CN114438056B

CN114438056B - CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

Info

Publication number: CN114438056B
Application number: CN202210204370.1A
Authority: CN
Inventors: 刘文平; 蔡勤安; 马瑞; 郭东全; 郭东梅; 鲁昕; 于志晶; 李源; 魏嘉
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2023-11-21
Anticipated expiration: 2042-03-03
Also published as: CN116555226A; CN114438056A

Abstract

The invention discloses a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing, and relates to the technical field of gene editing. The amino acid sequence of the CasF2 protein is shown as SEQ ID No. 2; or substitution, deletion or addition of one or more amino acids as compared to the sequence shown in SEQ ID No.2, and has the same or similar biological function. The CRISPR/Cas gene editing system comprises a CasF2 protein or a plasmid expressing the CasF2 protein. The invention provides a novel efficient and stable gene editing system, which can use shorter sgRNA to guide CasF2 to edit target sequences, and can generate insertion or deletion of DNA sequences.

Description

CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

Technical Field

The invention relates to the technical field of gene editing, in particular to a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing.

Background

The gene editing technology is a scientific technology which is emerging in recent years and can be used for targeted silencing and modifying genes to create a novel non-transgenic material. The CRISPR/Cas (clustered regularly interspaced short palindromic repeatsand CRISPR-associated protein) system has the advantages of simple construction, low cost, high accuracy, capability of editing a plurality of genes simultaneously, high efficiency and good application prospect.

Currently, the main among CRISPR/Cas systems are Cas9, cas12 and Cas13. However, the molecular weight of these Cas genes is large and the PAM recognition sequence range is narrow. Therefore, development of new Cas genes for gene editing in plants is urgent. The development of a new gene editing system can provide an effective tool for crop gene editing breeding so as to achieve the expected aim.

There is currently no report in detail about the use of CasF2 genes to construct CRISPR gene editing vectors in crops such as arabidopsis, tobacco, soybean and maize in Cas gene families.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing; the invention provides a novel efficient and stable gene editing system, which can use shorter sgRNA to guide CasF2 to edit target sequences, and can generate insertion or deletion of DNA sequences.

The technical scheme provided by the invention is as follows:

in one aspect, the invention provides a CasF2 protein, the amino acid sequence of which CasF2 protein is shown in SEQ ID No. 2; or the amino acid sequence of the CasF2 protein is a substitution, deletion or addition of one or more amino acids compared with the sequence shown in SEQ ID NO.2, and has the same or similar biological functions.

The amino acid sequence shown in SEQ ID No.2 is shown below:

MDYKDHDGDYKDHDIDYKDDDDKMAPKKKRKVGIHGVPAAPKPAVESEFSKVLKKHFPGERFRSSYMKRGGKILAAQGEEAVVAYLQGKSEEEPPNFQPPAKCHVVTKSRDFAEWPIMKASEAIQRYIYALSTTERAACKPGKSSESHAAWFAATGVSNHGYSHVQGLNLIFDHTLGRYDGVLKKVQLRNEKARARLESINASRADEGLPEIKAEEEEVATNETGHLLQPPGINPSFYVYQTISPQAYRPRDEIVLPPEYAGYVRDPNAPIPLGVVRNRCDIQKGCPGYIPEWQREAGTAISPKTGKAVTVPGLSPKKNKRMRRYWRSEKEKAQDALLVTVRIGTDWVVIDVRGLLRNARWRTIAPKDISLNALLDLFTGDPVIDVRRNIVTFTYTLDACGTYARKWTLKGKQTKATLDKLTATQTVALVAIDLGQTNPISAGISRVTQENGALQCEPLDRFTLPDDLLKDISAYRIAWDRNEEELRARSVEALPEAQQAEVRALDGVSKETARTQLCADFGLDPKRLPWDKMSSNTTFISEALLSNSVSRDQVFFTPAPKKGAKKKAPVEVMRKDRTWARAYKPRLSVEAQKLKNEALWALKRTSPEYLKLSRRKEELCRRSINYVIEKTRRRTQCQIVIPVIEDLNVRFFHGSGKRLPGWDNFFTAKKENRWFIQGLHKAFSDLRTHRSFYVFEVRPERTSITCPKCGHCEVGNRDGEAFQCLSCGKTCNADLDVATHNLTQVALTGKTMPKREEPRDAQGTAPARKTKKASKSKAPPAEREDQTPAQEPSQTSKRPAATKKAGQAKKKK。

the CasF2 protein is RNA nuclease and has the following activities: activity of binding to a specific site of a target sequence and cleaving a nucleic acid or recognition of PAM site, endonuclease activity. In one embodiment, the CasF2 protein may have a sequence similarity of 95% or more, preferably 97% or more, more preferably 98% or more, and most preferably 99% or more, as compared to the amino acid sequence shown in SEQ ID No.2, so long as it has the same function as the amino acid sequence shown in SEQ ID No. 2.

