification effect achieved, but also color is developed due to the catalytic effect of the enzyme when the enzyme meets a corresponding substrate, and the purpose of detecting an unknown antigen (or antibody) molecule is achieved.

Spacer without base

As used herein, "Spacer-free" refers to a nucleoside that does not contain specific coding information. The abasic spacer may be associated with the oligonucleotide, including the 3 'and 5' ends, or within the nucleotide chain. Common spacers include: dSpacer (abacic furan), Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, inserted Abasic Site (dSpacer Abasic furan) and rAbasic Site (rSpacer Abasic furan).

Such abasic spacers are well known in the art and are disclosed, for example, in U.S. Pat. No. 4, 8153772, 2 to dSpacer, Spacer9, Spacer18, Spacer C3; chinese patent application CN101454451A discloses dSpacer.

Preferred herein are the abasic spacers "dspacers" also known as abasic sites, Tetrahydrofuran (THF) or apurinic/apyrimidic (ap) sites, or abasic linkers, wherein the methylene group is located at the 1-position of the 2' -deoxyribose. The dSpacer is not only very similar in structure to the native site, but is also quite stable. The structure is as follows:

the dSpacer, when in nucleotide linkage, may form the following structure:

target nucleic acid

As used herein, the "target nucleic acid" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested). The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single-celled organisms such as bacteria, yeasts, protozoa and amoebae and the like, multicellular organisms (e.g. plants or animals, including samples from healthy or superficially healthy human subjects or human patients affected by a condition or disease to be diagnosed or investigated, e.g. infection by a pathogenic microorganism such as a pathogenic bacterium or virus). For example, the biological sample may be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion, exudate (e.g., obtained from an abscess or any other site of infection or inflammation), or a fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab of a skin or mucosal surface. The sample may also be a sample obtained from any organ or tissue (including biopsies or autopsy specimens, e.g., tumor biopsies) or may comprise cells (primary cells or cultured cells) or culture medium conditioned by any cell, tissue or organ. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cytocentrifuge preparations, cytological smears, bodily fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (e.g., tumor biopsies), fine needle aspirates, and/or tissue sections (e.g., cryostat tissue sections and/or paraffin-embedded tissue sections).

In other embodiments, the biological sample may be a plant cell, callus, tissue or organ (e.g., root, stem, leaf, flower, seed, fruit), and the like.

In the present invention, the target nucleic acid also includes a DNA molecule formed by reverse transcription of RNA, and further, the target nucleic acid can be amplified by a technique known in the art, such as isothermal amplification techniques, such as nucleic acid sequencing-based amplification (NASBA), Recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), Strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), or Nicking Enzyme Amplification (NEAR), and non-isothermal amplification techniques. In certain exemplary embodiments, non-isothermal amplification methods may be used, including, but not limited to, PCR, Multiple Displacement Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or derivative amplification methods (RAM).

Further, the detection method of the present invention further comprises a step of amplifying the target nucleic acid; the detection system further comprises a reagent for amplifying the target nucleic acid. The reagents for amplification include one or more of the following: DNA polymerase, strand displacing enzyme, helicase, recombinase, single-strand binding protein, and the like.

CRISPR

As used herein, the "CRISPR" refers to Clustered, regularly interspaced short palindromic repeats (Clustered regular interspersed short palindromic repeats) derived from the immune system of a microorganism.

Cas protein

As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein (CRISPR/Cas effector protein), which upon binding (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) to a signature (target sequence) to be detected, can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein). When the Cas protein is combined with the characteristic sequence, the protein can induce the trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence. The Cas protein recognizes the characteristic sequence by recognizing PAM (protospacer adjacenttoment motif) adjacent to the characteristic sequence.

The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of the gRNA.

The Cas protein provided by the invention comprises V-type CRISPR/CAS effector proteins, including protein families such as Cas12 and Cas 14. Preferably, e.g., Cas12 proteins, e.g., Cas12a, Cas12 b, Cas12 j; preferably, the Cas protein is Cas12 j.

In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, may be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satrapia, legionella, treponema, Proteus, eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flavivivola, Flavobacterium, Azospirillum, Sphaerochaeta, gluconacetobacter, Neisseria, Rochelia, Parvibaculum, Staphylococcus, Nitrarefactor, Mycoplasma, Campylobacter, and Muspirillum.

