CN114517224A - Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector - Google Patents
Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector Download PDFInfo
- Publication number
- CN114517224A CN114517224A CN202011295714.1A CN202011295714A CN114517224A CN 114517224 A CN114517224 A CN 114517224A CN 202011295714 A CN202011295714 A CN 202011295714A CN 114517224 A CN114517224 A CN 114517224A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- leu
- lys
- glu
- arg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Abstract
The present invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with a type V CRISPR/CAS effector protein, a gRNA (guide RNA), and a single-stranded nucleic acid detector, detecting a detectable signal produced by the cleavage of the single-stranded nucleic acid detector by the CRISPR/CAS effector protein, thereby detecting the target nucleic acid; specifically, the single-stranded nucleic acid detector contains 21 to 29 arbitrary bases, preferably 21 to 25 arbitrary bases, and preferably 25 arbitrary bases.
Description
Technical Field
The invention relates to the field of nucleic acid detection, and relates to detection of target nucleic acid by using a single-stranded nucleic acid detector, in particular to a method, a system and a kit for detecting target nucleic acid by using a single-stranded nucleic acid detector containing 21-29 arbitrary bases.
Background
The method for specifically detecting Nucleic acid molecules (Nucleic acid detection) has important application values, such as pathogen detection, genetic disease detection and the like. In the aspect of pathogen detection, each pathogenic microorganism has a unique characteristic nucleic acid molecule sequence, so that nucleic acid molecule detection for a specific species, also called Nucleic Acid Diagnostics (NADs), can be developed, and is important in the fields of food safety, detection of environmental microbial contamination, infection of human pathogenic bacteria, and the like. Another aspect is the detection of Single Nucleotide Polymorphisms (SNPs) in humans or other species. Understanding the relationship between genetic variation and biological functions at the genomic level provides a new perspective for modern molecular biology, and SNPs are closely related to biological functions, evolution, diseases and the like, so the development of detection and analysis techniques of SNPs is particularly important.
The detection of specific nucleic acid molecules established at present usually requires two steps, the first step being the amplification of the nucleic acid of interest and the second step being the detection of the nucleic acid of interest. The existing detection technologies include restriction endonuclease methods, Southern, Northern, dot blot, fluorescent PCR detection technologies, LAMP loop-mediated isothermal amplification technologies, recombinase polymerase amplification technologies (RPA) and the like. After 2012, CRISPR gene editing technology arose, a zhanfeng team developed a new nucleic acid diagnosis technology (SHERLOCK technology) of targeted RNA with Cas13 as a core based on RPA technology, a Doudna team developed a diagnosis technology (DETECTR technology) with Cas12 enzyme as a core, and a new nucleic acid detection technology (HOLMES technology) based on Cas12 was also developed by doctor royal jelly, a institute of physiology and ecology of plants, shanghai, academy of science, china. Nucleic acid detection techniques developed based on CRISPR technology are playing an increasingly important role.
In the CRISPR-based nucleic acid detection technology, a nucleic acid probe or a nucleic acid detector is a key element of the detection technology, the nucleic acid probe is improved, and a single-stranded nucleic acid detector containing 21-29 arbitrary bases is selected as the probe, so that the detection efficiency of the technology is improved, and the sensitivity, the accuracy and the precision are particularly improved.
Disclosure of Invention
The present invention provides methods, systems and kits for detecting a target nucleic acid using a single stranded nucleic acid detector comprising 21 to 29 arbitrary bases.
Method
In one aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with a type V CRISPR/CAS effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/CAS effector protein and a guide sequence that hybridizes to the target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid.
In another aspect, a method of cleaving a single-stranded nucleic acid detector, the method comprising contacting the single-stranded nucleic acid detector with a target nucleic acid, a V-type CRISPR/CAS effector protein, and a gRNA (guide RNA) comprising a region that binds to the CRISPR/CAS effector protein and a guide sequence that hybridizes to the target nucleic acid, the V-type CRISPR/CAS effector protein selected from the group consisting of CAS12i, CAS12j, or a combination of two thereof.
After contacting with the gRNA and the target nucleic acid, the V-type CRISPR/CAS effector protein is excited to have trans activity, so that the single-stranded nucleic acid detector can be cut more efficiently, and a detectable signal is reflected.
Composition comprising a metal oxide and a metal oxide
In another aspect, the invention provides a composition for detecting a target nucleic acid in a sample, the composition comprising a type V CRISPR/CAS effector protein, a gRNA (guide RNA), and a single-stranded nucleic acid detector contact. Contacting the sample with the composition and detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid.
Reagent kit
In another aspect, the invention provides a kit for detecting a target nucleic acid in a sample, the kit comprising a type V CRISPR/CAS effector protein, a gRNA (guide RNA), and a single-stranded nucleic acid detector contact. The target nucleic acid is detected by contacting the sample with components of the kit and detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector.
In one embodiment, the kit further provides the containers required for the reaction.
In one embodiment, the kit also provides the reagents and instrumentation required to extract the target nucleic acid (DNA).
In one embodiment, the kit further comprises a standard for verifying the detection result of the kit.
Single-stranded nucleic acid detector
In one embodiment, the single-stranded nucleic acid detector does not hybridize to the gRNA.
In one embodiment, the single stranded nucleic acid detector comprises 21 to 29 arbitrary bases, specifically 21, 22, 23, 24, 25, 26, 27, 28 or 29 arbitrary bases, preferably 21 to 25 arbitrary bases, preferably 25 arbitrary bases.
In one embodiment, the single stranded nucleic acid detector has an a + T content of 10% to 100%, specifically, 10% to 20%, 20% to 25%, 25% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 100%.
In one embodiment, the Base refers to the nitrogenous Base at position 1 of ribose or deoxyribose.
The base comprises one or more of adenine A, uracil U, cytosine C, guanine G, thymine T, hypoxanthine I, a modification of adenine A, a modification of uracil U, a modification of cytosine C, a modification of guanine G, a modification of thymine T and a modification of hypoxanthine I.
The base modification is obtained by chemically modifying adenine A, uracil U, cytosine C, guanine G, thymine T and hypoxanthine I in nucleotide. Other similar base modifications will be readily apparent to those skilled in the art and such other methods are intended to be within the scope of the present invention.
In one embodiment, the single-stranded nucleic acid detector further comprises an abasic spacer (the single-stranded nucleic acid detector comprising an abasic spacer is also described in chinese application CN 2020106946328); the Spacer without base is selected from one or more of dSpacer, Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, Inverted Abasic Site (dSpacerbasic furan) and rAbasic Site (rSpacerbasic furan).