The invention also provides a coding gene of the CasF2 protein, and the nucleotide sequence of the coding gene is shown in the following SEQ ID No. 1:

ATGGATTACAAGGATCACGACGGTGATTACAAGGACCATGATATCGACTACAAGGATGACGATGACAAGATGGCGCCTAAGAAGAAGAGAAAAGTGGGAATTCACGGTGTTCCTGCTGCCCCAAAGCCGGCCGTGGAGTCAGAGTTCTCTAAGGTTCTTAAGAAGCATTTCCCGGGCGAGCGCTTCAGATCTTCCTACATGAAGAGGGGCGGAAAGATCCTGGCGGCTCAGGGAGAGGAGGCTGTGGTTGCCTACCTCCAGGGCAAGAGCGAGGAGGAGCCTCCAAACTTCCAGCCGCCTGCTAAGTGCCACGTCGTGACTAAGTCAAGAGATTTCGCCGAGTGGCCAATTATGAAGGCGTCAGAGGCTATCCAGCGCTACATTTACGCTCTGTCTACTACCGAGAGAGCCGCGTGCAAGCCGGGCAAGTCTTCTGAGAGCCACGCTGCTTGGTTCGCTGCTACAGGCGTCTCAAACCACGGATACTCTCATGTGCAGGGACTCAATCTTATCTTCGATCATACTCTCGGAAGATACGACGGCGTTCTGAAGAAGGTCCAGCTCCGCAACGAGAAGGCTAGGGCCCGCCTTGAGTCAATCAATGCTTCTAGGGCTGACGAGGGCCTGCCTGAGATTAAGGCTGAGGAGGAGGAGGTCGCCACCAACGAGACAGGTCATCTCCTTCAGCCACCGGGCATCAATCCATCCTTCTACGTGTACCAGACAATTAGCCCTCAGGCTTACAGACCAAGGGATGAGATCGTGCTCCCTCCAGAGTACGCGGGTTACGTTAGAGATCCTAACGCTCCTATTCCACTTGGCGTTGTCCGCAATAGATGCGATATCCAGAAGGGCTGCCCAGGATACATTCCGGAGTGGCAGAGGGAGGCTGGAACTGCCATTTCCCCGAAGACTGGAAAGGCCGTCACCGTGCCTGGCCTCAGCCCAAAGAAGAACAAGAGGATGAGAAGGTACTGGCGCTCAGAGAAGGAGAAGGCGCAGGACGCTCTGCTCGTTACAGTCAGAATCGGAACTGATTGGGTGGTTATTGACGTGCGCGGTCTTCTGAGAAACGCGAGGTGGCGCACTATCGCTCCAAAGGATATTTCTCTTAATGCCCTCCTTGACCTGTTCACCGGAGATCCGGTCATCGACGTGCGCAGAAATATTGTTACCTTCACATACACTCTCGATGCTTGCGGCACCTACGCCAGGAAGTGGACACTTAAGGGAAAGCAGACTAAGGCTACCCTTGATAAGCTGACCGCCACACAGACTGTTGCCCTTGTCGCGATCGACCTGGGCCAGACCAACCCTATCTCCGCCGGAATTAGCCGCGTCACACAGGAGAATGGTGCGCTCCAGTGCGAGCCACTTGATAGATTCACTCTGCCGGATGACCTGCTCAAGGATATCTCTGCGTACAGAATTGCTTGGGACAGGAACGAGGAGGAGCTTAGAGCGAGGTCCGTTGAGGCTCTGCCAGAGGCTCAGCAGGCCGAAGTTAGGGCTCTCGATGGCGTCAGCAAGGAGACAGCCAGGACTCAGCTCTGCGCGGATTTCGGACTCGACCCGAAGAGGCTTCCTTGGGATAAGATGTCTTCCAACACAACTTTCATCTCAGAGGCTCTTCTGAGCAATTCAGTCTCTCGCGACCAGGTGTTCTTCACCCCGGCCCCTAAGAAGGGTGCTAAGAAGAAGGCGCCTGTGGAGGTTATGCGCAAGGATAGAACATGGGCGCGCGCTTACAAGCCAAGACTCTCTGTGGAGGCCCAGAAGCTTAAGAATGAGGCGCTCTGGGCTCTTAAGAGAACCTCCCCAGAGTACCTGAAGCTCAGCAGGCGCAAGGAGGAGCTTTGCAGAAGGTCTATCAACTACGTTATTGAGAAGACACGCAGAAGGACTCAGTGCCAGATCGTGATTCCGGTTATTGAGGATCTTAATGTCAGATTCTTCCACGGTTCCGGCAAGAGGCTGCCTGGTTGGGACAACTTCTTCACTGCCAAGAAGGAGAATAGATGGTTCATCCAGGGCCTGCACAAGGCGTTCTCAGATCTCAGGACCCATCGCTCTTTCTACGTCTTCGAAGTGAGGCCTGAGAGGACCTCTATTACATGCCCAAAGTGCGGACACTGCGAGGTTGGAAACAGGGACGGAGAGGCTTTCCAGTGCCTCTCCTGCGGAAAGACCTGCAACGCCGATCTTGACGTTGCGACCCATAATCTGACACAGGTCGCCCTCACTGGAAAGACCATGCCGAAGAGGGAGGAGCCTAGGGATGCTCAGGGTACTGCTCCAGCTAGGAAGACCAAGAAGGCTTCCAAGAGCAAGGCTCCACCTGCTGAGAGGGAGGACCAGACACCAGCTCAGGAGCCGTCCCAGACAAGCAAGAGGCCTGCCGCGACTAAGAAGGCTGGACAGGCTAAGAAGAAGAAGTGA。

the CasF2 gene is Cas gene of Cas12j type, with the potential of deletion of long fragment DNA sequences. The PAM recognition sequence of the CasF2 gene is: 5'-TBN-3' (b=g/T/C), and CasF2 has high site-specificity for the recognized target sequence. The target sequence of the CasF2 editing system is 18bp. CasF2 has more editable sites on genomic DNA and a wider range of potential target targets.