In one embodiment, the Cas protein is selected from the group consisting of proteins consisting of:

(1) a protein shown as SEQ ID No. 1;

(2) derived proteins which are formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues in the amino acid sequence shown in SEQ ID No.1 or active fragments thereof and have basically the same functions.

In one embodiment, the Cas protein further includes proteins having 50%, preferably 55%, preferably 60%, preferably 65%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 99%, sequence identity (homology) to the above sequences and having trans activity.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be, for example, of the plasmid, virus, cosmid, phage, etc. type, which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.

gRNA

As used herein, the "gRNA" is also referred to as guide RNA or guide RNA and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, a direct repeat and a guide sequence (guide sequence). grnas may include crRNA and tracrRNA or only crRNA depending on Cas protein on which they depend in different CRISPR systems. The crRNA and tracrRNA may be artificially engineered to fuse to form single guide RNA (sgRNA). In certain cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence (the signature sequence described in the present invention) to hybridize with and guide specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25nt, and in preferred embodiments, the guide sequence has a sequence length of 13-20nt, e.g., 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, or 20 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

The gRNA of the invention can be natural, and can also be artificially modified or designed and synthesized.

Sequence information

SEQ ID No.1	Details of	Type (B)
			1	Cas12j	Protein

Drawings

FIG. 1 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 16bp in length.

FIG. 2 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 18bp in length.

FIG. 3 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 20bp in length.

FIG. 4 shows the detection results of sequential mutations at each site of the gRNA-targeted region on the target nucleic acid when the target gene is CV19 and the gRNA length is 16 bp.

FIG. 5 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 16bp in length.

FIG. 6 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 18bp in length.

FIG. 7 shows the results of detection of each site of the gRNA-targeted region in the target nucleic acid by mutation in sequence when the target gene is OsTGW6 and the gRNA is 20bp in length.

FIG. 8 shows the detection results of sequential mutations at each site of the gRNA-targeted region on the target nucleic acid when the target gene is CV19 and the gRNA length is 16 bp.

FIG. 9 shows the results of detection of each site in the region targeted by the gRNA in the target nucleic acid by mutation in sequence when the target gene is Ngene and the gRNA has a length of 16 bp.

FIG. 10 shows that when OsTGW6 is detected by using 14bp or 16bp gRNAs, the two lengths of gRNAs have little influence on the detection result; when 14bp or 16bp gRNA is used for detecting CV19, the detection result of 14bp gRNA is better, and the difference between a wild type and a mutant type is more obvious.

FIG. 11 shows that in the single-base substitution mutation, no matter what base the mutation is, the detection result is not affected by either.

FIG. 12 shows the results of detection of deletion mutations sequentially in the region targeted by the gRNA in the target nucleic acid when the gRNA has a length of 14bp and the target gene is Ngene.

FIG. 13 shows the results of detection of insertion mutations sequentially in the region targeted by the gRNA in the target nucleic acid when the gRNA has a length of 14bp and the target gene is Ngene.

FIG. 14 shows the results of detection of deletion mutations sequentially placed in the region targeted by the gRNA on the target nucleic acid when the target gene is OsTGW6 and the gRNA is 14bp in length.

FIG. 15 shows the results of detection of insertion mutations sequentially placed in the region targeted by the gRNA on the target nucleic acid when the target gene is OsTGW6 and the gRNA is 14bp in length.

Fig. 16 shows the detection results of deletion mutations sequentially provided in the region targeted by the gRNA on the target nucleic acid when the target gene is CV19 and the gRNA is 14bp in length.

Fig. 17 shows the detection results of insertion mutations sequentially placed in the region targeted by the gRNA on the target nucleic acid when the target gene is CV19 and the gRNA is 14bp in length.

FIG. 18 shows the detection efficiency of the mutant base at a base (position 2 or position 6) of the gRNA targeting sequence that is not paired with the target mutation site when the target gene is OsTGW6 and the gRNA is 14bp in length.

