CN114438056A

CN114438056A - CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

Info

Publication number: CN114438056A
Application number: CN202210204370.1A
Authority: CN
Inventors: 刘文平; 蔡勤安; 马瑞; 郭东全; 郭东梅; 鲁昕; 于志晶; 李源; 魏嘉
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2022-05-06
Anticipated expiration: 2042-03-03
Also published as: CN114438056B; CN116555226A

Abstract

The invention discloses a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing, relating to the technical field of gene editing. The amino acid sequence of the CasF2 protein is shown as SEQ ID No. 2; or has substitution, deletion or addition of one or more amino acids compared with the sequence shown in SEQ ID No.2 and has the same or similar biological functions. The CRISPR/Cas gene editing system comprises a CasF2 protein or a plasmid expressing the CasF2 protein. The invention provides a novel efficient and stable gene editing system, which can use shorter sgRNA to guide CasF2 to edit a target sequence to generate insertion or deletion of a DNA sequence.

Description

CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

Technical Field

The invention relates to the technical field of gene editing, in particular to a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing.

Background

The gene editing technology is a new scientific technology emerging in recent years, and can be used for targeted silencing and modification of genes to create a new non-transgenic material. The CRISPR/Cas (clustered regulated short linked polymorphic CRISPR-associated protein) system is simple in construction, low in cost and high in accuracy, can realize the editing of multiple genes simultaneously, is high in efficiency, and is a gene targeting modification technology with good application prospect.

At present, Cas9, Cas12 and Cas13 are the main components in the CRISPR/Cas system. However, the molecular weights of these Cas genes are large, and the PAM recognition sequence range is narrow. Therefore, the development of new Cas genes for application in gene editing in plants is imminent. The development of a new gene editing system can provide an effective tool for crop gene editing breeding so as to realize the expected goal of people.

In the CasF gene family, no report on the application of CRISPR gene editing vector constructed by using CasF2 gene in crops such as Arabidopsis, tobacco, soybean and corn is reported in detail at present.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a CasF2 protein, a CRISPR/Cas gene editing system and application thereof in plant gene editing; the invention provides a novel efficient and stable gene editing system, which can use shorter sgRNA to guide CasF2 to edit a target sequence to generate insertion or deletion of a DNA sequence.

The technical scheme provided by the invention is as follows:

in one aspect, the invention provides a CasF2 protein, wherein the amino acid sequence of the CasF2 protein is shown as SEQ ID No. 2; or the amino acid sequence of the CasF2 protein has one or more amino acid substitutions, deletions or additions compared with the sequence shown in SEQ ID NO.2, and has the same or similar biological functions.

The amino acid sequence shown in SEQ ID No.2 is as follows:

MDYKDHDGDYKDHDIDYKDDDDKMAPKKKRKVGIHGVPAAPKPAVESEFSKVLKKHFPGERFRSSYMKRGGKILAAQGEEAVVAYLQGKSEEEPPNFQPPAKCHVVTKSRDFAEWPIMKASEAIQRYIYALSTTERAACKPGKSSESHAAWFAATGVSNHGYSHVQGLNLIFDHTLGRYDGVLKKVQLRNEKARARLESINASRADEGLPEIKAEEEEVATNETGHLLQPPGINPSFYVYQTISPQAYRPRDEIVLPPEYAGYVRDPNAPIPLGVVRNRCDIQKGCPGYIPEWQREAGTAISPKTGKAVTVPGLSPKKNKRMRRYWRSEKEKAQDALLVTVRIGTDWVVIDVRGLLRNARWRTIAPKDISLNALLDLFTGDPVIDVRRNIVTFTYTLDACGTYARKWTLKGKQTKATLDKLTATQTVALVAIDLGQTNPISAGISRVTQENGALQCEPLDRFTLPDDLLKDISAYRIAWDRNEEELRARSVEALPEAQQAEVRALDGVSKETARTQLCADFGLDPKRLPWDKMSSNTTFISEALLSNSVSRDQVFFTPAPKKGAKKKAPVEVMRKDRTWARAYKPRLSVEAQKLKNEALWALKRTSPEYLKLSRRKEELCRRSINYVIEKTRRRTQCQIVIPVIEDLNVRFFHGSGKRLPGWDNFFTAKKENRWFIQGLHKAFSDLRTHRSFYVFEVRPERTSITCPKCGHCEVGNRDGEAFQCLSCGKTCNADLDVATHNLTQVALTGKTMPKREEPRDAQGTAPARKTKKASKSKAPPAEREDQTPAQEPSQTSKRPAATKKAGQAKKKK。

the CasF2 protein is an RNA nuclease and has the following activities: activity to bind to specific sites of the target sequence and cleave nucleic acids or to recognize PAM sites and endonuclease activity. In one embodiment, the amino acid sequence of the CasF2 protein can be more than 95%, preferably more than 97%, more preferably more than 98%, and most preferably more than 99% of the amino acid sequence as compared with the amino acid sequence as shown in SEQ ID No.2, as long as the amino acid sequence has the same function as the amino acid sequence as shown in SEQ ID No. 2.