The invention may also include a nucleotide sequence that is reverse complementary to the nucleotide sequence of the CasF2 protein shown in SEQ ID No. 1.

In another aspect, the invention also provides an expression vector comprising the nucleotide sequence as described above. The expression vector can express the CasF2 protein in the target cell, so that corresponding gene editing can be performed in the target cell. Commonly used vectors may be, for example, pBI121 vectors and PCAMBIA1300 vectors, etc.

The invention may also include recombinant cells comprising the expression vector, preferably the recombinant cells are eukaryotic cells, more preferably the recombinant cells are plant cells.

In another aspect, the invention also provides the use of the CasF2 protein, the gene encoding the CasF2 protein or the expression vector in gene editing.

In another aspect, the invention also provides a CRISPR/Cas gene editing system comprising the aforementioned CasF2 protein or a plasmid expressing the CasF2 protein.

In one embodiment, the gene editing system further comprises an sgRNA or a plasmid expressing an sgRNA, e.g., the expression plasmid contains a gene encoding the sgRNA.

Both sgrnas can be used to guide CasF2 protein to perform gene editing at the target gene sequence position in the acceptor material, and when using the sgRNA3 sequence shown in SEQ ID No.3, the CasF2 protein has the function of processing the sgRNA sequence, and can cut the sgRNA3 into dgRNA1 sequence, thereby guiding CasF2 to perform gene editing at the target site. The sgrnas may be one or more sgrnas for targeting one or more target genes. The sgrnas include nucleotides that contain their corresponding recognition region sequences.

In another aspect, the invention provides the use of the CRISPR/Cas gene editing system in plant gene editing; preferably, the plant is a monocot or dicot; more preferably, the plant is selected from any one of arabidopsis thaliana, tobacco, soybean, and corn.

In one embodiment, the application comprises the steps of:

(a) Determining sgRNA of a gene to be edited according to the PAM recognition site of the CasF2 protein;

(b) Cloning the gene sequence of the CasF2 protein and the corresponding sgRNA into an expression vector;

(c) Transforming the expression vector into agrobacterium, and introducing the expression vector into a target plant by using an agrobacterium-mediated genetic transformation method to obtain a targeted gene editing plant;

preferably, in said genetic transformation, mgCl is used ₂ Activating the gene editing activity.

The editing activity of the CasF2 gene requires a certain concentration of Mg ²⁺ Can be activated. When CasF2 exists in the plant body, a certain concentration of Mg is not added additionally ²⁺ CasF2 does not edit the target site in the cell.

In one embodiment, the plant is Arabidopsis thaliana, and the nucleotide sequence corresponding to the sgRNA (sgRNA 3 sequence) is shown in SEQ ID No. 3. Specifically, SEQ ID No.3:

TAATGTCGGAACGCTCAACGATTGCCCCTCACGAGGGGAC-N ₁₈ (target sequence).

In one embodiment, the plant is tobacco and the nucleotide sequence corresponding to the sgRNA (sgRNA 1 sequence) is as shown in SEQ ID No. 4. Specifically, SEQ ID No.4:

CGCTCAACGATTGCCCCTCACGAGGGGAC-N ₁₈ (target sequence).

In one embodiment, the invention provides a sgRNA target sequence of the plant arabidopsis BRI1 gene; the nucleotide sequence of the sgRNA target sequence is shown as SEQ ID No. 5.

Specifically, SEQ ID No.5: CTGCGAATTCAATCTCCG.

In one embodiment, the invention provides an sgRNA target sequence of a plant tobacco PDS gene; the nucleotide sequence of the sgRNA target sequence is shown as SEQ ID No. 6.

Specifically, SEQ ID No.6: GTAGTAGCGACTCCATGG.

Based on the application of the CRISPR/Cas gene editing system in plant gene editing, the invention also provides a method for carrying out gene editing on plants by using the gene editing carrier system.

In the present invention, the CasF2 protein and the sgRNA in the CRISPR/Cas system can be in the same expression vector or in different expression vectors.

In the present invention, the shorthand "CRISPR" or "CRISPR" each refer to a short palindromic repeat of regular clustered intervals, an acronym for Clustered regularly interspaced short palindromic repeats. In the case of a nucleotide sequence, unless otherwise specified, the base represented by the letter N has a meaning common in the art, that is, N represents a random or arbitrary base A, T, C or G.

As used herein, "comprising," having, "or" including "includes" including, "" consisting essentially of … …, "" consisting essentially of … …, "and" consisting of … ….