FIG. 19 shows the detection efficiency of a mutant base at a base (position 2 or position 6) of a gRNA targeting sequence that does not pair with the target mutation site when the gRNA is 14bp in length because the target gene is Ngene.

FIG. 20 shows the detection efficiency of the mutant base at a base (position 2 or position 6) of the gRNA targeting sequence that is not paired with the target mutation site when the target gene is CV19 and the gRNA length is 14 bp.

Detailed description of the preferred embodiments

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

The technical scheme of the invention is based on the following principle, the nucleic acid of a sample to be detected is obtained, for example, a target nucleic acid can be obtained by an amplification method, and the gRNA which can be paired with the target nucleic acid is used for guiding the Cas protein to be identified and combined on the target nucleic acid; subsequently, the Cas protein activates the cleavage activity of the single-stranded nucleic acid detector, thereby cleaving the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, and if the single-stranded nucleic acid detector is cut, fluorescence can be excited; if the single-stranded nucleic acid detector cannot be cleaved, fluorescence is not excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label capable of being detected by colloidal gold.

Example 1 test of detection efficiency by setting different mutations in the region targeted by gRNA using double-stranded DNA as the target nucleic acid

Synthesizing OT-ssDNA (primers) containing different OsTGW6 gene mutation sites and complementary chains thereof, annealing, performing T-Blunt connection, selecting a single clone for correct sequencing, performing plasmid extraction, and performing experimental addition according to the plasmid concentration to enable the final concentration to reach 5 nM; CV19-Lamb-j19g1-16bp corresponding gene is Orflab-A (the gene is constructed on a vector), OT-ssDNA primers and T7 primers containing different mutation sites are respectively utilized to amplify plasmid Orflab-A, then PCR products are recovered and tested, and test addition is carried out according to the concentration of the PCR products, so that the final concentration is controlled at 10 nM. The final concentration of Cas12j19 is 50nM, the final concentration of gRNA is 50nM, and the concentration of Reporter-FB-T is 200nM, when different target sequences are verified and detected, gRNAs with different lengths are used for detecting the influence of different positions of mutation sites on a gRNA target nucleic acid region on detection results, namely the influence of detection on the in vitro trans activity of Cas12j 19.

TABLE 1 Experimental arrangement when the target nucleic acid is double-stranded DNA

The region sequence of the gRNA combined with the Cas protein is GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCAC, and the guide sequence is positioned at the 3' end of the sequence; counting the differential sites from one end near the PAM sequence (namely the 5 'end of the guide sequence on the gRNA, namely the 5' end of the Spacer), and sequentially carrying out single base mutation; valid means that the difference is significantly different between the detection of the presence and absence of the difference.

As shown in fig. 1, when the target gene is OsTGW6 and the gRNA is 16bp in length, the 1 st (the 1 st base at the 5 ' end of the gRNA is different from the target nucleic acid, i.e., the 1 st base near the PAM end in the region targeted by the gRNA for the target nucleic acid, and the 2 nd base at the 5 ' end of the gRNA means that the 2 nd base at the 5 ' end of the gRNA is different from the target nucleic acid, i.e., the 2 nd base near the PAM end in the region targeted by the gRNA for the target nucleic acid, and so on) and the 16 th site are different from the target nucleic acid (i.e., when detecting SNP, mutation exists between the site and the wild-type gene or SNP exists at the site) both have a significant effect on the detection result (reduction of the fluorescence signal). This indicates that any mutation at the position targeted by the gRNA can be clearly observed when detecting the mutation in this sequence.

As shown in FIG. 2, when the target gene is OsTGW6 and the gRNA length is 18bp, any difference (mutation) between No.1 and No. 3, No. 7 and No. 14 or No. 16 can bring obvious influence (fluorescence signal reduction) on the detection result. Thus, when the mutation on the sequence is detected, the mutation of at least any one of No. 1-3, No. 7-14 or No. 16 of the 5' end of the gRNA target position can be obviously observed.

As shown in FIG. 3, when the target gene is CV19 and the gRNA length is 20bp, the difference in at least any one of the genes 1-5 or 7-10 significantly affects the detection result (the fluorescence signal is decreased). Thus, when detecting the mutation in the sequence, the mutation at the 1 st-3 rd, 7 th-14 th or 16 th position of the 5' end of the gRNA target position can be obviously observed.