The single-stranded nucleic acid detector may be linear or circular.
In some embodiments, the single-stranded nucleic acid detector is provided with different reporter groups at the 5 'end and the 3' end, respectively, and when the single-stranded nucleic acid detector is cleaved, a detectable reporter signal can be shown; for example, a single-stranded nucleic acid detector is provided with a fluorescent group and a quenching group at both ends thereof; or a first molecule (such as FAM or FITC) and a second molecule (such as biotin) connected to the 3' end are respectively arranged at two ends of the single-stranded nucleic acid detector.
When a fluorescent group and a quencher group are disposed at both ends of the single-stranded nucleic acid detector, respectively, a detectable fluorescent signal can be exhibited when the single-stranded nucleic acid detector is cleaved.
When a first molecule (such as FAM or FITC) and a second molecule (such as biotin) are respectively arranged at two ends of the single-stranded nucleic acid detector, the reaction system containing the single-stranded nucleic acid detector is matched with the flow strip to detect the characteristic sequence (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line.
In one embodiment, the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1, cy3, cy5 or Tamra.
CRISPR/CAS effector proteins
Further, the type V CRISPR/CAS effector protein is selected from a CAS12 family protein or a mutant thereof.
In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12 j.
In one embodiment, the Cas12a is selected from one or any of FnCas12a, assas 12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12 a; the Cas12a is preferably LbCas12a, the amino acid sequence is shown as SEQ ID No.3, or the derivative protein which is formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown as SEQ ID No.3 or an active fragment thereof and has basically the same function.
In other embodiments, the amino acid sequence of Cas12b is as shown in SEQ ID No.4, or a derivative protein formed by substituting, deleting or adding one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.4 or an active fragment thereof, and having substantially the same function.
In preferred embodiments, the amino acid sequence of the Cas12i protein is selected from the group consisting of:
(1) a protein shown as SEQ ID No. 1;
(2) the derivative protein is formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.1 or an active fragment thereof, and has basically the same function.
In a preferred embodiment, the amino acid sequence of Cas12j protein is selected from the group consisting of:
(1) a protein shown as SEQ ID No. 2;
(2) derived protein formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.2 or active fragment thereof and having basically the same function.
In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.
Target nucleic acid
In the present invention, the target nucleic acid includes ribonucleotide or deoxyribonucleotide, and includes single-stranded nucleic acid, double-stranded nucleic acid such as single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, DNA-RNA hybrid, or nucleic acid modification.
In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like.
In one embodiment, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, or the like.
In one embodiment, the method further comprises the step of obtaining the target nucleic acid from the sample.
In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant virus or an animal virus, e.g., papilloma virus, hepatic DNA virus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2(COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-CoV.
In some embodiments, the target nucleic acid is derived from a cell, e.g., from a cell lysate.
Detectable signal
In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). After contacting with the gRNA and the target nucleic acid, the V-type CRISPR/CAS effector protein is excited to have trans activity, so that the single-stranded nucleic acid detector can be cut more efficiently, and a detectable signal is reflected.
In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing.
The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.
In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.
Ratio of
In one embodiment, the Cas protein and gRNA are used in a molar ratio of (0.8-1.2): 1.
in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50 nM.
In one embodiment, the gRNA is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, and more preferably, 50 nM.
In one embodiment, the target nucleic acid is used in a final concentration of 5-100nM, preferably, 10-50 nM.
In one embodiment, the single stranded nucleic acid detector is used at a final concentration of 100-.
Use of
In another aspect, the present invention also provides the use of the above-described single-stranded nucleic acid detector in the preparation of a composition, a reagent or a kit for detecting a target nucleic acid in a sample.
In one embodiment, the above composition, reagent or kit further comprises a V-type CRISPR/CAS effector protein and a gRNA (guide RNA), the gRNA comprising a region binding to said CRISPR/CAS effector protein and a guide sequence hybridizing to the target nucleic acid, said V-type CRISPR/CAS effector protein being selected from one or a combination of two of CAS12i, CAS12 j.
In another aspect, the present invention also provides the use of the single-stranded nucleic acid detector described above for improving the detection efficiency of a nucleic acid detection composition, a nucleic acid detection reagent, or a nucleic acid detection kit.
In another aspect, the present invention also provides the use of the above composition, reagent or kit for detecting a target nucleic acid in a sample.
General definition:
unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.
The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.
The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.
The term "homology" or "identity" is used to refer to the match of sequence between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, by computerized algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package), with reference to, for example, the teachings of Smith and Waterman,1981, adv.Appl.Math.2:482Pearson Lipman,1988, Proc.Natl.Acad.Sci.USA 85:2444, Thomponetal, 1994, Nucleic Acids Res 22:467380, etc. The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.
As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with extremely high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin to avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to a protein (such as an antibody) by a covalent bond, and an avidin molecule bonded to an enzyme reacts with a biotin molecule bonded to a specific antibody, so that not only is a multi-stage amplification effect achieved, but also color is developed due to the catalytic effect of the enzyme when the enzyme meets a corresponding substrate, and the purpose of detecting an unknown antigen (or antibody) molecule is achieved.
Single-stranded nucleic acid detector
The single-stranded nucleic acid detector of the present invention is used in a detection method or system to report whether a characteristic sequence is contained. The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid contains a characteristic sequence to be detected; alternatively, if the detectable difference is not detectable, it indicates that the target nucleic acid does not contain the signature sequence to be detected.
In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.
In one embodiment, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to the 5 'end and a second molecule (e.g., biotin) attached to the 3' end. The reaction system containing the single-stranded nucleic acid detector is matched with the flow strip to detect the characteristic sequence (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line.
The detection method can be used for quantitative detection of the characteristic sequence to be detected. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.
Spacer without base
As used herein, "Spacer-free" refers to a nucleoside that does not contain specific coding information. The abasic spacer may be associated with the oligonucleotide, including the 3 'and 5' ends, or within the nucleotide chain. Common spacers include: dSpacer (abaca furan), Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, inserted Abasic Site (dSpacerbasic furan) and rAbasic Site (rSpacerbasic furan).
Such abasic spacers are well known in the art and are disclosed, for example, in U.S. Pat. No.3, 8153772, 2 to dSpacer, Spacer9, Spacer18, Spacer C3; chinese patent application CN101454451A discloses dSpacer.