The beneficial effects are that:

the invention provides a novel CasF2 protein and a high-efficiency and stable Cas-mediated gene editing vector, which can be stably and efficiently expressed in plant cells, thereby better regulating and controlling the expression of target genes. The small number of amino acids of the CasF2 protein provides advantages for delivery into plant cells (for ease of packaging and delivery), and CasF2 uses a single active site for crRNA processing and cleavage of DNA sequences. The CasF2 has wide PAM recognition sites, and can construct a plurality of gene editing site vectors to realize knockout of more genes. The invention can be used for gene editing of DNA sequences in Arabidopsis thaliana, tobacco, soybean and maize.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the results of PCR sequencing provided by the examples of the present invention;

FIG. 2 is a phenotypic chart of an Arabidopsis BRI1 gene-edited plant obtained by a CRISPR/CasF2 gene editing system according to an embodiment of the present invention;

FIG. 3 is a schematic diagram of a sgRNA 3T plasmid vector provided in an embodiment of the present invention;

FIG. 4 is a schematic diagram of a pHCasF2 vector provided in an embodiment of the present invention;

FIG. 5 is a schematic diagram of a sgRNA1T plasmid provided in an embodiment of the present invention;

fig. 6 is a diagram of a tobacco tissue culture result provided by an embodiment of the present invention;

fig. 7 is a sequencing diagram of tobacco PDS target sequences provided in an embodiment of the present invention.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

1. Targeting strategy for arabidopsis thaliana target gene BRI 1:

arabidopsis thaliana (Arabidopsis thaliana) brassinolide receptor BRI1 is used as a target gene, and the Arabidopsis thaliana BRI1 is directionally edited by using CRISPR/CasF 2.

CasF2/sgRNA design:

based on the PAM sequence recognized by CasF2, the nucleotide sequence of the sgRNA target of arabidopsis BRI1 (target sequence SEQ ID No. 5) (5 '-3'): CTGCGAATTCAATCTCCG.

2. Editing of the BRI1 Gene of Arabidopsis thaliana

Constructing the sgRNA of the BRI1 gene of the Arabidopsis thaliana, and selecting the AtU-26 promoter of the Arabidopsis thaliana to drive the expression of the sgRNA sequence; meanwhile, a AtU-26 terminator sequence was added after the sgRNA sequence. The CRISPR/CasF2 gene editing vector of the sgRNA was driven with the arabidopsis U6 promoter.

The targeted sgRNA sequence was amplified using KOD-plus neo with the sgRNA 3T plasmid (fig. 3 is a schematic of a plasmid vector) as template. Round 1 PCR, amplification System (20. Mu.L):

primer pair: u6-26p-F+F2BRI1-gRNA-R amplification 1 tube, primer pair: f2BRI1-U6-26t-F+U6-26t-R amplification 1 tube.

U6-26p-F(SEQ ID No.7)：

TTCAGAggtctcTtagtCGACTTGCCTTCCGCACAATAC；

U6-26t-R(SEQ ID No.8)：

AGCGTGggtctcGcgccTATTGGTTTATCTCATCGGAAC；

F2BRI1-U6-26t-F(SEQ ID No.9)：

(wherein the underlined part is bolded as the target sequence)

F2BRI1-gRNA-R(SEQ ID No.10)：

CGGAGATTGAATTCGCAGGTCCCCTCGTGAGGGGCAATC。

PCR reaction procedure:

after the completion of PCR amplification, 2. Mu.L of each of the 2-tube PCR products was used as a template for performing round 2 PCR.

Amplification system:

the reaction procedure:

after the completion of round 2 PCR, 1. Mu.L of the PCR product was used as a template for round 3 PCR. The reaction system and the amplification system are the same as those of round 1. After the amplification, agarose gel electrophoresis was performed.

After gel recovery of the PCR product, it was ligated with pHCasF2 vector (FIG. 4 is a schematic vector).

The connection system is as follows:

ligation reaction: 5min at 37℃and 5min at 10 ℃;20 ℃ for 5min;15 cycles, 5min at 37 ℃.

Ligation product transformation E.coli DH 5. Alpha. Competence was spread on LB (Kan ⁺ ) And (3) on a flat plate. Colonies were picked from the plates and sent to company for sequencing verification.

The constructed BRI1 gene targeting expression vector pHCasF2-BRI1 converts agrobacterium GV3101.

And (5) selecting agrobacterium to infect the arabidopsis thaliana in the full bloom stage. The steps of infecting arabidopsis thaliana by the agrobacterium method are as follows: agrobacterium strain 20. Mu.L was pipetted into 3mL yeast liquid medium (5248, YEB) (kan) ⁺ 、Rif ⁺ ) In (a) and (b); shaking for 24h at 28 ℃ and 200 rpm;

collecting the strain by shaking at 12,000rpm and 1min, removing supernatant, re-suspending the precipitate with 1mL5% sucrose 1/2MS solution, and collecting the strain again; finally, 1mL of 5% sucrose 1/2MS solution was used, while 0.2. Mu.L of Silwet77 and a final concentration of 10mM MgCl were added ₂ After fully and evenly mixing, the arabidopsis thaliana can be infected.

Resistant seedlings were screened and sequenced:

after the arabidopsis seeds are ripe, the seeds are harvested. Seeds were sown on 1/2MS medium plates containing 50mg/L hygromycin and resistant seedlings were picked.

The DNA sequence near the target site was amplified by PCR and the PCR product was sequenced by the company. The arabidopsis plants whose BRI1 gene was edited were photographed.