As shown in FIG. 4, when the target gene is OsTGW6 and the gRNA length is 16bp, the difference mutation between at least any of the 5-15 positions and the target nucleic acid will have a significant effect on the detection result (decrease of fluorescence signal). Thus, when detecting the mutation on the sequence, the 5-15 position mutation of the 5' end of the gRNA target position can be obviously observed.

Example 2 testing the efficiency of detection by setting different mutations in the region targeted by gRNA using single-stranded DNA as the target nucleic acid

Synthesizing an OT-ssDNA primer as a target nucleic acid with the final concentration of 50nM, verifying and detecting the influence of gRNAs with different lengths on detecting templates (target nucleic acids) containing different mutation sites under the conditions that the final concentration of Cas12j19 is 50nM, the final concentration of gRNAs is 50nM, and the concentration of Reporter-FB-T is 200nM, namely detecting the influence on the in vitro trans activity of Cas12j 19.

TABLE 2 Experimental arrangement when the target nucleic acid is double-stranded DNA

The region sequence of the gRNA combined with the Cas protein is GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCAC, and the guide sequence is positioned at the 3' end of the sequence; differential sites were counted from the 5' end of the gRNA; effective means that the difference is significantly different between the presence and absence of the difference.

As shown in FIG. 5, the target gene is OsTGW6, and when the gRNA length is 16bp, any one of positions 9-13 has a significant influence on the detection result (the fluorescence signal is reduced). This indicates that when mutations are detected in this sequence, mutations in at least any one of positions 9-13 of the 5' end of the gRNA target can be clearly observed.

As shown in FIG. 6, when the target gene is OsTGW6 and the gRNA length is 18bp, the difference between 9-10 or 16-17 will have a significant effect on the detection result (the fluorescence signal is reduced). Thus, when the mutation on the sequence is detected, the mutation of at least any one of positions 9-10 or 16-17 at the 5' end of the gRNA target position can be obviously observed.

As shown in FIG. 7, when the target gene is CV19 and the gRNA length is 20bp, any one of differences No. 6, No. 9-10, No. 12 or No. 14-19 will have a significant effect on the detection result (decrease in fluorescence signal). This indicates that when mutations are detected in this sequence, mutations in at least any one of positions 6, 9-10, 12, or 14-19 at the 5' end of the gRNA target can be clearly observed.

As shown in FIG. 8, when the target gene is CV19 and the gRNA length is 16bp, the difference between at least any one of the target nucleic acids and 7-15 has a significant effect on the detection result (decrease in fluorescence signal). Thus, when the mutation on the sequence is detected, the mutation at any position 7-15 of the 5' end of the gRNA target position can be obviously observed.

As shown in FIG. 9, when the target gene is Ngene and the gRNA length is 16bp, the difference between any of the 6-15 positions and the target nucleic acid will have a significant effect on the detection result (decrease in fluorescence signal). Thus, when the mutation on the sequence is detected, the mutation at any position 6-15 of the 5' end of the gRNA target position can be obviously observed.

Example 3 Using a single-stranded DNA as a target nucleic acid, different mutations were placed in the region targeted by the gRNA, and a gRNA of 14bp in length had higher detection efficiency

According to the reaction systems of examples 1 and 2, two genes were selected in the arrangement shown in Table 3 to verify the effect of the position difference at the 9 th position of the 5' end on gRNAs with different lengths on the detection effect.

TABLE 3 Experimental arrangement for different lengths of gRNA when the target nucleic acid is single-stranded DNA

As shown in FIG. 10, when OsTGW6 was detected using 14bp or 16bp gRNAs, the two lengths of gRNAs had little effect on the detection results; when 14bp or 16bp gRNA is used for detecting CV19, the detection result of 14bp gRNA is better, and the difference between a wild type and a mutant type is more obvious.

Example 4 verification of detection efficiency by mutating the 9 th position of the region targeted by gRNA to a different base using single-stranded DNA as the target nucleic acid

Grnas as shown in table 4 were synthesized, and the 9 th position set in the region targeted by the grnas was mutated into different bases in order, and whether or not the different base mutations had an influence on the detection results was examined.