The invention also provides a coding gene of the CasF2 protein, and the nucleotide sequence of the coding gene is shown as the following SEQ ID No. 1:

ATGGATTACAAGGATCACGACGGTGATTACAAGGACCATGATATCGACTACAAGGATGACGATGACAAGATGGCGCCTAAGAAGAAGAGAAAAGTGGGAATTCACGGTGTTCCTGCTGCCCCAAAGCCGGCCGTGGAGTCAGAGTTCTCTAAGGTTCTTAAGAAGCATTTCCCGGGCGAGCGCTTCAGATCTTCCTACATGAAGAGGGGCGGAAAGATCCTGGCGGCTCAGGGAGAGGAGGCTGTGGTTGCCTACCTCCAGGGCAAGAGCGAGGAGGAGCCTCCAAACTTCCAGCCGCCTGCTAAGTGCCACGTCGTGACTAAGTCAAGAGATTTCGCCGAGTGGCCAATTATGAAGGCGTCAGAGGCTATCCAGCGCTACATTTACGCTCTGTCTACTACCGAGAGAGCCGCGTGCAAGCCGGGCAAGTCTTCTGAGAGCCACGCTGCTTGGTTCGCTGCTACAGGCGTCTCAAACCACGGATACTCTCATGTGCAGGGACTCAATCTTATCTTCGATCATACTCTCGGAAGATACGACGGCGTTCTGAAGAAGGTCCAGCTCCGCAACGAGAAGGCTAGGGCCCGCCTTGAGTCAATCAATGCTTCTAGGGCTGACGAGGGCCTGCCTGAGATTAAGGCTGAGGAGGAGGAGGTCGCCACCAACGAGACAGGTCATCTCCTTCAGCCACCGGGCATCAATCCATCCTTCTACGTGTACCAGACAATTAGCCCTCAGGCTTACAGACCAAGGGATGAGATCGTGCTCCCTCCAGAGTACGCGGGTTACGTTAGAGATCCTAACGCTCCTATTCCACTTGGCGTTGTCCGCAATAGATGCGATATCCAGAAGGGCTGCCCAGGATACATTCCGGAGTGGCAGAGGGAGGCTGGAACTGCCATTTCCCCGAAGACTGGAAAGGCCGTCACCGTGCCTGGCCTCAGCCCAAAGAAGAACAAGAGGATGAGAAGGTACTGGCGCTCAGAGAAGGAGAAGGCGCAGGACGCTCTGCTCGTTACAGTCAGAATCGGAACTGATTGGGTGGTTATTGACGTGCGCGGTCTTCTGAGAAACGCGAGGTGGCGCACTATCGCTCCAAAGGATATTTCTCTTAATGCCCTCCTTGACCTGTTCACCGGAGATCCGGTCATCGACGTGCGCAGAAATATTGTTACCTTCACATACACTCTCGATGCTTGCGGCACCTACGCCAGGAAGTGGACACTTAAGGGAAAGCAGACTAAGGCTACCCTTGATAAGCTGACCGCCACACAGACTGTTGCCCTTGTCGCGATCGACCTGGGCCAGACCAACCCTATCTCCGCCGGAATTAGCCGCGTCACACAGGAGAATGGTGCGCTCCAGTGCGAGCCACTTGATAGATTCACTCTGCCGGATGACCTGCTCAAGGATATCTCTGCGTACAGAATTGCTTGGGACAGGAACGAGGAGGAGCTTAGAGCGAGGTCCGTTGAGGCTCTGCCAGAGGCTCAGCAGGCCGAAGTTAGGGCTCTCGATGGCGTCAGCAAGGAGACAGCCAGGACTCAGCTCTGCGCGGATTTCGGACTCGACCCGAAGAGGCTTCCTTGGGATAAGATGTCTTCCAACACAACTTTCATCTCAGAGGCTCTTCTGAGCAATTCAGTCTCTCGCGACCAGGTGTTCTTCACCCCGGCCCCTAAGAAGGGTGCTAAGAAGAAGGCGCCTGTGGAGGTTATGCGCAAGGATAGAACATGGGCGCGCGCTTACAAGCCAAGACTCTCTGTGGAGGCCCAGAAGCTTAAGAATGAGGCGCTCTGGGCTCTTAAGAGAACCTCCCCAGAGTACCTGAAGCTCAGCAGGCGCAAGGAGGAGCTTTGCAGAAGGTCTATCAACTACGTTATTGAGAAGACACGCAGAAGGACTCAGTGCCAGATCGTGATTCCGGTTATTGAGGATCTTAATGTCAGATTCTTCCACGGTTCCGGCAAGAGGCTGCCTGGTTGGGACAACTTCTTCACTGCCAAGAAGGAGAATAGATGGTTCATCCAGGGCCTGCACAAGGCGTTCTCAGATCTCAGGACCCATCGCTCTTTCTACGTCTTCGAAGTGAGGCCTGAGAGGACCTCTATTACATGCCCAAAGTGCGGACACTGCGAGGTTGGAAACAGGGACGGAGAGGCTTTCCAGTGCCTCTCCTGCGGAAAGACCTGCAACGCCGATCTTGACGTTGCGACCCATAATCTGACACAGGTCGCCCTCACTGGAAAGACCATGCCGAAGAGGGAGGAGCCTAGGGATGCTCAGGGTACTGCTCCAGCTAGGAAGACCAAGAAGGCTTCCAAGAGCAAGGCTCCACCTGCTGAGAGGGAGGACCAGACACCAGCTCAGGAGCCGTCCCAGACAAGCAAGAGGCCTGCCGCGACTAAGAAGGCTGGACAGGCTAAGAAGAAGAAGTGA。

the CasF2 gene is a Cas gene of Cas12j type with the potential for long-fragment DNA sequence deletion. The PAM recognition sequence of the CasF2 gene is as follows: 5 '-TBN-3' (B ═ G/T/C), and CasF2 was highly site specific for the target sequence recognized. The target sequence of the CasF2 editing system was 18 bp. CasF2 has more sites on genomic DNA that can be edited and has a broader range of potential target sites.