PCR amplification primers for DNA amplification near target sequences:

F2BRI1crispr-identify-F(SEQ ID No.11)：

CTGGCTTCAAGTGCTCTGCTTC；

F2BRI1crispr-identify-R(SEQ ID No.12)：

GTAATTCGCCGGAAAACTCG。

the amplification system was the same as that of round 1 PCR.

Analysis of experimental results:

(1) No MgCl with final concentration of 10mM is added into the invasion solution for infecting Arabidopsis thaliana ₂ Plants in which BRI1 gene was edited were not found, only when 10mM MgCl was added ₂ The arabidopsis plants infected by the infection liquid of the (a) only appear plants with the BRI1 gene edited.

(2) Amplifying a DNA sequence near a BRI1 target, and finding that the target has a sleeve peak (shown in FIG. 1) through sequencing; and the arabidopsis plants developed a sterile phenotype, consistent with reported literature results (shown in fig. 2).

The results show that: mgCl is required for gene editing of CasF2 protein in Arabidopsis thaliana ₂ And can carry out gene editing on the Arabidopsis genes to generate insertion and deletion of DNA sequences.

Example 2

1. The present smoke PDS gene targeting strategy:

the phytoene dehydrogenase PDS of Nicotiana benthamiana (Nicotiana benthamiana) is used as a target gene, and CRISPR/CasF2 is utilized for directionally editing the PDS of Nicotiana benthamiana.

CasF2/sgRNA design:

based on the PAM sequence recognized by CasF2, the nucleotide sequence of the sgRNA target of the nicotiana benthamiana PDS (target sequence SEQ ID No. 6) (5 '-3'): GTAGTAGCGACTCCATGG.

2. Editing of the BRI1 Gene of Arabidopsis thaliana

Editing of the PDS gene of Nicotiana benthamiana

The construction method of the sgRNA of tobacco PDS gene is the same as that of Arabidopsis thaliana, the BRI1 target primer of Arabidopsis thaliana is replaced by the PDS target primer of tobacco, and the template for amplifying the sgRNA sequence is replaced by the sgRNA1T plasmid (FIG. 5 is a schematic diagram of a vector). The target primers of tobacco PDS gene are as follows:

F2NtPDS-U6-26t-F(SEQ ID No.13)：

(wherein the underlined part is bolded as the target sequence)

F2NtPDS-gRNA-R(SEQ ID No.14)：

CCATGGAGTCGCTACTACGTCCCCTCGTGAGGGGCAATC。

The constructed tobacco targeting PDS gene plasmid pHCasF2-PDS converts agrobacterium GV3101, and the leaf disc method converts tobacco, and the specific steps are as follows:

1. blade disinfection:

1) Selecting leaf blades of Benshi tobacco growing for 1-2 months, placing the leaf blades into a beaker, and soaking the leaf blades in sterile water for 20-30min;

2) Pouring out sterile water, soaking the leaves in 0.6% sodium hypochlorite (1 drop of Tween-20 is added to each 50mL of solution), and soaking the leaves in the water for 10min;

3) Washing with sterile water for 5 times,

2. leaf infection:

1) Cutting the blade edge with a sterilizing scissors or a puncher to obtain 1cm blade ² The size of the culture medium avoids the main veins of the leaves, and the leaves are put into the liquid co-culture medium;

2) All the sheared leaves are transferred into the infection liquid to be infected for 8min; then sucking the dyeing liquid on the surface of the blade by using sterile filter paper;

3) Rapidly placing the leaves on a solid co-culture medium, and culturing the leaves for 48 hours at 25 ℃ in a dark way with the back surfaces of the leaves facing downwards;

4) The leaves were transferred to the selection medium, which was changed every 10 days at 25℃with 16h light/8 h dark until the transformed cells differentiated adventitious buds.

5) Albino seedling is selected for photographing, albino seedling genome DNA is extracted, DNA sequences near the target point are amplified by using the primer, and PCR products are sent to a company for sequencing.

PCR amplification primers for DNA amplification near target sequences:

NtPDS-seq-F(SEQ ID No.15)：ATGCCCCAAATTGGACTTGTTTC；

NtPDS1-23-R(SEQ ID No.16)：CTGGAGCGTGGACAACATAAAT。

the method for constructing the tobacco sgRNA target is the same as that for constructing an Arabidopsis thaliana system.

Analysis of experimental results:

according to the result of gene editing of Arabidopsis thaliana, mgCl is required for CasF2 protein to exert gene editing ₂ Is active, and edits the target DNA sequence at the direction of the sgRNA. Thus, in tobacco PDS genome culture, mgCl was added to the selection medium at a final concentration of 100nM ₂ The method comprises the steps of carrying out a first treatment on the surface of the Albino seedlings were produced after 2 rounds of screening media after infection by agrobacterium (see fig. 6). Without the addition of MgCl ₂ In the screening medium of (2), green differentiated seedlings are produced. Sequencing the target sequence of albino seedlings shows that the base deletion occurs in the target sequence. Tobacco PDS target sequence sequencing figure 7.