TABLE 4 gRNA names, sequences and experimental results

The region sequence of the gRNA combined with the Cas protein is GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCAC, and the guide sequence is positioned at the 3' end of the sequence; effective in the table means that mutations to such bases can be detected.

As a result, as shown in FIG. 11, in the single-base substitution mutation, the detection result was not affected regardless of the base to which the mutation was made.

Example 5 verification of detection efficiency by setting different insertion or deletion mutations in the region targeted by gRNA using single-stranded DNA as target nucleic acid

Three gRNAs shown in Table 5 are synthesized, respectively target different target nucleic acids, and mutations with insertions or deletions at different positions are sequentially designed in the region targeted by the gRNAs, so that whether the method can detect the mutations with insertions or deletions at different positions in the region targeted by the gRNAs is verified.

TABLE 5 gRNA names, sequences and experimental results

The region sequence of the gRNA combined with the Cas protein is GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCAC, and the guide sequence is positioned at the 3' end of the sequence; sequentially setting insertion or deletion of a base at the 1 st to 14 th/1 st to 16 th positions of the 5' end of the guide sequence; insertion of a base means insertion of a base at the 5 'end of the position, for example, insertion at position 1 means insertion of a base at the 5' end of position 1; deletion of a single base means deletion of a single base at that position, for example, deletion at position 1 means deletion of a base at position 1, and counting is as before.

Example 6 setting of a mutated base at a base (position 2 or 6) of the gRNA targeting sequence that is not paired with the target mutation site to verify detection efficiency

According to the grnas of table 6, a mutation is provided at position 9 in a region targeted by the gRNA, and a deliberate mutation is designed at position other than position 9 (position 2 or position 9), and the detection efficiency of a mutation designed at a base not paired with the target mutation site is detected.

The experimental results are shown in fig. 18-20, mutations are designed at positions on the gRNA corresponding to non-target mutations, and the detection efficiency is not affected.

TABLE 6 gRNA names, sequences and experimental results

TABLE 7 target nucleic acid name, sequence

Name (R)	Sequence of
		12j19-ostgw6-3-ssdna9-insert-2a	CCCCGCCTTTTGGACCAACTCGCtATCAATACCATGTAGGCGTCGGCGATG
12j19-ostgw6-3-ssdna9-insert-6a	CCCCGCCTTTTGGACCAACTCGCtATAAATCCCATGTAGGCGTCGGCGATG
		12j19-ostgw6-3-ssdna2a	CCCCGCCTTTTGGACCAACTCGCATCAATACCATGTAGGCGTCGGCGATG
12j19-ostgw6-3-ssdna6a	CCCCGCCTTTTGGACCAACTCGCATAAATCCCATGTAGGCGTCGGCGATG
		n-b-12j19g1-ssdna89 10-insert2a	CCCAGCGCTTCAGCGTTCTTCGGAaATGTCGAGCATTGGCATGGAAGTCACAC
n-b-12j19g1-ssdna89 10-insert6a	CCCAGCGCTTCAGCGTTCTTCGGAaATATCGCGCATTGGCATGGAAGTCACAC
		n-b-j19g1-ssdna2a	CCCAGCGCTTCAGCGTTCTTCGGAATGTCGAGCATTGGCATGGAAGTCACAC
n-b-j19g1-ssdna6a	CCCAGCGCTTCAGCGTTCTTCGGAATATCGCGCATTGGCATGGAAGTCACAC
		cv-j19g1-ssdna0	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCTTCAGTACCATACTCATATTGAG
cv-j19g1-ssdna789-insert	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCtTTCAGTACCATACTCATATTGAG
		cv-j19g1-ssdna789-insert2c	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCtTTCAGTcCCATACTCATATTGAG
cv-j19g1-ssdna789-insert6a	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCtTTaAGTACCATACTCATATTGAG
		cv-j19g1-ssdna2c	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCTTCAGTCCCATACTCATATTGAG
cv-j19g1-ssdna6a	GGCACCAAATTCCAAAGGTTTACCTTGGTAATCATCTTAAGTACCATACTCATATTGAG

The results of the above examples demonstrate that two nucleic acid sequences having at least one different base (single base substitution, insertion or deletion) can be rapidly detected and distinguished by using the designed gRNA, and the wild type and the mutant type can be respectively identified without performing amplification and sequencing, thereby providing a faster, convenient and accurate method for rapidly classifying target nucleic acids.