Preferred herein are the abasic spacers "dspacers" also known as abasic sites, Tetrahydrofuran (THF) or apurinic/apyrimidic (ap) sites, or abasic linkers, wherein the methylene group is located at the 1-position of the 2' -deoxyribose. dspacers are not only very similar in structure to the native site, but are also quite stable. The structure is as follows:
the dSpacer, when attached to a nucleotide, may form the following structure:
target nucleic acid
As used herein, the "target nucleic acid" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested). The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single-celled organisms such as bacteria, yeasts, protozoa and amoebae and the like, multicellular organisms (e.g. plants or animals, including samples from healthy or superficially healthy human subjects or human patients affected by a condition or disease to be diagnosed or investigated, e.g. infection by a pathogenic microorganism such as a pathogenic bacterium or virus). For example, the biological sample may be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion, exudate (e.g., obtained from an abscess or any other site of infection or inflammation), or a fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab of a skin or mucosal surface. The sample may also be a sample obtained from any organ or tissue (including biopsies or autopsy specimens, e.g., tumor biopsies) or may comprise cells (primary cells or cultured cells) or culture medium conditioned by any cell, tissue or organ. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cytocentrifuge preparations, cytological smears, bodily fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (e.g., tumor biopsies), fine needle aspirates, and/or tissue sections (e.g., cryostat tissue sections and/or paraffin-embedded tissue sections).
In other embodiments, the biological sample may be a plant cell, callus, tissue or organ (e.g., root, stem, leaf, flower, seed, fruit), and the like.
In the present invention, the target nucleic acid also includes a DNA molecule formed by reverse transcription of RNA, and further, the target nucleic acid can be amplified by a technique known in the art, such as isothermal amplification techniques, such as nucleic acid sequencing-based amplification (NASBA), Recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), Strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), or Nicking Enzyme Amplification (NEAR), and non-isothermal amplification techniques. In certain exemplary embodiments, non-isothermal amplification methods may be used, including, but not limited to, PCR, Multiple Displacement Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or derivative amplification methods (RAM).
Further, the detection method of the present invention further comprises a step of amplifying the target nucleic acid; the detection system further comprises a reagent for amplifying the target nucleic acid. The reagents for amplification include one or more of the following: DNA polymerase, strand displacement enzyme, helicase, recombinase, single-strand binding protein, and the like.
CRISPR
As used herein, the "CRISPR" refers to Clustered, regularly interspaced short palindromic repeats (Clustered regular interspersed short palindromic repeats) derived from the immune system of a microorganism.
Cas protein
As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein (CRISPR/Cas effector protein), which upon binding (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) to a signature (target sequence) to be detected, can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein). When the Cas protein is combined with the characteristic sequence, the protein can induce trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence. The Cas protein recognizes the characteristic sequence by recognizing PAM (protospacer adjacenttoment motif) adjacent to the characteristic sequence.
The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of the gRNA.
The Cas protein provided by the invention comprises V-type CRISPR/CAS effector proteins, including protein families such as Cas12 and Cas 14. Preferably, e.g., Cas12 proteins, e.g., Cas12a, Cas12b, Cas12i, Cas12 j; preferably, the Cas protein is Cas12a, Cas12b, Cas12i, Cas12 j; the Cas14 protein family includes Cas14a, Cas14b, and the like.
In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.
In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, may be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.
In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.
In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satrapia, legionella, treponema, Proteus, eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flavivivola, Flavobacterium, Azospirillum, Sphaerochaeta, gluconacetobacter, Neisseria, Rochelia, Parvibaculum, Staphylococcus, Nitrarefactor, Mycoplasma, Campylobacter, and Muspirillum.
In one embodiment, the Cas protein is selected from the group consisting of proteins consisting of:
(1) proteins shown as SEQ ID No. 1-4;
(2) derived proteins which are formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues in the amino acid sequences shown in SEQ ID No.1-4 or active fragments thereof and have basically the same functions.
In one embodiment, the Cas protein further includes proteins having 50%, preferably 55%, preferably 60%, preferably 65%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, sequence identity (homology) to the above sequences and having trans activity.
The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be, for example, of the plasmid, virus, cosmid, phage, etc. type, which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.
The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.
gRNA
As used herein, the "gRNA" is also referred to as guide RNA or guide RNA and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, or consist of, a direct repeat and a guide sequence (also referred to as a spacer (spacer) in the context of endogenous CRISPR systems). grnas in different CRISPR systems may include crRNA and tracrRNA, or may contain only crRNA, depending on the Cas protein on which they depend. The crRNA and tracrRNA may be artificially engineered to fuse to form single guide RNA (sgRNA). In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence (the signature sequence described in the present invention) to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.
In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.
The gRNA of the invention can be natural, and can also be artificially modified or designed and synthesized.
Sequence information
Drawings
FIG. 1 fluorescent signals of Cas12i (Cas12i3) at different single-stranded nucleic acid detector lengths when the target nucleic acid is single-stranded DNA.
FIG. 2 fluorescent signals of Cas12j (Cas12j19) at different single-stranded nucleic acid detector lengths when the target nucleic acid is single-stranded DNA.
FIG. 3 detection signals of Cas12i and Cas12j with 5bp and 25bp single stranded nucleic acid detectors when the target nucleic acid is double stranded DNA.
Detailed description of the preferred embodiments
The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.
The technical scheme of the invention is based on the following principle, the nucleic acid of a sample to be detected is obtained, for example, a target nucleic acid can be obtained by an amplification method, and the gRNA which can be paired with the target nucleic acid is used for guiding the Cas protein to be identified and combined on the target nucleic acid; subsequently, the Cas protein activates the cleavage activity of the single-stranded nucleic acid detector, thereby cleaving the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, and if the single-stranded nucleic acid detector is cut, fluorescence can be excited; if the single-stranded nucleic acid detector cannot be cleaved, fluorescence is not excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label capable of being detected by colloidal gold.
Example 1 testing of different Length Single stranded nucleic acid Detector for different Cas Effect proteins when the target nucleic acid is Single stranded DNA
Effect of white Trans Activity
Single-stranded nucleic acid detectors of different lengths were designed and synthesized. The detailed sequence is shown in table 1.