Meanwhile, in arabidopsis thaliana, the sgRNA3 sequence was used as the sgRNA sequence, and in tobacco, the sgRNA1 sequence was used as the sgRNA sequence. Analysis of the constructed Arabidopsis thaliana sgRNA3 guide sequence and tobacco sgRNA1 guide sequence shows that the CasF2 protein can treat pre-crRNA, and the shorter sequence sgRNA1 can be used for guiding the cutting of a target sequence of the CasF 2. Thus, multiple sgrnas can be constructed simultaneously for polygenic targeting.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

SEQUENCE LISTING

<110> Jilin province academy of agricultural sciences

<120> CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

<130> PA20037888

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 2439

<212> DNA

<213> CasF2 Gene

<400> 1

atggattaca aggatcacga cggtgattac aaggaccatg atatcgacta caaggatgac 60

gatgacaaga tggcgcctaa gaagaagaga aaagtgggaa ttcacggtgt tcctgctgcc 120

ccaaagccgg ccgtggagtc agagttctct aaggttctta agaagcattt cccgggcgag 180

cgcttcagat cttcctacat gaagaggggc ggaaagatcc tggcggctca gggagaggag 240

gctgtggttg cctacctcca gggcaagagc gaggaggagc ctccaaactt ccagccgcct 300

gctaagtgcc acgtcgtgac taagtcaaga gatttcgccg agtggccaat tatgaaggcg 360

tcagaggcta tccagcgcta catttacgct ctgtctacta ccgagagagc cgcgtgcaag 420

ccgggcaagt cttctgagag ccacgctgct tggttcgctg ctacaggcgt ctcaaaccac 480

ggatactctc atgtgcaggg actcaatctt atcttcgatc atactctcgg aagatacgac 540

ggcgttctga agaaggtcca gctccgcaac gagaaggcta gggcccgcct tgagtcaatc 600

aatgcttcta gggctgacga gggcctgcct gagattaagg ctgaggagga ggaggtcgcc 660

accaacgaga caggtcatct ccttcagcca ccgggcatca atccatcctt ctacgtgtac 720

cagacaatta gccctcaggc ttacagacca agggatgaga tcgtgctccc tccagagtac 780

gcgggttacg ttagagatcc taacgctcct attccacttg gcgttgtccg caatagatgc 840

gatatccaga agggctgccc aggatacatt ccggagtggc agagggaggc tggaactgcc 900

atttccccga agactggaaa ggccgtcacc gtgcctggcc tcagcccaaa gaagaacaag 960

aggatgagaa ggtactggcg ctcagagaag gagaaggcgc aggacgctct gctcgttaca 1020

gtcagaatcg gaactgattg ggtggttatt gacgtgcgcg gtcttctgag aaacgcgagg 1080

tggcgcacta tcgctccaaa ggatatttct cttaatgccc tccttgacct gttcaccgga 1140

gatccggtca tcgacgtgcg cagaaatatt gttaccttca catacactct cgatgcttgc 1200

ggcacctacg ccaggaagtg gacacttaag ggaaagcaga ctaaggctac ccttgataag 1260

ctgaccgcca cacagactgt tgcccttgtc gcgatcgacc tgggccagac caaccctatc 1320

tccgccggaa ttagccgcgt cacacaggag aatggtgcgc tccagtgcga gccacttgat 1380

agattcactc tgccggatga cctgctcaag gatatctctg cgtacagaat tgcttgggac 1440

aggaacgagg aggagcttag agcgaggtcc gttgaggctc tgccagaggc tcagcaggcc 1500

gaagttaggg ctctcgatgg cgtcagcaag gagacagcca ggactcagct ctgcgcggat 1560

ttcggactcg acccgaagag gcttccttgg gataagatgt cttccaacac aactttcatc 1620

tcagaggctc ttctgagcaa ttcagtctct cgcgaccagg tgttcttcac cccggcccct 1680

aagaagggtg ctaagaagaa ggcgcctgtg gaggttatgc gcaaggatag aacatgggcg 1740

cgcgcttaca agccaagact ctctgtggag gcccagaagc ttaagaatga ggcgctctgg 1800

gctcttaaga gaacctcccc agagtacctg aagctcagca ggcgcaagga ggagctttgc 1860

agaaggtcta tcaactacgt tattgagaag acacgcagaa ggactcagtg ccagatcgtg 1920

attccggtta ttgaggatct taatgtcaga ttcttccacg gttccggcaa gaggctgcct 1980

ggttgggaca acttcttcac tgccaagaag gagaatagat ggttcatcca gggcctgcac 2040

aaggcgttct cagatctcag gacccatcgc tctttctacg tcttcgaagt gaggcctgag 2100

aggacctcta ttacatgccc aaagtgcgga cactgcgagg ttggaaacag ggacggagag 2160

gctttccagt gcctctcctg cggaaagacc tgcaacgccg atcttgacgt tgcgacccat 2220

aatctgacac aggtcgccct cactggaaag accatgccga agagggagga gcctagggat 2280

gctcagggta ctgctccagc taggaagacc aagaaggctt ccaagagcaa ggctccacct 2340

gctgagaggg aggaccagac accagctcag gagccgtccc agacaagcaa gaggcctgcc 2400

gcgactaaga aggctggaca ggctaagaag aagaagtga 2439

<210> 2

<211> 812

<212> PRT

<213> amino acid sequence of CasF2 protein

<400> 2

Met Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp

1 5 10 15

Tyr Lys Asp Asp Asp Asp Lys Met Ala Pro Lys Lys Lys Arg Lys Val

20 25 30

Gly Ile His Gly Val Pro Ala Ala Pro Lys Pro Ala Val Glu Ser Glu

35 40 45

Phe Ser Lys Val Leu Lys Lys His Phe Pro Gly Glu Arg Phe Arg Ser

50 55 60

Ser Tyr Met Lys Arg Gly Gly Lys Ile Leu Ala Ala Gln Gly Glu Glu

65 70 75 80

Ala Val Val Ala Tyr Leu Gln Gly Lys Ser Glu Glu Glu Pro Pro Asn

85 90 95

Phe Gln Pro Pro Ala Lys Cys His Val Val Thr Lys Ser Arg Asp Phe

100 105 110

Ala Glu Trp Pro Ile Met Lys Ala Ser Glu Ala Ile Gln Arg Tyr Ile

115 120 125

Tyr Ala Leu Ser Thr Thr Glu Arg Ala Ala Cys Lys Pro Gly Lys Ser

130 135 140

Ser Glu Ser His Ala Ala Trp Phe Ala Ala Thr Gly Val Ser Asn His

145 150 155 160

Gly Tyr Ser His Val Gln Gly Leu Asn Leu Ile Phe Asp His Thr Leu

165 170 175

Gly Arg Tyr Asp Gly Val Leu Lys Lys Val Gln Leu Arg Asn Glu Lys

180 185 190

Ala Arg Ala Arg Leu Glu Ser Ile Asn Ala Ser Arg Ala Asp Glu Gly

195 200 205

Leu Pro Glu Ile Lys Ala Glu Glu Glu Glu Val Ala Thr Asn Glu Thr

210 215 220

Gly His Leu Leu Gln Pro Pro Gly Ile Asn Pro Ser Phe Tyr Val Tyr

225 230 235 240

Gln Thr Ile Ser Pro Gln Ala Tyr Arg Pro Arg Asp Glu Ile Val Leu

245 250 255

Pro Pro Glu Tyr Ala Gly Tyr Val Arg Asp Pro Asn Ala Pro Ile Pro

260 265 270

Leu Gly Val Val Arg Asn Arg Cys Asp Ile Gln Lys Gly Cys Pro Gly

275 280 285

Tyr Ile Pro Glu Trp Gln Arg Glu Ala Gly Thr Ala Ile Ser Pro Lys

290 295 300

Thr Gly Lys Ala Val Thr Val Pro Gly Leu Ser Pro Lys Lys Asn Lys

305 310 315 320

Arg Met Arg Arg Tyr Trp Arg Ser Glu Lys Glu Lys Ala Gln Asp Ala

325 330 335

Leu Leu Val Thr Val Arg Ile Gly Thr Asp Trp Val Val Ile Asp Val

340 345 350

Arg Gly Leu Leu Arg Asn Ala Arg Trp Arg Thr Ile Ala Pro Lys Asp

355 360 365

Ile Ser Leu Asn Ala Leu Leu Asp Leu Phe Thr Gly Asp Pro Val Ile

370 375 380

Asp Val Arg Arg Asn Ile Val Thr Phe Thr Tyr Thr Leu Asp Ala Cys

385 390 395 400

Gly Thr Tyr Ala Arg Lys Trp Thr Leu Lys Gly Lys Gln Thr Lys Ala

405 410 415

Thr Leu Asp Lys Leu Thr Ala Thr Gln Thr Val Ala Leu Val Ala Ile

420 425 430

Asp Leu Gly Gln Thr Asn Pro Ile Ser Ala Gly Ile Ser Arg Val Thr

435 440 445

Gln Glu Asn Gly Ala Leu Gln Cys Glu Pro Leu Asp Arg Phe Thr Leu

450 455 460

Pro Asp Asp Leu Leu Lys Asp Ile Ser Ala Tyr Arg Ile Ala Trp Asp

465 470 475 480

Arg Asn Glu Glu Glu Leu Arg Ala Arg Ser Val Glu Ala Leu Pro Glu

485 490 495

Ala Gln Gln Ala Glu Val Arg Ala Leu Asp Gly Val Ser Lys Glu Thr

500 505 510

Ala Arg Thr Gln Leu Cys Ala Asp Phe Gly Leu Asp Pro Lys Arg Leu

515 520 525

Pro Trp Asp Lys Met Ser Ser Asn Thr Thr Phe Ile Ser Glu Ala Leu

530 535 540

Leu Ser Asn Ser Val Ser Arg Asp Gln Val Phe Phe Thr Pro Ala Pro

545 550 555 560

Lys Lys Gly Ala Lys Lys Lys Ala Pro Val Glu Val Met Arg Lys Asp

565 570 575

Arg Thr Trp Ala Arg Ala Tyr Lys Pro Arg Leu Ser Val Glu Ala Gln

580 585 590

Lys Leu Lys Asn Glu Ala Leu Trp Ala Leu Lys Arg Thr Ser Pro Glu

595 600 605

Tyr Leu Lys Leu Ser Arg Arg Lys Glu Glu Leu Cys Arg Arg Ser Ile

610 615 620

Asn Tyr Val Ile Glu Lys Thr Arg Arg Arg Thr Gln Cys Gln Ile Val

625 630 635 640

Ile Pro Val Ile Glu Asp Leu Asn Val Arg Phe Phe His Gly Ser Gly

645 650 655

Lys Arg Leu Pro Gly Trp Asp Asn Phe Phe Thr Ala Lys Lys Glu Asn

660 665 670

Arg Trp Phe Ile Gln Gly Leu His Lys Ala Phe Ser Asp Leu Arg Thr

675 680 685

His Arg Ser Phe Tyr Val Phe Glu Val Arg Pro Glu Arg Thr Ser Ile

690 695 700

Thr Cys Pro Lys Cys Gly His Cys Glu Val Gly Asn Arg Asp Gly Glu

705 710 715 720

Ala Phe Gln Cys Leu Ser Cys Gly Lys Thr Cys Asn Ala Asp Leu Asp

725 730 735

Val Ala Thr His Asn Leu Thr Gln Val Ala Leu Thr Gly Lys Thr Met

740 745 750

Pro Lys Arg Glu Glu Pro Arg Asp Ala Gln Gly Thr Ala Pro Ala Arg

755 760 765

Lys Thr Lys Lys Ala Ser Lys Ser Lys Ala Pro Pro Ala Glu Arg Glu

770 775 780