Sequence listing

<110> Shunheng Biotech Co., Ltd

<120> method for detecting target mutation by using Cas12j effector protein

<130> JH-CNP202142DJ

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 908

<212> PRT

<213> Artificial Sequence

<220>

<223> Cas12 j

<400> 1

Met Pro Ser Tyr Lys Ser Ser Arg Val Leu Val Arg Asp Val Pro Glu

1 5 10 15

Glu Leu Val Asp His Tyr Glu Arg Ser His Arg Val Ala Ala Phe Phe

20 25 30

Met Arg Leu Leu Leu Ala Met Arg Arg Glu Pro Tyr Ser Leu Arg Met

35 40 45

Arg Asp Gly Thr Glu Arg Glu Val Asp Leu Asp Glu Thr Asp Asp Phe

50 55 60

Leu Arg Ser Ala Gly Cys Glu Glu Pro Asp Ala Val Ser Asp Asp Leu

65 70 75 80

Arg Ser Phe Ala Leu Ala Val Leu His Gln Asp Asn Pro Lys Lys Arg

85 90 95

Ala Phe Leu Glu Ser Glu Asn Cys Val Ser Ile Leu Cys Leu Glu Lys

100 105 110

Ser Ala Ser Gly Thr Arg Tyr Tyr Lys Arg Pro Gly Tyr Gln Leu Leu

115 120 125

Lys Lys Ala Ile Glu Glu Glu Trp Gly Trp Asp Lys Phe Glu Ala Ser

130 135 140

Leu Leu Asp Glu Arg Thr Gly Glu Val Ala Glu Lys Phe Ala Ala Leu

145 150 155 160

Ser Met Glu Asp Trp Arg Arg Phe Phe Ala Ala Arg Asp Pro Asp Asp

165 170 175

Leu Gly Arg Glu Leu Leu Lys Thr Asp Thr Arg Glu Gly Met Ala Ala

180 185 190

Ala Leu Arg Leu Arg Glu Arg Gly Val Phe Pro Val Ser Val Pro Glu

195 200 205

His Leu Asp Leu Asp Ser Leu Lys Ala Ala Met Ala Ser Ala Ala Glu

210 215 220

Arg Leu Lys Ser Trp Leu Ala Cys Asn Gln Arg Ala Val Asp Glu Lys

225 230 235 240

Ser Glu Leu Arg Lys Arg Phe Glu Glu Ala Leu Asp Gly Val Asp Pro

245 250 255

Glu Lys Tyr Ala Leu Phe Glu Lys Phe Ala Ala Glu Leu Gln Gln Ala

260 265 270

Asp Tyr Asn Val Thr Lys Lys Leu Val Leu Ala Val Ser Ala Lys Phe

275 280 285

Pro Ala Thr Glu Pro Ser Glu Phe Lys Arg Gly Val Glu Ile Leu Lys

290 295 300

Glu Asp Gly Tyr Lys Pro Leu Trp Glu Asp Phe Arg Glu Leu Gly Phe

305 310 315 320

Val Tyr Leu Ala Glu Arg Lys Trp Glu Arg Arg Arg Gly Gly Ala Ala

325 330 335

Val Thr Leu Cys Asp Ala Asp Asp Ser Pro Ile Lys Val Arg Phe Gly

340 345 350

Leu Thr Gly Arg Gly Arg Lys Phe Val Leu Ser Ala Ala Gly Ser Arg

355 360 365

Phe Leu Ile Thr Val Lys Leu Pro Cys Gly Asp Val Gly Leu Thr Ala

370 375 380

Val Pro Ser Arg Tyr Phe Trp Asn Pro Ser Val Gly Arg Thr Thr Ser

385 390 395 400

Asn Ser Phe Arg Ile Glu Phe Thr Lys Arg Thr Thr Glu Asn Arg Arg

405 410 415

Tyr Val Gly Glu Val Lys Glu Ile Gly Leu Val Arg Gln Arg Gly Arg

420 425 430

Tyr Tyr Phe Phe Ile Asp Tyr Asn Phe Asp Pro Glu Glu Val Ser Asp

435 440 445

Glu Thr Lys Val Gly Arg Ala Phe Phe Arg Ala Pro Leu Asn Glu Ser

450 455 460

Arg Pro Lys Pro Lys Asp Lys Leu Thr Val Met Gly Ile Asp Leu Gly

465 470 475 480