TABLE 1 sequences of Single-stranded nucleic acid detectors used in the present invention
Name (R) | Length (nt) | Single-stranded nucleic acid detector sequences | SEQ ID No. |
Reporter- |
5 | ttctt | - |
|
10 | |
5 |
|
15 | ttgtttgcgtttgtt | 6 |
|
20 | ttgtttgcgtttgttttatt | 7 |
|
25 | ttgtttgcgtttgtttgcgtttgtt | 8 |
|
36 | acatgcgctttgatgcagagttcacttttgttgcgt | 9 |
The applicant verified the above 2 different Cas effector proteins Cas12i (SEQ ID No.1) (in the invention Cas12i3 sometimes refers to Cas12i) and Cas12j (SEQ ID No.2) (in the invention Cas12j19 sometimes refers to Cas12j), using single strand nucleic acid detectors Reporter-TGT, Reporter 10, Reporter 15, Reporter 20, Reporter25, Reporter 36, and designed as follows:
TABLE 2 target nucleic acids, gRNAs and single-stranded nucleic acid detectors corresponding to different Cas proteins
The sequence of the target nucleic acid EV71ssDNA was: GTGCACGCAACAAAAGTGAACTCTGCATCAAAGCGCATGT
The gRNA sequence of the i3-1 is as follows: AGAGAAUGUGUGCAUAGUCACACAUGCAGAGUUCACUUUUGUUGCGU (underlined are targeting sequences)
The gRNA sequence of the j19-1 is as follows: GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCACCAGAGUUCAC UUUUGUUGCGUGCA (underlined is a targeting sequence)
A20. mu.l reaction system was mixed according to the design of Table 2, and a negative control (NTC) containing no target nucleic acid was set for each reaction to confirm that the fluorescence signal was actually generated due to the detection of the target nucleic acid. The contents of the respective components in the system are shown in Table 3. The mixed reaction system was reacted at 37 ℃ for 30min, and the fluorescence signal was detected, with the results shown in FIGS. 1 and 2.
TABLE 3.20 μ l content of each component in the system
As shown in FIG. 1, Cas12i (Cas12i3) was able to detect fluorescence signals at different single-stranded nucleic acid detector lengths, with a single-stranded nucleic acid detector of 25bp length being the most preferred.
As shown in FIG. 2, Cas12j (Cas12j19) was able to detect fluorescence signals at different single-stranded nucleic acid detector lengths, with a single-stranded nucleic acid detector of 25bp length being the most preferred.
Example 2 when the target nucleic acid is double-stranded DNA, the different length single-stranded nucleic acid detectors are effective against Cas12i and Cas12j
Effect of the Trans Activity of the stress protein
Designing LAMP primers to amplify target nucleic acid sequences:
the sequence of the target nucleic acid is: gcgtaggaaggtggagctattcacttacatgcgctttgatgcagagttcacttttgttgcgtgcacacccaccggggaagttgttccacaattgctcc aatatatgtttgtgccacctggagcccctaagccagattcaagggaatcccttgcatggcaaactgccactaacccctcagtttttgtcaagctgtca gaccctccag the flow of the air in the air conditioner,
the primer sequence of LAMP amplification is as follows:
·VP1-FIP caacttccccggtgggtgtgacttacatgcgctttgatgc
·VP1-BIP tgtttgtgccacctggagccaactgaggggttagtggca
·VP1-F3caggttacgcgcaaatgc
·VP1-B3gggtctgacagcttgacaaa
·VP1-LF caacaaaagtgaactct
·VP1-LBgggaatcccttgcatggcaaac
design experiments comparing double-stranded DNA as reaction substrates, gRNA i3-1, gRNA j19-1, Reporter5 and Reporter25 were identical to those in example 1, and Cas12i and Cas12j performed nucleic acid detection using single-stranded nucleic acid detectors of different lengths.
Verification was performed by mixing samples according to 20 μ l reaction system in example 1, and the Cas protein and the corresponding target nucleic acid, gRNA and single-stranded nucleic acid detector in each reaction system are shown in table 4. The mixed reaction system is reacted at 37 ℃ for 60min, and a fluorescence signal is collected every 1 min.
TABLE 4 target nucleic acids, gRNAs, and single-stranded nucleic acid detectors for different Cas proteins
Cas protein | Target nucleic acid | gRNA | Name of Single-stranded nucleic acid Detector |
Cas12i | EV71 | i3-1 | Reporter5,Reporter25 |
Cas12j | EV71 | j19-1 | Reporter5,Reporter25 |
As shown in fig. 3, when the single-stranded nucleic acid detector is 25bp, higher fluorescence signals can be detected by both Cas12i and Cas12j compared to when the single-stranded nucleic acid detector is 5 bp.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes or modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the appended claims of the present application.
SEQUENCE LISTING
<110> Shunheng Biotech Co., Ltd
<120> a method for detecting nucleic acid using an optimized single-stranded nucleic acid detector
<130> JH-CNP201842DJ
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 1045
<212> PRT
<213> Artificial Sequence
<220>
<223> Cas12i
<400> 1
Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro
1 5 10 15
Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys
20 25 30
Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala
35 40 45
Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp
50 55 60
Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val
65 70 75 80
Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser
85 90 95
Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln
100 105 110
Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp
115 120 125
Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala
130 135 140
Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu
145 150 155 160
Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu
165 170 175
Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu
180 185 190
Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr
195 200 205
Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys
210 215 220
Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser
225 230 235 240
Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln
245 250 255
Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile
260 265 270
Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser
275 280 285
Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala
290 295 300
Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu
305 310 315 320
Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly
325 330 335
Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His
340 345 350
Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn
355 360 365
Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala
370 375 380
Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu
385 390 395 400
Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn
405 410 415
Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln
420 425 430
Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys
435 440 445
Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu
450 455 460
Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His
465 470 475 480
Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg
485 490 495
Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn
500 505 510
Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp
515 520 525
Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln
530 535 540
Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys
545 550 555 560
Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val
565 570 575
Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr
580 585 590
Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu
595 600 605
Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala
610 615 620
Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp
625 630 635 640
Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser
645 650 655
Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu
660 665 670
Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val
675 680 685
Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp
690 695 700
Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe
705 710 715 720
Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu
725 730 735
Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly
740 745 750
Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys
755 760 765
Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu
770 775 780
Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe
785 790 795 800
Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu
805 810 815
Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr
820 825 830
Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser
835 840 845
Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp
850 855 860
Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu
865 870 875 880
Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln
885 890 895
Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu
900 905 910
Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly
915 920 925
Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser
930 935 940
Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly
945 950 955 960
Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val
965 970 975
Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu
980 985 990
Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly
995 1000 1005
Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn
1010 1015 1020
Ile Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys
1025 1030 1035
Glu Glu Ser Ser Ala Ser Gly
1040 1045
<210> 2
<211> 908
<212> PRT
<213> Artificial Sequence
<220>
<223> Cas12j
<400> 2
Met Pro Ser Tyr Lys Ser Ser Arg Val Leu Val Arg Asp Val Pro Glu
1 5 10 15
Glu Leu Val Asp His Tyr Glu Arg Ser His Arg Val Ala Ala Phe Phe
20 25 30
Met Arg Leu Leu Leu Ala Met Arg Arg Glu Pro Tyr Ser Leu Arg Met
35 40 45
Arg Asp Gly Thr Glu Arg Glu Val Asp Leu Asp Glu Thr Asp Asp Phe
50 55 60
Leu Arg Ser Ala Gly Cys Glu Glu Pro Asp Ala Val Ser Asp Asp Leu
65 70 75 80
Arg Ser Phe Ala Leu Ala Val Leu His Gln Asp Asn Pro Lys Lys Arg
85 90 95
Ala Phe Leu Glu Ser Glu Asn Cys Val Ser Ile Leu Cys Leu Glu Lys
100 105 110
Ser Ala Ser Gly Thr Arg Tyr Tyr Lys Arg Pro Gly Tyr Gln Leu Leu
115 120 125
Lys Lys Ala Ile Glu Glu Glu Trp Gly Trp Asp Lys Phe Glu Ala Ser
130 135 140
Leu Leu Asp Glu Arg Thr Gly Glu Val Ala Glu Lys Phe Ala Ala Leu
145 150 155 160
Ser Met Glu Asp Trp Arg Arg Phe Phe Ala Ala Arg Asp Pro Asp Asp
165 170 175
Leu Gly Arg Glu Leu Leu Lys Thr Asp Thr Arg Glu Gly Met Ala Ala
180 185 190
Ala Leu Arg Leu Arg Glu Arg Gly Val Phe Pro Val Ser Val Pro Glu
195 200 205
His Leu Asp Leu Asp Ser Leu Lys Ala Ala Met Ala Ser Ala Ala Glu
210 215 220
Arg Leu Lys Ser Trp Leu Ala Cys Asn Gln Arg Ala Val Asp Glu Lys
225 230 235 240
Ser Glu Leu Arg Lys Arg Phe Glu Glu Ala Leu Asp Gly Val Asp Pro
245 250 255
Glu Lys Tyr Ala Leu Phe Glu Lys Phe Ala Ala Glu Leu Gln Gln Ala
260 265 270
Asp Tyr Asn Val Thr Lys Lys Leu Val Leu Ala Val Ser Ala Lys Phe
275 280 285
Pro Ala Thr Glu Pro Ser Glu Phe Lys Arg Gly Val Glu Ile Leu Lys
290 295 300
Glu Asp Gly Tyr Lys Pro Leu Trp Glu Asp Phe Arg Glu Leu Gly Phe
305 310 315 320
Val Tyr Leu Ala Glu Arg Lys Trp Glu Arg Arg Arg Gly Gly Ala Ala
325 330 335
Val Thr Leu Cys Asp Ala Asp Asp Ser Pro Ile Lys Val Arg Phe Gly
340 345 350
Leu Thr Gly Arg Gly Arg Lys Phe Val Leu Ser Ala Ala Gly Ser Arg
355 360 365
Phe Leu Ile Thr Val Lys Leu Pro Cys Gly Asp Val Gly Leu Thr Ala
370 375 380
Val Pro Ser Arg Tyr Phe Trp Asn Pro Ser Val Gly Arg Thr Thr Ser
385 390 395 400
Asn Ser Phe Arg Ile Glu Phe Thr Lys Arg Thr Thr Glu Asn Arg Arg
405 410 415
Tyr Val Gly Glu Val Lys Glu Ile Gly Leu Val Arg Gln Arg Gly Arg
420 425 430
Tyr Tyr Phe Phe Ile Asp Tyr Asn Phe Asp Pro Glu Glu Val Ser Asp
435 440 445
Glu Thr Lys Val Gly Arg Ala Phe Phe Arg Ala Pro Leu Asn Glu Ser
450 455 460
Arg Pro Lys Pro Lys Asp Lys Leu Thr Val Met Gly Ile Asp Leu Gly
465 470 475 480
Ile Asn Pro Ala Phe Ala Phe Ala Val Cys Thr Leu Gly Glu Cys Gln
485 490 495
Asp Gly Ile Arg Ser Pro Val Ala Lys Met Glu Asp Val Ser Phe Asp
500 505 510
Ser Thr Gly Leu Arg Gly Gly Ile Gly Ser Gln Lys Leu His Arg Glu
515 520 525
Met His Asn Leu Ser Asp Arg Cys Phe Tyr Gly Ala Arg Tyr Ile Arg
530 535 540
Leu Ser Lys Lys Leu Arg Asp Arg Gly Ala Leu Asn Asp Ile Glu Ala
545 550 555 560
Arg Leu Leu Glu Glu Lys Tyr Ile Pro Gly Phe Arg Ile Val His Ile
565 570 575
Glu Asp Ala Asp Glu Arg Arg Arg Thr Val Gly Arg Thr Val Lys Glu
580 585 590
Ile Lys Gln Glu Tyr Lys Arg Ile Arg His Gln Phe Tyr Leu Arg Tyr
595 600 605
His Thr Ser Lys Arg Asp Arg Thr Glu Leu Ile Ser Ala Glu Tyr Phe
610 615 620
Arg Met Leu Phe Leu Val Lys Asn Leu Arg Asn Leu Leu Lys Ser Trp
625 630 635 640
Asn Arg Tyr His Trp Thr Thr Gly Asp Arg Glu Arg Arg Gly Gly Asn
645 650 655
Pro Asp Glu Leu Lys Ser Tyr Val Arg Tyr Tyr Asn Asn Leu Arg Met
660 665 670
Asp Thr Leu Lys Lys Leu Thr Cys Ala Ile Val Arg Thr Ala Lys Glu
675 680 685
His Gly Ala Thr Leu Val Ala Met Glu Asn Ile Gln Arg Val Asp Arg
690 695 700
Asp Asp Glu Val Lys Arg Arg Lys Glu Asn Ser Leu Leu Ser Leu Trp
705 710 715 720
Ala Pro Gly Met Val Leu Glu Arg Val Glu Gln Glu Leu Lys Asn Glu
725 730 735
Gly Ile Leu Ala Trp Glu Val Asp Pro Arg His Thr Ser Gln Thr Ser
740 745 750
Cys Ile Thr Asp Glu Phe Gly Tyr Arg Ser Leu Val Ala Lys Asp Thr