Asp Gln Thr Pro Ala Gln Glu Pro Ser Gln Thr Ser Lys Arg Pro Ala

785 790 795 800

Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

805 810

<210> 3

<211> 40

<212> DNA

<213> sgRNA3 sequence

<400> 3

taatgtcgga acgctcaacg attgcccctc acgaggggac 40

<210> 4

<211> 29

<212> DNA

<213> sgRNA1 sequence

<400> 4

cgctcaacga ttgcccctca cgaggggac 29

<210> 5

<211> 18

<212> DNA

<213> sgRNA target sequence of Arabidopsis BRI1 Gene

<400> 5

ctgcgaattc aatctccg 18

<210> 6

<211> 18

<212> DNA

<213> sgRNA target sequence of tobacco PDS Gene

<400> 6

gtagtagcga ctccatgg 18

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence U6-26p-F

<400> 7

ttcagaggtc tcttagtcga cttgccttcc gcacaatac 39

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence U6-26t-R

<400> 8

agcgtgggtc tcgcgcctat tggtttatct catcggaac 39

<210> 9

<211> 44

<212> DNA

<213> Artificial sequence F2BRI1-U6-26t-F

<400> 9

ctgcgaattc aatctccgtt ttttttgcaa aattttccag atcg 44

<210> 10

<211> 39

<212> DNA

<213> artificial sequence

<400> 10

cggagattga attcgcaggt cccctcgtga ggggcaatc 39

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence F2BRI1 crispr-identification-F

<400> 11

ctggcttcaa gtgctctgct tc 22

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence F2BRI1 crispr-identifying-R

<400> 12

gtaattcgcc ggaaaactcg 20

<210> 13

<211> 44

<212> DNA

<213> Artificial sequence F2NtPDS-U6-26t-F

<400> 13

gtagtagcga ctccatggtt ttttttgcaa aattttccag atcg 44

<210> 14

<211> 39

<212> DNA

<213> Artificial sequence F2NtPDS-gRNA-R

<400> 14

ccatggagtc gctactacgt cccctcgtga ggggcaatc 39

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence NtPDS-seq-F

<400> 15

atgccccaaa ttggacttgt ttc 23

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence NtPDS1-23-R

<400> 16

ctggagcgtg gacaacataa at 22

Claims

The CasF2 protein is characterized in that the amino acid sequence of the CasF2 protein is shown as SEQ ID No. 2.
2. The CasF2 protein-encoding gene according to claim 1, wherein the nucleotide sequence of the encoding gene is shown in SEQ ID No. 1.
3. An expression vector comprising the nucleotide sequence of claim 2.
4. The CasF2 protein of claim 1, the gene encoding the CasF2 protein of claim 2, or the gene encoding the CasF2 proteinUse of the expression vector of claim 3 for plant gene editing, wherein MgCl is used ₂ Activating the gene editing activity.
5. A CRISPR/Cas gene editing system comprising the CasF2 protein of claim 1 or a plasmid expressing said CasF2 protein, and MgCl ₂ 。
6. The CRISPR/Cas gene editing system according to claim 5, further comprising an sgRNA or a plasmid expressing the sgRNA.
7. The use of the CRISPR/Cas gene editing system according to claim 6 in plant gene editing.
8. The use according to claim 7, wherein the plant is a monocot or dicot.
9. The use according to claim 7, wherein the plant is selected from any one of arabidopsis, tobacco, soybean and maize.
10. The application according to claim 7, characterized in that it comprises the following steps:

(a) Determining sgRNA of a gene to be edited according to the PAM recognition site of the CasF2 protein;

(b) Cloning the gene sequence of the CasF2 protein and the corresponding sgRNA into an expression vector;

(c) Transforming the expression vector into agrobacterium, and introducing the expression vector into a target plant by using an agrobacterium-mediated genetic transformation method to obtain a targeted gene editing plant;

in the genetic transformation, mgCl is used ₂ Activating the gene editing activity.
11. The use according to claim 7, wherein the plant is arabidopsis thaliana and the nucleotide sequence corresponding to the sgRNA is shown in SEQ ID No. 3.
12. The use according to claim 7, wherein the plant is tobacco and the nucleotide sequence corresponding to the sgRNA is shown in SEQ ID No. 4.