Ile Asn Pro Ala Phe Ala Phe Ala Val Cys Thr Leu Gly Glu Cys Gln

485 490 495

Asp Gly Ile Arg Ser Pro Val Ala Lys Met Glu Asp Val Ser Phe Asp

500 505 510

Ser Thr Gly Leu Arg Gly Gly Ile Gly Ser Gln Lys Leu His Arg Glu

515 520 525

Met His Asn Leu Ser Asp Arg Cys Phe Tyr Gly Ala Arg Tyr Ile Arg

530 535 540

Leu Ser Lys Lys Leu Arg Asp Arg Gly Ala Leu Asn Asp Ile Glu Ala

545 550 555 560

Arg Leu Leu Glu Glu Lys Tyr Ile Pro Gly Phe Arg Ile Val His Ile

565 570 575

Glu Asp Ala Asp Glu Arg Arg Arg Thr Val Gly Arg Thr Val Lys Glu

580 585 590

Ile Lys Gln Glu Tyr Lys Arg Ile Arg His Gln Phe Tyr Leu Arg Tyr

595 600 605

His Thr Ser Lys Arg Asp Arg Thr Glu Leu Ile Ser Ala Glu Tyr Phe

610 615 620

Arg Met Leu Phe Leu Val Lys Asn Leu Arg Asn Leu Leu Lys Ser Trp

625 630 635 640

Asn Arg Tyr His Trp Thr Thr Gly Asp Arg Glu Arg Arg Gly Gly Asn

645 650 655

Pro Asp Glu Leu Lys Ser Tyr Val Arg Tyr Tyr Asn Asn Leu Arg Met

660 665 670

Asp Thr Leu Lys Lys Leu Thr Cys Ala Ile Val Arg Thr Ala Lys Glu

675 680 685

His Gly Ala Thr Leu Val Ala Met Glu Asn Ile Gln Arg Val Asp Arg

690 695 700

Asp Asp Glu Val Lys Arg Arg Lys Glu Asn Ser Leu Leu Ser Leu Trp

705 710 715 720

Ala Pro Gly Met Val Leu Glu Arg Val Glu Gln Glu Leu Lys Asn Glu

725 730 735

Gly Ile Leu Ala Trp Glu Val Asp Pro Arg His Thr Ser Gln Thr Ser

740 745 750

Cys Ile Thr Asp Glu Phe Gly Tyr Arg Ser Leu Val Ala Lys Asp Thr

755 760 765

Phe Tyr Phe Glu Gln Asp Arg Lys Ile His Arg Ile Asp Ala Asp Val

770 775 780

Asn Ala Ala Ile Asn Ile Ala Arg Arg Phe Leu Thr Arg Tyr Arg Ser

785 790 795 800

Leu Thr Gln Leu Trp Ala Ser Leu Leu Asp Asp Gly Arg Tyr Leu Val

805 810 815

Asn Val Thr Arg Gln His Glu Arg Ala Tyr Leu Glu Leu Gln Thr Gly

820 825 830

Ala Pro Ala Ala Thr Leu Asn Pro Thr Ala Glu Ala Ser Tyr Glu Leu

835 840 845

Val Gly Leu Ser Pro Glu Glu Glu Glu Leu Ala Gln Thr Arg Ile Lys

850 855 860

Arg Lys Lys Arg Glu Pro Phe Tyr Arg His Glu Gly Val Trp Leu Thr

865 870 875 880

Arg Glu Lys His Arg Glu Gln Val His Glu Leu Arg Asn Gln Val Leu

885 890 895

Ala Leu Gly Asn Ala Lys Ile Pro Glu Ile Arg Thr

900 905

Claims

1. A method of detecting the presence or absence of a mutation site of interest in a target nucleic acid using a Cas12j effector protein, the method comprising contacting the target nucleic acid with a type V CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/Cas effector protein and a guide sequence that hybridizes to a mutant target nucleic acid containing a mutation of interest, the guide sequence comprising a base that pairs with the mutation site of interest; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector;