755 760 765
Phe Tyr Phe Glu Gln Asp Arg Lys Ile His Arg Ile Asp Ala Asp Val
770 775 780
Asn Ala Ala Ile Asn Ile Ala Arg Arg Phe Leu Thr Arg Tyr Arg Ser
785 790 795 800
Leu Thr Gln Leu Trp Ala Ser Leu Leu Asp Asp Gly Arg Tyr Leu Val
805 810 815
Asn Val Thr Arg Gln His Glu Arg Ala Tyr Leu Glu Leu Gln Thr Gly
820 825 830
Ala Pro Ala Ala Thr Leu Asn Pro Thr Ala Glu Ala Ser Tyr Glu Leu
835 840 845
Val Gly Leu Ser Pro Glu Glu Glu Glu Leu Ala Gln Thr Arg Ile Lys
850 855 860
Arg Lys Lys Arg Glu Pro Phe Tyr Arg His Glu Gly Val Trp Leu Thr
865 870 875 880
Arg Glu Lys His Arg Glu Gln Val His Glu Leu Arg Asn Gln Val Leu
885 890 895
Ala Leu Gly Asn Ala Lys Ile Pro Glu Ile Arg Thr
900 905
<210> 3
<211> 1228
<212> PRT
<213> Artificial Sequence
<220>
<223> LbCas12a
<400> 3
Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr
1 5 10 15
Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp
20 25 30
Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys
35 40 45
Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp
50 55 60
Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu
65 70 75 80
Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn
85 90 95
Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn
100 105 110
Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu
115 120 125
Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe
130 135 140
Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn
145 150 155 160
Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile
165 170 175
Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys
180 185 190
Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys
195 200 205
Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe
210 215 220
Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile
225 230 235 240
Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn
245 250 255
Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys
260 265 270
Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser
275 280 285
Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe
290 295 300
Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys
305 310 315 320
Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile
325 330 335
Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe
340 345 350
Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp
355 360 365
Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp
370 375 380
Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu
385 390 395 400
Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu
405 410 415
Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser
420 425 430
Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys
435 440 445
Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys
450 455 460
Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr
465 470 475 480
Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile
485 490 495
Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr
500 505 510
Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro
515 520 525
Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala
530 535 540
Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys
545 550 555 560
Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly
565 570 575
Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met
580 585 590
Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro
595 600 605
Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly
610 615 620
Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys
625 630 635 640
Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn
645 650 655
Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu
660 665 670
Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys
675 680 685
Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile
690 695 700
Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His
705 710 715 720
Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile
725 730 735
Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys
740 745 750
Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys
755 760 765
Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr
770 775 780
Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile
785 790 795 800
Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val
805 810 815
Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp
820 825 830
Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly
835 840 845
Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn
850 855 860
Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu
865 870 875 880
Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile
885 890 895
Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys
900 905 910
Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn
915 920 925
Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln
930 935 940
Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys
945 950 955 960
Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile
965 970 975
Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe
980 985 990
Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr
995 1000 1005
Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp
1010 1015 1020
Ser Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro
1025 1030 1035
Glu Glu Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser
1040 1045 1050
Arg Thr Asp Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr
1055 1060 1065
Gly Asn Arg Ile Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val
1070 1075 1080
Phe Asp Trp Glu Glu Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu
1085 1090 1095
Phe Asn Lys Tyr Gly Ile Asn Tyr Gln Gln Gly Asp Ile Arg Ala
1100 1105 1110
Leu Leu Cys Glu Gln Ser Asp Lys Ala Phe Tyr Ser Ser Phe Met
1115 1120 1125
Ala Leu Met Ser Leu Met Leu Gln Met Arg Asn Ser Ile Thr Gly
1130 1135 1140
Arg Thr Asp Val Asp Phe Leu Ile Ser Pro Val Lys Asn Ser Asp
1145 1150 1155
Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu Ala Gln Glu Asn Ala
1160 1165 1170
Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala Tyr Asn Ile Ala
1175 1180 1185
Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys Ala Glu Asp
1190 1195 1200
Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys Glu Trp
1205 1210 1215
Leu Glu Tyr Ala Gln Thr Ser Val Lys His
1220 1225
<210> 4
<211> 1129
<212> PRT
<213> Artificial Sequence
<220>
<223> Cas12b
<400> 4
Met Ala Val Lys Ser Ile Lys Val Lys Leu Arg Leu Asp Asp Met Pro
1 5 10 15