The present invention may further include a nucleotide sequence reverse-complementary to the nucleotide sequence of CasF2 protein shown in SEQ ID No. 1.

In another aspect, the present invention also provides an expression vector comprising the nucleotide sequence described above. The expression vector can express the CasF2 protein in the target cell, so that the corresponding gene editing can be carried out in the target cell. Commonly used vectors may be, for example, the pBI121 vector, the PCAMBIA1300 vector, and the like.

The invention may also include a recombinant cell comprising the expression vector, preferably the recombinant cell is a eukaryotic cell, more preferably the recombinant cell is a plant cell.

In another aspect, the invention also provides the CasF2 protein, the gene encoding the CasF2 protein or the application of the expression vector in gene editing.

In another aspect, the invention also provides a CRISPR/Cas gene editing system comprising the foregoing CasF2 protein or a plasmid expressing the CasF2 protein.

In one embodiment, the gene editing system further comprises sgrnas or plasmids expressing the sgrnas, e.g., the expression plasmids contain genes encoding the sgrnas.

Both sgrnas can be used for guiding the cassf 2 protein to perform gene editing at the target gene sequence position in the receptor material, and when the sgRNA3 sequence shown in SEQ ID No.3 is used, the cassf 2 protein has the function of sgRNA sequence processing, and cuts sgRNA3 into a dgRNA1 sequence, thereby guiding the cassf 2 to perform gene editing at the target site. The sgRNA can be one or more sgrnas for targeting one or more target genes. The sgRNA includes nucleotides containing sequences of its corresponding recognition region.

In another aspect, the invention provides the use of the CRISPR/Cas gene editing system in plant gene editing; preferably, the plant is a monocot or a dicot; more preferably, the plant is selected from any one of arabidopsis, tobacco, soybean and maize.

In one embodiment, the application comprises the steps of:

(a) determining sgRNA of a gene to be edited according to the PAM recognition site of the CasF2 protein;

(b) cloning the gene sequence of the CasF2 protein and the corresponding sgRNA into an expression vector;

(c) transforming the expression vector into agrobacterium, and introducing the expression vector into a target plant by an agrobacterium-mediated genetic transformation method to obtain a directional gene editing plant;

preferably, in said genetic transformation, MgCl is used₂Activating gene editing activity.

Editing activity of CasF2 Gene requires a certain concentration of Mg²⁺Can be activated. CasF2 is present in plants without the addition of Mg at a concentration²⁺CasF2 does not edit the target site in the cell.

In one embodiment, the plant is arabidopsis, and the corresponding nucleotide sequence of the sgRNA (sgRNA3 sequence) is represented by SEQ ID No. 3. Specifically, SEQ ID No. 3:

TAATGTCGGAACGCTCAACGATTGCCCCTCACGAGGGGAC-N₁₈(target sequence).

In one embodiment, the plant is tobacco, and the corresponding nucleotide sequence of the sgRNA (sgRNA1 sequence) is as shown in SEQ ID No. 4. Specifically, SEQ ID No. 4:

CGCTCAACGATTGCCCCTCACGAGGGGAC-N₁₈(target sequence).

In one embodiment, the invention provides sgRNA target sequences of the plant arabidopsis BRI1 gene; the nucleotide sequence of the sgRNA target sequence is shown in SEQ ID No. 5.

Specifically, SEQ ID No. 5: CTGCGAATTCAATCTCCG are provided.

In one embodiment, the invention provides sgRNA target sequences of plant tobacco PDS genes; the nucleotide sequence of the sgRNA target sequence is shown in SEQ ID No. 6.

Specifically, SEQ ID No. 6: GTAGTAGCGACTCCATGG are provided.

Based on the application of the CRISPR/Cas gene editing system in plant gene editing, the invention also provides a method for carrying out gene editing on plants by using the gene editing vector system.

In the invention, the CasF2 protein and the sgRNA in the CRISPR/Cas system can be in the same expression vector or different expression vectors.

In the present invention, the abbreviation "CRISPR" or "CRISPR" refers to regularly Clustered interspaced short palindromic repeats, i.e. the acronym for Clustered regular interstitial short palindromic repeats. In the nucleotide sequence, when a base is represented, the base represented by the letter N has a meaning common in the art unless otherwise specified, that is, N represents a random or arbitrary base A, T, C or G.

As used herein, "comprising," having, "or" including "includes" comprising, "" consisting essentially of … …, "" consisting essentially of … …, "and" consisting of … ….

Has the beneficial effects that:

the invention provides a novel CasF2 protein and an efficient and stable Cas-mediated gene editing vector, which can be stably and efficiently expressed in plant cells, thereby better regulating and controlling the expression of a target gene. The small number of amino acids in the CasF2 protein, the small size of CasF2, provides advantages for delivery into plant cells (ease of packaging and delivery), and the use of a single active site for crRNA processing and cleavage of DNA sequences by CasF 2. CasF2 has extensive PAM recognition sites, can construct a plurality of gene editing site vectors, and realizes knocking out more genes. The invention can be used for gene editing of DNA sequences in arabidopsis, tobacco, soybean and corn.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the result of PCR sequencing according to the present invention;

FIG. 2 provides a phenotypic map of an Arabidopsis BRI1 gene editing plant obtained by the CRISPR/CasF2 gene editing system according to an embodiment of the present invention;

fig. 3 is a schematic diagram of a sgRNA 3T plasmid vector provided by an embodiment of the present invention;

FIG. 4 is a schematic diagram of the pHCasF2 vector provided in the examples of the present invention;

fig. 5 is a schematic diagram of sgRNA1T plasmid provided by an embodiment of the present invention;

FIG. 6 is a graph showing the results of tobacco tissue culture according to an embodiment of the present invention;

FIG. 7 is a sequence sequencing diagram of a tobacco PDS target according to an embodiment of the present invention.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

1. Targeting strategy for arabidopsis target gene BRI 1:

arabidopsis thaliana (Arabidopsis thaliana) brassinolide receptor BRI1 is used as a target gene, and Arabidopsis thaliana BRI1 is directionally edited by using CRISPR/CasF 2.

CasF2/sgRNA design:

selecting the nucleotide sequence of the sgRNA target of arabidopsis BRI1 (target sequence SEQ ID No.5) (5 '-3') according to the PAM sequence recognized by CasF 2: CTGCGAATTCAATCTCCG are provided.

2. Editing of the Arabidopsis BRI1 Gene

Constructing sgRNA of an arabidopsis BRI1 gene, and selecting an arabidopsis AtU6-26 promoter to drive the expression of a sgRNA sequence; meanwhile, AtU6-26 terminator sequences were added after the sgRNA sequences. The CRISPR/CasF2 gene editing vector of sgRNA was driven with the arabidopsis U6 promoter.

The targeted sgRNA sequences were amplified using KOD-plus neo using the sgRNA 3T plasmid (fig. 3 is a schematic diagram of the plasmid vector) as a template. Round 1 PCR, amplification system (20 μ L):

primer pair: u6-26p-F + F2BRI1-gRNA-R amplification 1 tube, primer pair: f2BRI1-U6-26t-F + U6-26t-R amplify 1 tube.

U6-26p-F(SEQ ID No.7)：

TTCAGAggtctcTtagtCGACTTGCCTTCCGCACAATAC；

U6-26t-R(SEQ ID No.8)：

AGCGTGggtctcGcgccTATTGGTTTATCTCATCGGAAC；

F2BRI1-U6-26t-F(SEQ ID No.9)：

(wherein the bold underlined portion is the target sequence)

F2BRI1-gRNA-R(SEQ ID No.10)：

CGGAGATTGAATTCGCAGGTCCCCTCGTGAGGGGCAATC。

PCR reaction procedure:

after the PCR amplification was completed, 2. mu.L of each of 2 tubes of PCR products was used as a template for the 2 nd round of PCR.

An amplification system:

reaction procedure:

after the 2 nd round PCR was completed, 1. mu.L of the PCR product was used as a template for the 3 rd round PCR. The reaction system and the amplification system were the same as in round 1. After the amplification, agarose gel electrophoresis was performed.

The PCR product was recovered by gel recovery and ligated with pHCasF2 vector (FIG. 4 is a vector diagram).

A connection system:

and (3) connection reaction: 5min at 37 ℃ and 5min at 10 ℃; 5min at 20 ℃; 15 cycles, and finally 5min at 37 ℃.

Transformation of the ligation products E.coli DH 5. alpha. competent coating on LB (Kan)⁺) On a flat plate. Colonies were picked from the plate and sent to the company for sequencing validation.

The constructed BRI1 gene targeting expression vector pHCasF2-BRI1 is used for transforming agrobacterium GV 3101.

And (3) selecting agrobacterium to infect the arabidopsis thaliana in the full-bloom stage. The steps of infecting arabidopsis thaliana by the agrobacterium method are as follows: the Agrobacterium strain was pipetted 20. mu.L into 3mL of Yeast Extract Broth (YEB) (kan)⁺、Rif⁺) Performing the following steps; shaking at 28 deg.C and 200rpm for 24 h;

taking the shaken bacteria, centrifuging at 12,000rpm for 1min, collecting the strains, removing supernatant, resuspending the precipitate with 1mL of 5% sucrose 1/2MS solution, and collecting the strains again; finally, it was resuspended in 1mL of 5% sucrose 1/2MS solution, while 0.2. mu.L of Silwet77 and MgCl were added to a final concentration of 10mM₂And after the components are fully and uniformly mixed, the arabidopsis thaliana can be infected.

Screening resistant seedlings and sequencing:

and after the arabidopsis seeds are mature, harvesting the seeds. Seeds were sown on 1/2MS medium plates containing 50mg/L hygromycin and resistant shoots were picked.

The DNA sequence near the target site is amplified by PCR, and the PCR product is sent to the company for sequencing. Arabidopsis plants with the BRI1 gene edited were photographed.

PCR amplification primers for DNA amplification near the target sequence:

F2BRI1crispr-identify-F(SEQ ID No.11)：

CTGGCTTCAAGTGCTCTGCTTC；

F2BRI1crispr-identify-R(SEQ ID No.12)：

GTAATTCGCCGGAAAACTCG。

the amplification system is the same as that of round 1 PCR.

And (3) analyzing an experimental result:

(1) no MgCl was added to the final concentration of 10mM in the staining solutions infecting Arabidopsis thaliana₂Plants in which the BRI1 gene was not edited were found, except in the case ofIncorporating 10mM MgCl₂The Arabidopsis plants infected by the infection solution of (1) only show plants with the BRI1 gene edited.

(2) Amplifying a DNA sequence near the BRI1 target point, and finding that the target point generates a set of peaks (shown in figure 1) through sequencing; and Arabidopsis plants developed a sterile phenotype, consistent with reported literature results (shown in FIG. 2).

The results show that: MgCl is required for the CasF2 protein to carry out gene editing in Arabidopsis thaliana₂And can carry out gene editing on the Arabidopsis gene to generate insertion and deletion of a DNA sequence.

Example 2

1. The strategy of targeting the PDS gene of Nicotiana benthamiana:

the tobacco (Nicotiana benthamiana) phytoene dehydrogenase PDS is taken as a target gene, and the CRISPR/CasF2 is utilized to directionally edit the tobacco PDS.

CasF2/sgRNA design:

selecting the nucleotide sequence of sgRNA target of the PDS of nigella benthamii (target sequence SEQ ID No.6) (5 '-3') according to the PAM sequence recognized by CasF 2: GTAGTAGCGACTCCATGG are provided.

2. Editing of the Arabidopsis BRI1 Gene

Editing of the PDS Gene of Nicotiana benthamiana

The sgRNA of the tobacco PDS gene is constructed by the same construction method as Arabidopsis thaliana, the BRI1 target primer of Arabidopsis thaliana is replaced by the PDS target primer of tobacco, and the template for amplifying the sgRNA sequence is replaced by sgRNA1T plasmid (figure 5 is a vector schematic diagram). The target primers of the tobacco PDS gene are as follows:

F2NtPDS-U6-26t-F(SEQ ID No.13)：

(wherein the bold underlined portion is the target sequence)

F2NtPDS-gRNA-R(SEQ ID No.14)：

CCATGGAGTCGCTACTACGTCCCCTCGTGAGGGGCAATC。

The constructed tobacco targeting PDS gene plasmid pHCasF2-PDS is transformed into agrobacterium GV3101, and the tobacco is transformed by a leaf disc method, and the specific steps are as follows:

1. disinfecting the leaves:

1) selecting leaf blades growing 1-2 months old Benzenbachia, placing into a beaker, and soaking with sterile water for 20-30 min;

2) discarding sterile water, soaking the leaves with 0.6% sodium hypochlorite (1 drop Tween-20 is added to each 50mL solution), and soaking the leaves in water for 10 min;

3) washing with sterile water for 5 times,

2. leaf infection:

1) cutting the blade edge with sterilizing scissors or puncher to 1cm²The size is that the leaf is put into a liquid co-culture medium while avoiding the main veins of the leaf;

2) transferring all the cut leaves into an infection solution, and infecting for 8 min; then, absorbing the staining solution on the surface of the leaf by using sterile filter paper;

3) quickly placing the leaves on a solid co-culture medium, keeping the back of the leaves downward, and performing dark culture at 25 ℃ for 48 h;

4) the leaves were transferred to a selection medium, cultured at 25 ℃ for 16h light/8 h dark, and replaced with fresh selection medium every 10 days until adventitious buds were differentiated from the transformed cells.

5) Selecting albino seedlings for photographing, extracting albino seedling genome DNA, amplifying DNA sequences near target spots by using primers, and sending PCR products to a company for sequencing.

PCR amplification primers for DNA amplification near the target sequence:

NtPDS-seq-F(SEQ ID No.15)：ATGCCCCAAATTGGACTTGTTTC；

NtPDS1-23-R(SEQ ID No.16)：CTGGAGCGTGGACAACATAAAT。

the method for constructing the tobacco sgRNA target is the same as that for constructing an arabidopsis system.

And (3) analyzing an experimental result:

according to the results of gene editing in Arabidopsis thaliana, MgCl is required for the CasF2 protein to exert gene editing₂Will be active, editing the target DNA sequence under the direction of the sgRNA. Therefore, in the tobacco PDS gene tissue culture, the screening culture is performedMgCl is added to the nutrient at a final concentration of 100nM₂(ii) a Albino shoots were produced after 2 rounds of selection medium after infection by Agrobacterium (see FIG. 6). Without adding MgCl₂The screening medium of (1) produced green differentiated seedlings. Sequencing the target sequence of the albino seedling to discover that the base deletion occurs in the target sequence. Tobacco PDS target sequence sequencing figure 7.

Meanwhile, the sgRNA3 sequence was used as the sgRNA sequence in arabidopsis and the sgRNA1 sequence was used as the sgRNA sequence in tobacco. Through analysis of the constructed arabidopsis sgRNA3 guide sequence and the sgRNA1 guide sequence in tobacco, the CasF2 protein can treat pre-crRNA, and the shorter sgRNA1 can be used for guiding CasF2 to cut a target sequence. Thus, multiple sgrnas can be constructed simultaneously for targeting multiple genes.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Jilin province academy of agricultural sciences

<120> CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing

<130> PA20037888

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 2439

<212> DNA

<213> CasF2 Gene

<400> 1

atggattaca aggatcacga cggtgattac aaggaccatg atatcgacta caaggatgac 60

gatgacaaga tggcgcctaa gaagaagaga aaagtgggaa ttcacggtgt tcctgctgcc 120

ccaaagccgg ccgtggagtc agagttctct aaggttctta agaagcattt cccgggcgag 180

cgcttcagat cttcctacat gaagaggggc ggaaagatcc tggcggctca gggagaggag 240

gctgtggttg cctacctcca gggcaagagc gaggaggagc ctccaaactt ccagccgcct 300

gctaagtgcc acgtcgtgac taagtcaaga gatttcgccg agtggccaat tatgaaggcg 360

tcagaggcta tccagcgcta catttacgct ctgtctacta ccgagagagc cgcgtgcaag 420

ccgggcaagt cttctgagag ccacgctgct tggttcgctg ctacaggcgt ctcaaaccac 480

ggatactctc atgtgcaggg actcaatctt atcttcgatc atactctcgg aagatacgac 540

ggcgttctga agaaggtcca gctccgcaac gagaaggcta gggcccgcct tgagtcaatc 600

aatgcttcta gggctgacga gggcctgcct gagattaagg ctgaggagga ggaggtcgcc 660

accaacgaga caggtcatct ccttcagcca ccgggcatca atccatcctt ctacgtgtac 720

cagacaatta gccctcaggc ttacagacca agggatgaga tcgtgctccc tccagagtac 780

gcgggttacg ttagagatcc taacgctcct attccacttg gcgttgtccg caatagatgc 840

gatatccaga agggctgccc aggatacatt ccggagtggc agagggaggc tggaactgcc 900

atttccccga agactggaaa ggccgtcacc gtgcctggcc tcagcccaaa gaagaacaag 960

aggatgagaa ggtactggcg ctcagagaag gagaaggcgc aggacgctct gctcgttaca 1020

gtcagaatcg gaactgattg ggtggttatt gacgtgcgcg gtcttctgag aaacgcgagg 1080

tggcgcacta tcgctccaaa ggatatttct cttaatgccc tccttgacct gttcaccgga 1140

gatccggtca tcgacgtgcg cagaaatatt gttaccttca catacactct cgatgcttgc 1200

ggcacctacg ccaggaagtg gacacttaag ggaaagcaga ctaaggctac ccttgataag 1260

ctgaccgcca cacagactgt tgcccttgtc gcgatcgacc tgggccagac caaccctatc 1320

tccgccggaa ttagccgcgt cacacaggag aatggtgcgc tccagtgcga gccacttgat 1380

agattcactc tgccggatga cctgctcaag gatatctctg cgtacagaat tgcttgggac 1440

aggaacgagg aggagcttag agcgaggtcc gttgaggctc tgccagaggc tcagcaggcc 1500

gaagttaggg ctctcgatgg cgtcagcaag gagacagcca ggactcagct ctgcgcggat 1560

ttcggactcg acccgaagag gcttccttgg gataagatgt cttccaacac aactttcatc 1620

tcagaggctc ttctgagcaa ttcagtctct cgcgaccagg tgttcttcac cccggcccct 1680

aagaagggtg ctaagaagaa ggcgcctgtg gaggttatgc gcaaggatag aacatgggcg 1740

cgcgcttaca agccaagact ctctgtggag gcccagaagc ttaagaatga ggcgctctgg 1800

gctcttaaga gaacctcccc agagtacctg aagctcagca ggcgcaagga ggagctttgc 1860

agaaggtcta tcaactacgt tattgagaag acacgcagaa ggactcagtg ccagatcgtg 1920

attccggtta ttgaggatct taatgtcaga ttcttccacg gttccggcaa gaggctgcct 1980

ggttgggaca acttcttcac tgccaagaag gagaatagat ggttcatcca gggcctgcac 2040

aaggcgttct cagatctcag gacccatcgc tctttctacg tcttcgaagt gaggcctgag 2100

aggacctcta ttacatgccc aaagtgcgga cactgcgagg ttggaaacag ggacggagag 2160

gctttccagt gcctctcctg cggaaagacc tgcaacgccg atcttgacgt tgcgacccat 2220

aatctgacac aggtcgccct cactggaaag accatgccga agagggagga gcctagggat 2280

gctcagggta ctgctccagc taggaagacc aagaaggctt ccaagagcaa ggctccacct 2340

gctgagaggg aggaccagac accagctcag gagccgtccc agacaagcaa gaggcctgcc 2400

gcgactaaga aggctggaca ggctaagaag aagaagtga 2439

<210> 2

<211> 812

<212> PRT

<213> amino acid sequence of CasF2 protein

<400> 2

Met Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp

1 5 10 15

Tyr Lys Asp Asp Asp Asp Lys Met Ala Pro Lys Lys Lys Arg Lys Val

20 25 30

Gly Ile His Gly Val Pro Ala Ala Pro Lys Pro Ala Val Glu Ser Glu

35 40 45

Phe Ser Lys Val Leu Lys Lys His Phe Pro Gly Glu Arg Phe Arg Ser

50 55 60

Ser Tyr Met Lys Arg Gly Gly Lys Ile Leu Ala Ala Gln Gly Glu Glu

65 70 75 80

Ala Val Val Ala Tyr Leu Gln Gly Lys Ser Glu Glu Glu Pro Pro Asn

85 90 95

Phe Gln Pro Pro Ala Lys Cys His Val Val Thr Lys Ser Arg Asp Phe

100 105 110

Ala Glu Trp Pro Ile Met Lys Ala Ser Glu Ala Ile Gln Arg Tyr Ile

115 120 125

Tyr Ala Leu Ser Thr Thr Glu Arg Ala Ala Cys Lys Pro Gly Lys Ser

130 135 140

Ser Glu Ser His Ala Ala Trp Phe Ala Ala Thr Gly Val Ser Asn His

145 150 155 160

Gly Tyr Ser His Val Gln Gly Leu Asn Leu Ile Phe Asp His Thr Leu

165 170 175

Gly Arg Tyr Asp Gly Val Leu Lys Lys Val Gln Leu Arg Asn Glu Lys

180 185 190

Ala Arg Ala Arg Leu Glu Ser Ile Asn Ala Ser Arg Ala Asp Glu Gly

195 200 205

Leu Pro Glu Ile Lys Ala Glu Glu Glu Glu Val Ala Thr Asn Glu Thr

210 215 220

Gly His Leu Leu Gln Pro Pro Gly Ile Asn Pro Ser Phe Tyr Val Tyr

225 230 235 240

Gln Thr Ile Ser Pro Gln Ala Tyr Arg Pro Arg Asp Glu Ile Val Leu

245 250 255

Pro Pro Glu Tyr Ala Gly Tyr Val Arg Asp Pro Asn Ala Pro Ile Pro

260 265 270

Leu Gly Val Val Arg Asn Arg Cys Asp Ile Gln Lys Gly Cys Pro Gly

275 280 285

Tyr Ile Pro Glu Trp Gln Arg Glu Ala Gly Thr Ala Ile Ser Pro Lys

290 295 300

Thr Gly Lys Ala Val Thr Val Pro Gly Leu Ser Pro Lys Lys Asn Lys

305 310 315 320

Arg Met Arg Arg Tyr Trp Arg Ser Glu Lys Glu Lys Ala Gln Asp Ala

325 330 335

Leu Leu Val Thr Val Arg Ile Gly Thr Asp Trp Val Val Ile Asp Val

340 345 350

Arg Gly Leu Leu Arg Asn Ala Arg Trp Arg Thr Ile Ala Pro Lys Asp

355 360 365

Ile Ser Leu Asn Ala Leu Leu Asp Leu Phe Thr Gly Asp Pro Val Ile

370 375 380

Asp Val Arg Arg Asn Ile Val Thr Phe Thr Tyr Thr Leu Asp Ala Cys

385 390 395 400

Gly Thr Tyr Ala Arg Lys Trp Thr Leu Lys Gly Lys Gln Thr Lys Ala

405 410 415

Thr Leu Asp Lys Leu Thr Ala Thr Gln Thr Val Ala Leu Val Ala Ile

420 425 430

Asp Leu Gly Gln Thr Asn Pro Ile Ser Ala Gly Ile Ser Arg Val Thr

435 440 445

Gln Glu Asn Gly Ala Leu Gln Cys Glu Pro Leu Asp Arg Phe Thr Leu

450 455 460

Pro Asp Asp Leu Leu Lys Asp Ile Ser Ala Tyr Arg Ile Ala Trp Asp

465 470 475 480

Arg Asn Glu Glu Glu Leu Arg Ala Arg Ser Val Glu Ala Leu Pro Glu

485 490 495

Ala Gln Gln Ala Glu Val Arg Ala Leu Asp Gly Val Ser Lys Glu Thr

500 505 510

Ala Arg Thr Gln Leu Cys Ala Asp Phe Gly Leu Asp Pro Lys Arg Leu

515 520 525

Pro Trp Asp Lys Met Ser Ser Asn Thr Thr Phe Ile Ser Glu Ala Leu

530 535 540

Leu Ser Asn Ser Val Ser Arg Asp Gln Val Phe Phe Thr Pro Ala Pro

545 550 555 560

Lys Lys Gly Ala Lys Lys Lys Ala Pro Val Glu Val Met Arg Lys Asp

565 570 575

Arg Thr Trp Ala Arg Ala Tyr Lys Pro Arg Leu Ser Val Glu Ala Gln

580 585 590

Lys Leu Lys Asn Glu Ala Leu Trp Ala Leu Lys Arg Thr Ser Pro Glu

595 600 605

Tyr Leu Lys Leu Ser Arg Arg Lys Glu Glu Leu Cys Arg Arg Ser Ile

610 615 620

Asn Tyr Val Ile Glu Lys Thr Arg Arg Arg Thr Gln Cys Gln Ile Val

625 630 635 640

Ile Pro Val Ile Glu Asp Leu Asn Val Arg Phe Phe His Gly Ser Gly

645 650 655

Lys Arg Leu Pro Gly Trp Asp Asn Phe Phe Thr Ala Lys Lys Glu Asn

660 665 670

Arg Trp Phe Ile Gln Gly Leu His Lys Ala Phe Ser Asp Leu Arg Thr

675 680 685

His Arg Ser Phe Tyr Val Phe Glu Val Arg Pro Glu Arg Thr Ser Ile

690 695 700

Thr Cys Pro Lys Cys Gly His Cys Glu Val Gly Asn Arg Asp Gly Glu

705 710 715 720

Ala Phe Gln Cys Leu Ser Cys Gly Lys Thr Cys Asn Ala Asp Leu Asp

725 730 735

Val Ala Thr His Asn Leu Thr Gln Val Ala Leu Thr Gly Lys Thr Met

740 745 750

Pro Lys Arg Glu Glu Pro Arg Asp Ala Gln Gly Thr Ala Pro Ala Arg

755 760 765

Lys Thr Lys Lys Ala Ser Lys Ser Lys Ala Pro Pro Ala Glu Arg Glu

770 775 780

Asp Gln Thr Pro Ala Gln Glu Pro Ser Gln Thr Ser Lys Arg Pro Ala

785 790 795 800

Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

805 810

<210> 3

<211> 40

<212> DNA

<213> sgRNA3 sequence

<400> 3

taatgtcgga acgctcaacg attgcccctc acgaggggac 40

<210> 4

<211> 29

<212> DNA

<213> sgRNA1 sequence

<400> 4

cgctcaacga ttgcccctca cgaggggac 29

<210> 5

<211> 18

<212> DNA

<213> sgRNA target sequence of Arabidopsis BRI1 Gene

<400> 5

ctgcgaattc aatctccg 18

<210> 6

<211> 18

<212> DNA

<213> sgRNA target sequence of tobacco PDS gene

<400> 6

gtagtagcga ctccatgg 18

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence U6-26p-F

<400> 7

ttcagaggtc tcttagtcga cttgccttcc gcacaatac 39

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence U6-26t-R

<400> 8

agcgtgggtc tcgcgcctat tggtttatct catcggaac 39

<210> 9

<211> 44

<212> DNA

<213> Artificial sequence F2BRI1-U6-26t-F

<400> 9

ctgcgaattc aatctccgtt ttttttgcaa aattttccag atcg 44

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence

<400> 10

cggagattga attcgcaggt cccctcgtga ggggcaatc 39

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence F2BRI1 crispr-identification-F

<400> 11

ctggcttcaa gtgctctgct tc 22

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence F2BRI1 criprpr-identification-R

<400> 12

gtaattcgcc ggaaaactcg 20

<210> 13

<211> 44

<212> DNA

<213> Artificial sequence F2NtPDS-U6-26t-F

<400> 13

gtagtagcga ctccatggtt ttttttgcaa aattttccag atcg 44

<210> 14

<211> 39

<212> DNA

<213> Artificial sequence F2NtPDS-gRNA-R

<400> 14

ccatggagtc gctactacgt cccctcgtga ggggcaatc 39

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence NtPDS-seq-F

<400> 15

atgccccaaa ttggacttgt ttc 23

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence NtPDS1-23-R

<400> 16

ctggagcgtg gacaacataa at 22

Claims

The CasF2 protein, wherein the amino acid sequence of the CasF2 protein is shown as SEQ ID No. 2; or has substitution, deletion or addition of one or more amino acids compared with the sequence shown in SEQ ID No.2 and has the same or similar biological functions.
2. The CasF2 protein coding gene as claimed in claim 1, wherein the nucleotide sequence of the coding gene is shown in SEQ ID No. 1.
3. An expression vector comprising the nucleotide sequence of claim 2.
4. Use of the CasF2 protein of claim 1, the gene encoding the CasF2 protein of claim 2, or the expression vector of claim 3 for gene editing.
5. A CRISPR/Cas gene editing system, comprising the CasF2 protein of claim 1 or a plasmid expressing the CasF2 protein.
6. The CRISPR/Cas gene editing system of claim 5, further comprising a sgRNA or a plasmid expressing the sgRNA.
7. Use of a CRISPR/Cas gene editing system according to claim 5 or claim 6 in plant gene editing;

preferably, the plant is a monocot or a dicot; more preferably, the plant is selected from any one of arabidopsis, tobacco, soybean and maize.
8. The application according to claim 7, characterized in that it comprises the following steps:

(a) determining sgRNA of a gene to be edited according to the PAM recognition site of the CasF2 protein;

(b) cloning the gene sequence of the CasF2 protein and the corresponding sgRNA into an expression vector;

(c) transforming the expression vector into agrobacterium, and introducing the expression vector into a target plant by an agrobacterium-mediated genetic transformation method to obtain a directional gene editing plant;

preferably, in said genetic transformation, MgCl is used₂Activating gene editing activity.
9. The use of claim 7, wherein the plant is Arabidopsis thaliana, and the sgRNA has a nucleotide sequence shown in SEQ ID No. 3.
10. The use of claim 7, wherein the plant is tobacco and the sgRNA has a nucleotide sequence as set forth in SEQ ID No. 4.