the base matched with the target mutation site is arranged at one or more positions from 1 st to 20 th at the 5' end of the gRNA guide sequence;

preferably, the base pairing with the target mutation site is provided at one or more of positions 7 to 16 of the 5' end of the gRNA guide sequence;

more preferably, the base pairing with the mutation site of interest is located at one or more of positions 9 to 10 of the 5' end of the gRNA guide sequence.

2. A method of detecting the presence or absence of a mutation in a target region using a Cas12j effector protein, the method comprising contacting a sample with a type V CRISPR/Cas effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/Cas effector protein and a guide sequence that hybridizes to a wild-type target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector;

the target region refers to the position of the target nucleic acid targeted from 1 st to 20 th positions at the 5' end of the guide sequence of the gRNA; preferably, the target region refers to the position of the target nucleic acid targeted from position 7 to position 16 at the 5' end of the guide sequence of the gRNA; more preferably, the target region refers to the position of the target nucleic acid targeted from positions 9 to 10 at the 5' end of the gRNA targeting sequence.

3. The method of claim 1 or 2, wherein the detectable signal is detected by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal-based detection, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

4. The method of claims 1-3, wherein the target nucleic acid comprises ribonucleotides or deoxyribonucleotides; preferably, it includes single-stranded nucleic acids, double-stranded nucleic acids, for example, single-stranded DNA, double-stranded DNA, single-stranded RNA.

5. The method according to claims 1 to 4, wherein the type V CRISPR/CAS effector protein is a Cas12j protein, preferably the type V CRISPR/CAS effector protein comprises the sequence of SEQ ID No.1, or the type V CRISPR/CAS effector protein is a derivative protein formed by the substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.1 and having substantially the same function; or the V-type CRISPR/CAS effector protein is a protein which has 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% of identity with the sequence shown in SEQ ID No.1, and preferably the amino acid sequence of the V-type CRISPR/CAS effector protein is shown in SEQ ID No. 1.

6. A reagent, kit or composition for detecting the presence or absence of a target mutation site in a target nucleic acid, the reagent, kit or composition comprising a CRISPR/CAS effector protein type V according to the method of claim 1, a gRNA (guide RNA) comprising a region that binds to the CRISPR/CAS effector protein and a guide sequence that hybridizes to a mutant target nucleic acid containing a target mutation, the guide sequence comprising a base that pairs with the target mutation site, and a single-stranded nucleic acid detector.

7. A reagent, kit or composition for detecting the presence or absence of a mutation in a target nucleic acid at a target region, the reagent, kit or composition comprising a type V CRISPR/CAS effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/CAS effector protein and a targeting sequence that hybridizes to a wild-type target nucleic acid in the method of claim 2, the target region being the position of the target nucleic acid targeted at positions 1 to 20 from the 10 th position of the 5 ' end of the gRNA targeting sequence, preferably, the target region being the position of the target nucleic acid targeted at positions 7 to 16 from the 5 ' end of the gRNA targeting sequence, more preferably, the target region being the position of the target nucleic acid targeted at positions 9 to 10 from the 5 ' end of the gRNA targeting sequence.

8. Use of the reagent, kit or composition of claim 6 or 7 for detecting the presence of a mutation site of interest in a target nucleic acid, or for detecting the presence of a mutation in a region of interest in a target nucleic acid.

9. Use of the type V CRISPR/CAS effector protein, gRNA (guide RNA), and single-stranded nucleic acid detector of any one of claim 1, claim 3, claim 4, or claim 5 in the preparation of a reagent, composition, or kit for detecting the presence or absence of a mutation site of interest in a target nucleic acid.

10. Use of the type V CRISPR/CAS effector protein, gRNA (guide RNA), and single-stranded nucleic acid detector of any one of claim 2, claim 3, claim 4, or claim 5 in the preparation of a reagent, composition, or kit for detecting the presence or absence of a mutation in a target nucleic acid at a target region.