Glu Ile Arg Ala Gly Leu Trp Lys Leu His Lys Glu Val Asn Ala Gly
20 25 30
Val Arg Tyr Tyr Thr Glu Trp Leu Ser Leu Leu Arg Gln Glu Asn Leu
35 40 45
Tyr Arg Arg Ser Pro Asn Gly Asp Gly Glu Gln Glu Cys Asp Lys Thr
50 55 60
Ala Glu Glu Cys Lys Ala Glu Leu Leu Glu Arg Leu Arg Ala Arg Gln
65 70 75 80
Val Glu Asn Gly His Arg Gly Pro Ala Gly Ser Asp Asp Glu Leu Leu
85 90 95
Gln Leu Ala Arg Gln Leu Tyr Glu Leu Leu Val Pro Gln Ala Ile Gly
100 105 110
Ala Lys Gly Asp Ala Gln Gln Ile Ala Arg Lys Phe Leu Ser Pro Leu
115 120 125
Ala Asp Lys Asp Ala Val Gly Gly Leu Gly Ile Ala Lys Ala Gly Asn
130 135 140
Lys Pro Arg Trp Val Arg Met Arg Glu Ala Gly Glu Pro Gly Trp Glu
145 150 155 160
Glu Glu Lys Glu Lys Ala Glu Thr Arg Lys Ser Ala Asp Arg Thr Ala
165 170 175
Asp Val Leu Arg Ala Leu Ala Asp Phe Gly Leu Lys Pro Leu Met Arg
180 185 190
Val Tyr Thr Asp Ser Glu Met Ser Ser Val Glu Trp Lys Pro Leu Arg
195 200 205
Lys Gly Gln Ala Val Arg Thr Trp Asp Arg Asp Met Phe Gln Gln Ala
210 215 220
Ile Glu Arg Met Met Ser Trp Glu Ser Trp Asn Gln Arg Val Gly Gln
225 230 235 240
Glu Tyr Ala Lys Leu Val Glu Gln Lys Asn Arg Phe Glu Gln Lys Asn
245 250 255
Phe Val Gly Gln Glu His Leu Val His Leu Val Asn Gln Leu Gln Gln
260 265 270
Asp Met Lys Glu Ala Ser Pro Gly Leu Glu Ser Lys Glu Gln Thr Ala
275 280 285
His Tyr Val Thr Gly Arg Ala Leu Arg Gly Ser Asp Lys Val Phe Glu
290 295 300
Lys Trp Gly Lys Leu Ala Pro Asp Ala Pro Phe Asp Leu Tyr Asp Ala
305 310 315 320
Glu Ile Lys Asn Val Gln Arg Arg Asn Thr Arg Arg Phe Gly Ser His
325 330 335
Asp Leu Phe Ala Lys Leu Ala Glu Pro Glu Tyr Gln Ala Leu Trp Arg
340 345 350
Glu Asp Ala Ser Phe Leu Thr Arg Tyr Ala Val Tyr Asn Ser Ile Leu
355 360 365
Arg Lys Leu Asn His Ala Lys Met Phe Ala Thr Phe Thr Leu Pro Asp
370 375 380
Ala Thr Ala His Pro Ile Trp Thr Arg Phe Asp Lys Leu Gly Gly Asn
385 390 395 400
Leu His Gln Tyr Thr Phe Leu Phe Asn Glu Phe Gly Glu Arg Arg His
405 410 415
Ala Ile Arg Phe His Lys Leu Leu Lys Val Glu Asn Gly Val Ala Arg
420 425 430
Glu Val Asp Asp Val Thr Val Pro Ile Ser Met Ser Glu Gln Leu Asp
435 440 445
Asn Leu Leu Pro Arg Asp Pro Asn Glu Pro Ile Ala Leu Tyr Phe Arg
450 455 460
Asp Tyr Gly Ala Glu Gln His Phe Thr Gly Glu Phe Gly Gly Ala Lys
465 470 475 480
Ile Gln Cys Arg Arg Asp Gln Leu Ala His Met His Arg Arg Arg Gly
485 490 495
Ala Arg Asp Val Tyr Leu Asn Val Ser Val Arg Val Gln Ser Gln Ser
500 505 510
Glu Ala Arg Gly Glu Arg Arg Pro Pro Tyr Ala Ala Val Phe Arg Leu
515 520 525
Val Gly Asp Asn His Arg Ala Phe Val His Phe Asp Lys Leu Ser Asp
530 535 540
Tyr Leu Ala Glu His Pro Asp Asp Gly Lys Leu Gly Ser Glu Gly Leu
545 550 555 560
Leu Ser Gly Leu Arg Val Met Ser Val Asp Leu Gly Leu Arg Thr Ser
565 570 575
Ala Ser Ile Ser Val Phe Arg Val Ala Arg Lys Asp Glu Leu Lys Pro
580 585 590
Asn Ser Lys Gly Arg Val Pro Phe Phe Phe Pro Ile Lys Gly Asn Asp
595 600 605
Asn Leu Val Ala Val His Glu Arg Ser Gln Leu Leu Lys Leu Pro Gly
610 615 620
Glu Thr Glu Ser Lys Asp Leu Arg Ala Ile Arg Glu Glu Arg Gln Arg
625 630 635 640
Thr Leu Arg Gln Leu Arg Thr Gln Leu Ala Tyr Leu Arg Leu Leu Val
645 650 655
Arg Cys Gly Ser Glu Asp Val Gly Arg Arg Glu Arg Ser Trp Ala Lys
660 665 670
Leu Ile Glu Gln Pro Val Asp Ala Ala Asn His Met Thr Pro Asp Trp
675 680 685
Arg Glu Ala Phe Glu Asn Glu Leu Gln Lys Leu Lys Ser Leu His Gly
690 695 700
Ile Cys Ser Asp Lys Glu Trp Met Asp Ala Val Tyr Glu Ser Val Arg
705 710 715 720
Arg Val Trp Arg His Met Gly Lys Gln Val Arg Asp Trp Arg Lys Asp
725 730 735
Val Arg Ser Gly Glu Arg Pro Lys Ile Arg Gly Tyr Ala Lys Asp Val
740 745 750
Val Gly Gly Asn Ser Ile Glu Gln Ile Glu Tyr Leu Glu Arg Gln Tyr
755 760 765
Lys Phe Leu Lys Ser Trp Ser Phe Phe Gly Lys Val Ser Gly Gln Val
770 775 780
Ile Arg Ala Glu Lys Gly Ser Arg Phe Ala Ile Thr Leu Arg Glu His
785 790 795 800
Ile Asp His Ala Lys Glu Asp Arg Leu Lys Lys Leu Ala Asp Arg Ile
805 810 815
Ile Met Glu Ala Leu Gly Tyr Val Tyr Ala Leu Asp Glu Arg Gly Lys
820 825 830
Gly Lys Trp Val Ala Lys Tyr Pro Pro Cys Gln Leu Ile Leu Leu Glu
835 840 845
Glu Leu Ser Glu Tyr Gln Phe Asn Asn Asp Arg Pro Pro Ser Glu Asn
850 855 860
Asn Gln Leu Met Gln Trp Ser His Arg Gly Val Phe Gln Glu Leu Ile
865 870 875 880
Asn Gln Ala Gln Val His Asp Leu Leu Val Gly Thr Met Tyr Ala Ala
885 890 895
Phe Ser Ser Arg Phe Asp Ala Arg Thr Gly Ala Pro Gly Ile Arg Cys
900 905 910
Arg Arg Val Pro Ala Arg Cys Thr Gln Glu His Asn Pro Glu Pro Phe
915 920 925
Pro Trp Trp Leu Asn Lys Phe Val Val Glu His Thr Leu Asp Ala Cys
930 935 940
Pro Leu Arg Ala Asp Asp Leu Ile Pro Thr Gly Glu Gly Glu Ile Phe
945 950 955 960
Val Ser Pro Phe Ser Ala Glu Glu Gly Asp Phe His Gln Ile His Ala
965 970 975
Asp Leu Asn Ala Ala Gln Asn Leu Gln Gln Arg Leu Trp Ser Asp Phe
980 985 990
Asp Ile Ser Gln Ile Arg Leu Arg Cys Asp Trp Gly Glu Val Asp Gly
995 1000 1005
Glu Leu Val Leu Ile Pro Arg Leu Thr Gly Lys Arg Thr Ala Asp
1010 1015 1020
Ser Tyr Ser Asn Lys Val Phe Tyr Thr Asn Thr Gly Val Thr Tyr
1025 1030 1035
Tyr Glu Arg Glu Arg Gly Lys Lys Arg Arg Lys Val Phe Ala Gln
1040 1045 1050
Glu Lys Leu Ser Glu Glu Glu Ala Glu Leu Leu Val Glu Ala Asp
1055 1060 1065
Glu Ala Arg Glu Lys Ser Val Val Leu Met Arg Asp Pro Ser Gly
1070 1075 1080
Ile Ile Asn Arg Gly Asn Trp Thr Arg Gln Lys Glu Phe Trp Ser
1085 1090 1095
Met Val Asn Gln Arg Ile Glu Gly Tyr Leu Val Lys Gln Ile Arg
1100 1105 1110
Ser Arg Val Pro Leu Gln Asp Ser Ala Cys Glu Asn Thr Gly Asp
1115 1120 1125
Ile
<210> 5
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Reporter 10
<400> 5
<210> 6
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> Reporter 15
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reporter 20
<400> 7
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Reporter 25
<400> 8
ttgtttgcgt ttgtttgcgt ttgtt 25
<210> 9
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Reporter 36
<400> 9
acatgcgctt tgatgcagag ttcacttttg ttgcgt 36
Claims (10)
1. A method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with a type V CRISPR/CAS effector protein, a gRNA (guide RNA) comprising a region that binds to the CRISPR/CAS effector protein and a guide sequence that hybridizes to the target nucleic acid, the type V CRISPR/CAS effector protein selected from one or a combination of two of CAS12i, CAS12 j; detecting a detectable signal generated by the CRISPR/CAS effector protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid;
the single-stranded nucleic acid detector contains 21 to 29 arbitrary bases, preferably 21 to 25 arbitrary bases, and preferably 25 arbitrary bases.
2. The method of claim 1, wherein the amino acid sequence of Cas12i is 80% homologous to SEQ ID No.1 and the amino acid sequence of Cas12j is 80% homologous to SEQ ID No. 2.
3. The method of claim 1 or 2, wherein the detectable signal is detected by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal-based detection, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.
4. The method according to any one of claims 1 to 3, wherein different reporter groups are provided at the 5 'end and the 3' end of the single-stranded nucleic acid detector, respectively, or different marker molecules are provided at the both ends of the single-stranded nucleic acid detector, respectively.
5. Use of a single stranded nucleic acid detector as claimed in any of the methods of claims 1 to 4 in the preparation of a composition, reagent or kit for detecting a target nucleic acid in a sample.
6. Use of the single-stranded nucleic acid detector described in any one of the methods of claims 1 to 4 for improving the detection efficiency of a nucleic acid detecting composition, a nucleic acid detecting reagent, or a nucleic acid detecting kit.
7. A composition for detecting a target nucleic acid in a sample, comprising a type V CRISPR/CAS effector protein, a gRNA (guide RNA), and a single-stranded nucleic acid detector; the gRNA comprises a region combined with the CRISPR/CAS effector protein and a guide sequence hybridized with a target nucleic acid, the V-type CRISPR/CAS effector protein is selected from one or two combinations of Cas12i and Cas12j, and the single-stranded nucleic acid detector comprises 21-29 arbitrary bases, preferably 21-25 arbitrary bases, and preferably 25 arbitrary bases.
8. A kit for detecting a target nucleic acid in a sample, comprising a V-type CRISPR/CAS effector protein, a gRNA (guide RNA) comprising a region binding to the CRISPR/CAS effector protein and a guide sequence hybridizing to the target nucleic acid, the V-type CRISPR/CAS effector protein being selected from one or a combination of two of CAS12i, CAS12j, and a single-stranded nucleic acid detector comprising 21 to 29 arbitrary bases, preferably 21 to 25 arbitrary bases, preferably 25 arbitrary bases.
9. Use of the composition of claim 7 or the kit of claim 8 for nucleic acid detection.
10. A method of cleaving a single-stranded nucleic acid detector, the method comprising contacting the single-stranded nucleic acid detector with a target nucleic acid, a V-type CRISPR/CAS effector protein, and a gRNA (guide RNA), the gRNA comprising a region that binds to the CRISPR/CAS effector protein and a guide sequence that hybridizes to the target nucleic acid, the V-type CRISPR/CAS effector protein being selected from one or a combination of CAS12i and CAS12j, the single-stranded nucleic acid being a single-stranded nucleic acid detector comprising 21 to 29 arbitrary bases, preferably a single-stranded nucleic acid detector of 21 to 25 arbitrary bases, preferably a single-stranded nucleic acid detector of 25 arbitrary bases.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011295714.1A CN114517224A (en) | 2020-11-18 | 2020-11-18 | Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011295714.1A CN114517224A (en) | 2020-11-18 | 2020-11-18 | Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector |
Publications (1)
Publication Number | Publication Date |
---|---|
CN114517224A true CN114517224A (en) | 2022-05-20 |
Family
ID=81595440
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011295714.1A Pending CN114517224A (en) | 2020-11-18 | 2020-11-18 | Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114517224A (en) |
-
2020
- 2020-11-18 CN CN202011295714.1A patent/CN114517224A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111996236B (en) | Method for detecting target nucleic acid based on CRISPR technology | |
CN111690720B (en) | Method for detecting target nucleic acid using modified single-stranded nucleic acid | |
CN111690773B (en) | Method and system for detecting target nucleic acid by using novel Cas enzyme | |
CN113801917B (en) | Method for detecting multiple nucleic acids based on CRISPR technology | |
CN111690717B (en) | Method and system for detecting target nucleic acid based on CRISPR technology | |
CN112795624B (en) | Method for detecting target nucleic acid using nucleic acid detector containing abasic spacer | |
CN111733216A (en) | Method for improving detection efficiency of target nucleic acid | |
CN113667718B (en) | Method for detecting target nucleic acid by double-stranded nucleic acid detector | |
CN111876469B (en) | Method for detecting target nucleic acid by using nucleic acid analogue | |
CN113913499A (en) | Method for detecting target mutation by using Cas12j effector protein | |
CN113980957A (en) | Single-stranded DNA probe based on CRISPR/Cas12a and method for detecting target nucleic acid | |
CN113913498A (en) | Method for detecting target mutation based on CRISPR technology | |
CN114634972B (en) | Method for detecting nucleic acid by using Cas enzyme | |
CN113293198B (en) | Method for performing multiple detection on target nucleic acid based on CRISPR technology | |
CN113234795B (en) | Method for detecting nucleic acid by using Cas protein | |
CN114517224A (en) | Method for detecting nucleic acid by using optimized single-stranded nucleic acid detector | |
CN115707775A (en) | Method for detecting African swine fever virus based on CRISPR technology | |
CN113913497A (en) | Method for detecting target nucleic acid using base-modified single-stranded nucleic acid | |
WO2021254267A1 (en) | Method for detecting target nucleic acid using nucleic acid analogue or base modification | |
CN114507665B (en) | Method for detecting cucumber green mottle mosaic virus based on CRISPR technology | |
CN115044649A (en) | Improved method for detecting target nucleic acid based on CRISPR technology | |
CN117587163A (en) | Method for detecting African swine fever by using Cas enzyme | |
CN114058735A (en) | Method for detecting hand-foot-and-mouth disease based on CRISPR technology | |
CN114457073A (en) | Method for detecting mycobacterium paratuberculosis based on CRISPR technology | |
CN114480384A (en) | Method for detecting foot-and-mouth disease virus based on CRISPR technology |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |