CN111455079A - L AMP primer for detecting Q fever of animals and detection method - Google Patents
L AMP primer for detecting Q fever of animals and detection method Download PDFInfo
- Publication number
- CN111455079A CN111455079A CN202010361884.9A CN202010361884A CN111455079A CN 111455079 A CN111455079 A CN 111455079A CN 202010361884 A CN202010361884 A CN 202010361884A CN 111455079 A CN111455079 A CN 111455079A
- Authority
- CN
- China
- Prior art keywords
- primer
- reaction
- seq
- animal
- fever
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a detection method for detecting animal Q fever by a L AMP fluorescence method, wherein the primer is suitable for L AMP fluorescence method detection, can accurately detect animal Q fever plasmids and positive samples, has no cross reaction with animal brucella, mycobacterium bovis, salmonella, escherichia coli, staphylococcus aureus and healthy bovine blood, has the specificity of 100 percent, is quick and easy to realize high flux, and simultaneously reduces the detection time and the detection cost.
Description
Technical Field
The invention belongs to the technical field of pathogen molecule detection, and particularly relates to a primer and a detection method for detecting animal Q fever.
Background
Animal Q fever (Query farm) is a natural epidemic zoonosis caused by Coxiella burnetii (Coxiella burnetii). As early as 1937, a febrile illness developed in australia, which was called the Q fever of animals for unknown reasons, and its causative agent was later identified as Coxix burnetii. The bacterium can widely infect humans and animals through aerosols, and therefore the U.S. anti-terrorist organization ranks it as one of the biological warfare agents. A wide variety of animals can infect the bacterium, including ruminants, wild and domestic animals, birds and arthropods (especially ticks), and the like. To date, animal Q fever has become one of the most widely distributed zoonosis worldwide, and animal Q fever infections have been reported in almost all countries of the world. In 1950, China reported the first animal Q fever cases, which are prevalent in most areas to date.
At present, pathogenic diagnosis technologies aiming at animal Q fever mainly comprise animal Q fever pathogen separation, animal Q fever coxiella PCR, fluorescent quantitative PCR and the like. Because animal Q heat is diseased by both human and animals, live cultures or disease collection from infected material must be carried out in a biosafety third-level laboratory, and pathogen separation has higher requirements on laboratory conditions, and is not suitable for rapid diagnosis and application in basement and clinic; in addition, animal Q thermal coxsackie PCR and fluorescence quantitative PCR both need a process of temperature rise and fall, temperature rise and continuous circulation, and have high requirements on temperature change and longer reaction time.
Disclosure of Invention
The invention provides a primer and a detection method for detecting animal Q fever by using an L AMP fluorescence method, which can realize the detection of the animal Q fever within 60min at 63 ℃, and have the characteristics of rapidness, specificity, sensitivity, simple and convenient operation and suitability for rapid field detection.
The invention firstly provides a primer pair for L AMP fluorescent amplification for detecting animal Q fever, which is used for amplifying all or partial fragments of a nucleic acid fragment with a sequence of SEQ ID NO. 1;
the primer pair comprises:
an outer upstream primer: 5'-ACGTCTTGTTGTTCCACC-3' (SEQ ID NO: 3);
outer downstream primer: 5'-GTGTGGAATTGATGAGTGG-3' (SEQ ID NO: 4);
an inner upstream primer: 5'-GTGTGGAGGAGCGAACCATTCGTTACGATCATTCTTGTTACTT-3' (SEQ ID NO: 5);
inner downstream primer: 5'-TTCCATCACCACGCAGCCAGCGTGCTCAGTATGTATC-3' (SEQ ID NO: 6);
a circular upstream primer: 5'-ATCAGTCCGCAGCACG-3' (SEQ ID NO: 7);
a circular downstream primer: 5'-CACCTTAAGACTGGCTACGG-3' (SEQ ID NO: 8);
the primers are used for preparing L AMP fluorescent detection kit.
Further, the invention also provides a method for detecting Q fever of animals by using an L AMP fluorescence method, which comprises the following specific steps:
1) extracting a nucleic acid sample of an object to be detected;
2) switching on a power supply to preheat the constant-temperature fluorescent gene detector, and setting reaction parameters; the reaction parameters were set to 63 ℃, reaction time: 60 min;
3) adding 8 mu L of water, 10 mu M of the primer with the concentration of 1 mu L, 1 mu L of polymerase and 0.5 mu L of fluorescent dye into 12.5 mu L of reaction liquid, and fully mixing to obtain reaction premixed liquid;
4) adding 2.5 mu L of glycerol on a reaction tube cover, fully mixing the nucleic acid sample obtained in the step 1) of 2 mu L with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector to detect a fluorescent signal;
5) according to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
Further, the primer is used at a concentration of 1-50 μ M.
Preferably, the primer is used at a concentration of 10. mu.M.
Compared with the prior art, the primer and the detection method for detecting the Q fever of the animal by the L AMP fluorescence method have the following advantages:
1) the primer provided by the invention is suitable for L AMP fluorescence method detection, can accurately detect animal Q fever pathogen, has no cross reaction with animal brucella, mycobacterium bovis, salmonella, escherichia coli and staphylococcus aureus, and has specificity of 100%;
2) the detection method provided by the invention is rapid, high flux is easy to realize, and meanwhile, the detection time and the detection cost are reduced, the method for rapidly detecting the Q fever of the animal based on the L AMP fluorescent method is high in sensitivity, and the detection sensitivity per reaction reaches 100 copy/mu L;
3) the method for rapidly detecting the Q fever of the animal by the L AMP fluorescence method can conveniently, rapidly and accurately identify the Q fever of the animal, is simple and convenient to operate, has short detection time, completes detection within 60min, does not need to perform DNA unwinding through high-temperature denaturation at 95 ℃ like PCR (polymerase chain reaction), performs annealing at 50-60 ℃, completes extension at 72 ℃, and can complete detection only by performing isothermal amplification at 63 ℃.
Drawings
FIG. 1: the invention is a primer combination screening result chart;
FIG. 2: the invention provides a detection result graph of the sensitivity of animal Q thermal plasmid with different concentrations;
FIG. 3: the invention provides a result chart of animal Q thermal plasmid repeatability detection;
FIG. 4: the specific detection result graph of the animal Q thermal nucleic acid is shown;
FIG. 5: the invention relates to a detection result chart of an animal Q fever clinical sample.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
Example 1 screening of conserved sequences of the Q-fever Virus
According to the whole gene sequence disclosed in NCBI, the analysis shows that multiple copy sequences of a specific IS1111 gene exist in the Q fever gene of the animal, and the sequences are highly conserved in the genome and are generally used for the accurate diagnosis of the Q fever case of the animal, so the Q fever IS1111 gene conserved sequence of the animal IS selected for primer design. Finding out a corresponding whole gene sequence in Genebank, and performing homology analysis and Blast sequence analysis by using DNASTAR software to screen out a highly conserved sequence of animal Q fever IS1111 gene (the fragment IS highly conserved in animal Q fever and has no cross-pairing reaction with pathogenic gene sequences of animal brucella, mycobacterium bovis, salmonella, escherichia coli, staphylococcus aureus and the like):
ATGGTTCGCTCCTCCACACGCTTCCATCACCACGCAGCCCACCTTAAGACTGGCTACGGTGGATACATACTGAGCACGCTTAACCCGTCTCGTGTAGATCACTTTACCCCACTCATCAATTCCACACAGTTGAAAAACATCTTTTGCAATATCAACACCCAGTAA(SEQ ID NO.1)；
and (3) taking the highly conserved sequence obtained by screening as a detection target gene segment, synthesizing positive plasmid, and carrying out primer design, screening and detection.
The DNA plasmid was synthesized by Begonia Borcico Biotechnology Limited according to the above conserved sequence of animal Q fever IS1111 gene, and the size of the plasmid was 2381 bp.
(1) Primer design
According to the conserved sequence of the animal Q fever IS1111 gene, an outer primer, an inner primer and a circular primer are designed, and the designed sequences are as follows:
outer upstream primer 1 OF: 5'-ACGTCTTGTTGTTCCACC-3' (SEQ ID NO: 2);
outer downstream primer 1 OB: 5'-GTGTGGAATTGATGAGTGG-3' (SEQ ID NO: 3);
inner downstream primer 1 BIP: 5'-TTCCATCACCACGCAGCCAGCGTGCTCAGTATGTATC-3' (SEQ ID NO: 5);
circular forward primer 1L F: 5'-ATCAGTCCGCAGCACG-3' (SEQ ID NO: 6);
circular reverse primer 1L B: 5'-CACCTTAAGACTGGCTACGG-3' (SEQ ID NO: 7);
inner downstream primer 2 BIP: 5'-TCCATCACCACGCAGCCAGCGTGCTCAGTATGTATC-3' (SEQ ID NO: 8);
inner upstream primer 3 FIP: 5'-TGTGGAGGAGCGAACCATTGCGTTACGATCATTCTTGTTACTT-3' (SEQ ID NO: 9);
outer upstream primer 4 OF: 5'-CCGCTTCGCTCGCTA-3' (SEQ ID NO: 10);
circular forward primer 5L F: 5'-CGCTGATCAATGAGATTCGG-3' (SEQ ID NO: 11);
circular reverse primer 6L B: 5'-CCACCTTAAGACTGGCTACG-3' (SEQ ID NO: 12) and the above primers were combined into 6 primer combinations, see Table 1;
TABLE 1 animal Q Heat-specific primer Table
As shown in fig. 1, the Q-hot positive samples of animals are detected by primer combinations 1, 2, 3, 4, 5, and 6, respectively, and specific primers with obvious amplification curves and short reaction time are selected, preferably combination 1:
outer upstream primer 1 OF: 5'-ACGTCTTGTTGTTCCACC-3' (SEQ ID NO: 3);
outer downstream primer 1 OB: 5'-GTGTGGAATTGATGAGTGG-3' (SEQ ID NO: 4);
inner upstream primer 1 FIP: 5'-GTGTGGAGGAGCGAACCATTCGTTACGATCATTCTTGTTACTT-3' (SEQ ID NO: 5);
inner downstream primer 1 BIP: 5'-TTCCATCACCACGCAGCCAGCGTGCTCAGTATGTATC-3' (SEQ ID NO: 6);
circular forward primer 1L F: 5'-ATCAGTCCGCAGCACG-3' (SEQ ID NO: 7);
circular reverse primer 1L B: 5'-CACCTTAAGACTGGCTACGG-3' (SEQ ID NO: 8);
4) both primers and plasmids were synthesized by Beijing Rui Boxing Corp Biotech Co.
5) The detection reagent for rapidly detecting the Q heat of the animal based on the L AMP fluorescence method comprises reaction liquid, polymerase, fluorescent dye, purified water, glycerol, a positive quality control product, a negative quality control product and primers;
l AMP fluorescent method reaction liquid and fluorescent dye are purchased from Guangzhou double helix gene technology GmbH, with the product number of 051011M, and when in use, the reaction liquid and the primers, purified water and the like are fully mixed to obtain reaction premix liquid.
The positive quality control product IS a recombinant plasmid containing animal Q fever IS1111 gene with the concentration of 1 × 104copies/μ L. the synthesized plasmid was subjected to concentration measurement and copy number calculation using an ultravioletray spectrophotometer, and diluted in a concentration gradient to prepare 1 × 100copies/μl～1×1010copies/μ L standard for use.
The negative quality control product is ddH2O or purified water. The concentration of the forward primer and the reverse primer was 10. mu.M.
Example 2L method for detecting Q fever in animals by AMP fluorescence method
The method for detecting Q fever of animals by using the L AMP fluorescence method comprises the following steps:
1) extracting nucleic acid from a whole blood sample according to a whole blood genome method, and storing at-20 ℃ for later use;
2) the constant-temperature fluorescent gene detector DHelix1610 is powered on to preheat, reaction parameters are set to 63 ℃, and the reaction time is as follows: 60 min;
3) adding 8 mu L of water, 10 mu M of the primer with the concentration of 1 mu L, 1 mu L of DNA polymerase and 0.5 mu L of fluorescent dye into 12.5 mu L of reaction solution, and fully mixing to obtain reaction premix;
4) adding 2.5 mu L of glycerol on a reaction tube cover, fully mixing the nucleic acid sample obtained in the step 1) of 2 mu L with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector DHelix1610 for detecting a fluorescent signal;
5) according to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
The sensitivity, reproducibility and specificity of the primers of the present invention to the probe were examined as follows.
1. Sensitivity test
(1) Primer and method for producing the same
Outer upstream primer 1 OF: 5'-ACGTCTTGTTGTTCCACC-3' (SEQ ID NO: 3);
outer downstream primer 1 OB: 5'-GTGTGGAATTGATGAGTGG-3' (SEQ ID NO: 4);
inner upstream primer 1 FIP: 5'-GTGTGGAGGAGCGAACCATTCGTTACGATCATTCTTGTTACTT-3' (SEQ ID NO: 5);
inner downstream primer 1 BIP: 5'-TTCCATCACCACGCAGCCAGCGTGCTCAGTATGTATC-3' (SEQ ID NO: 6);
circular forward primer 1L F: 5'-ATCAGTCCGCAGCACG-3' (SEQ ID NO: 7);
circular reverse primer 1L B: 5'-CACCTTAAGACTGGCTACGG-3' (SEQ ID NO: 8).
(2) Preparing a plasmid working standard, which respectively comprises the following steps:
working standard 1, containing 1 × 106copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working standardProduct 2, containing 1 × 105copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working Standard 3, containing 1 × 104copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working standard 4, containing 1 × 103copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working standard 5, containing 1 × 102copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working standard 6, containing 1 × 101copies/. mu. L animal Q heat plasmid non-infectious DNA fragments.
Working standard 7, containing 1 copy/. mu. L animal Q thermal plasmid non-infectious DNA fragment.
(3) The sensitivity implementation method comprises the following steps:
sucking 100 mu L reaction liquid, adding into a prepared 1.5M L EP tube, respectively adding 64 mu L water, 8 mu L polymerase, 4 mu L fluorescent dye and 8 mu L primer (the concentration of the primer is 10 mu M), and fully mixing to obtain a uniformly mixed reaction premix.
Step 2, sample addition reaction
After 2.5 mu L of glycerol is added on 8 prepared test tubes of L AMP fluorescent reaction premix liquid, 2 mu L0 negative quality control substances, 2 mu L standard work 7, 2 mu L standard work 6, 2 mu L standard work 5, 2 mu L standard work 4, 2 mu L standard work 3, 2 mu L standard work 2 and 2 mu L standard work 1 are respectively added into the tubes, each sample is repeated for 2 times, each reaction tube is fully and uniformly mixed after the samples are added, and the total volume of each reaction tube is 25 mu L.
And (3) putting the uniformly mixed 8 reaction tubes into a constant-temperature fluorescent gene detector DHelix1610, setting the reaction temperature to 63 ℃, and reacting for 60 min.
According to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
The detection result is shown in figure 2, and shows that the working standard products 1, 2, 3, 4 and 5 are amplified within 60min, and are analyzed by combining repeated results of several sensitivity experiments, namely 100 copy/mu L exists in each sample, so that the detection can be carried out within 60min, and the quick and sensitive detection result is realized.
2. Repeatability test
(1) The primer and negative quality control substance sequences are the same as in example 1.
(2) 8 replicates were verified using working standard 5 (containing 100 copy/. mu. L animal Q-Thermobifin DNA fragment):
(3) the method is repeatedly implemented:
sucking 112.5 μ L reaction solution, adding into a prepared 1.5M L EP tube, adding 72 μ L water, 9 μ L polymerase, 4.5 μ L fluorescent dye and 9 μ L primer (the concentration of the primer is 10 μ M), mixing well to obtain a mixed reaction premix.
Step 2, sample addition reaction
After 2.5 mu L of glycerol is added to the test tubes of the prepared L AMP fluorescent reaction premixed solution, 2 mu L of negative quality control substances are added to one of the test tubes of the prepared L AMP fluorescent basic reaction reagent, 2 mu L of standard work 7 serving as a template is added to the other 8 reaction tubes respectively, and after the sample is added, each reaction tube is fully and uniformly mixed, and the total volume of each reaction tube is 25 mu L.
Step 3, detection and result
And (3) putting the uniformly mixed 9 reaction tubes into a constant-temperature fluorescent gene detector DHelix1610, setting the reaction temperature to 63 ℃, and reacting for 60 min.
According to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
Relative fluorescence-initial amplification fluorescence (actual value normalized to 500mV)
The detection results are shown in fig. 3: the results show that all amplification occurs within 60min, and the repeatability is good.
3. Experiment of specificity
(1) The primer and negative quality control substance sequences are the same as in example 1.
(2) Nucleic acid samples of animal brucella, mycobacterium bovis, salmonella, escherichia coli, staphylococcus aureus and healthy bovine blood in the specificity experiment are provided by a zoonosis monitoring room of Chinese animal health and epidemiology center.
(3) The sample extraction method comprises the following steps:
homogenizing the tissue sample, and extracting nucleic acid by a DNA extraction method according to the commercial tissue of the radix asparagi; extracting nucleic acid from whole blood, serum and plasma by steps of cracking, magnetic bead enrichment, washing, eluting and the like; storing at-20 deg.C for use.
(4) Specific experiment implementation method:
sucking 100 mu L reaction liquid, adding into a prepared 1.5M L EP tube, respectively adding 64 mu L water, 8 mu L polymerase, 4 mu L fluorescent dye and 8 mu L primer (the concentration of the primer is 10 mu M), and fully mixing to obtain a uniformly mixed reaction premix.
Step 2, sample addition reaction
2.5 mu L of glycerol is added on 8 prepared test tubes of L AMP fluorescent reaction premix liquid, 2 mu L negative quality control substances are added into 1 test tube, 2 mu L sample nucleic acids of animal Q fever, animal brucella, mycobacterium bovis, salmonella, escherichia coli, staphylococcus aureus and healthy bovine blood are respectively added into the other 7 test tubes, and after the samples are added, each test tube is fully and uniformly mixed, and the total volume of each test tube is 25 mu L.
Step 3, detection and result
And (3) putting the uniformly mixed 8 reaction tubes into a constant-temperature fluorescent gene detector DHelix1610, setting the reaction temperature to 63 ℃, and reacting for 60 min.
According to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
The detection results are shown in fig. 4: the result shows that only animal Q thermonucleic acid is obviously amplified, and other sample nucleic acids such as animal brucella, mycobacterium bovis, salmonella, escherichia coli, staphylococcus aureus and healthy bovine blood are not obviously amplified, so that the specificity is good.
EXAMPLE 3 actual sample testing
(1) The primer and negative quality control substance sequences are the same as in example 1.
(2) In the experiment, 15 clinical samples are 1-15 in total and are provided by a human and animal common disease monitoring room of the Chinese animal health and epidemiology center;
(3) the sample extraction method comprises the following steps:
extracting nucleic acid from a whole blood sample according to a whole blood genome method, and storing at-20 ℃ for later use;
(4) method of implementation
sucking 200 mu L reaction liquid, adding into a prepared 1.5M L EP tube, respectively adding 128 mu L water, 16 mu L polymerase, 8 mu L fluorescent dye and 16 mu L primer (the concentration of the primer is 10 mu M), and fully mixing to obtain a uniformly mixed reaction premix.
Step 2, sample addition reaction
After 2.5 mu L of glycerol is added to the test tubes of the prepared L AMP fluorescent reaction premix, 2 mu L negative quality control substances are added into one of the test tubes, and 2 mu L of extracted nucleic acid is added into the other 15 reaction tubes respectively to serve as templates, and after the samples are added, each reaction tube is fully and uniformly mixed, and the total volume of each reaction tube is 25 mu L.
And (3) putting the uniformly mixed 16 reaction tubes into a constant-temperature fluorescent gene detector DHelix1610, setting the reaction temperature to 63 ℃, and reacting for 60 min.
According to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, wherein an obvious amplification curve exists, the curve amplified by the primer is judged to be positive when the relative fluorescence value is more than 3000mV, and the judgment that the curve without the obvious amplification curve is negative when the relative fluorescence value is less than 3000mV is carried out.
The detection results are shown in FIG. 5, the results show that the consistency of the results of the L AMP detection method and the qPCR detection method is 100% for 15 sample nucleic acids, no amplification occurs in the negative control samples, and the target curve occurs in the positive samples.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> China center for animal health and epidemiology
<120> L AMP primer for detecting Q fever of animals and detection method
<160>12
<170>SIPOSequenceListing 1.0
<210>1
<211>165
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggttcgct cctccacacg cttccatcac cacgcagccc accttaagac tggctacggt 60
ggatacatac tgagcacgct taacccgtct cgtgtagatc actttacccc actcatcaat 120
tccacacagt tgaaaaacat cttttgcaat atcaacaccc agtaa 165
<210>2
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>3
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
<210>4
<211>43
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gtgtggagga gcgaaccatt cgttacgatc 30
attcttgtta ctt 43
<210>5
<211>37
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ttccatcacc acgcagccag cgtgctcagt 30
atgtatc 37
<210>6
<211>16
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
<210>7
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
<210>8
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tccatcacca cgcagccagc gtgctcagta 30
<210>9
<211>43
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tgtggaggag cgaaccattg cgttacgatc 30
attcttgtta ctt 43
<210>10
<211>15
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
<210>12
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
Claims (6)
1. A primer pair for L AMP fluorescent amplification for detecting Q fever of animals is characterized in that the primer pair is used for amplifying all or partial fragments of a nucleic acid fragment with a sequence of SEQ ID NO. 1.
2. The primer pair of claim 1, wherein the primer pair comprises a primer having the sequence set forth in SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6 and SEQ ID NO: 7 in the sequence listing.
3. Use of the primer pair of claim 1 or claim 2 in the preparation of L AMP fluorescence detection kit.
4. An L AMP fluorescence detection kit, wherein the kit comprises the primer pair of claim 1 or claim 2.
5. A method for detecting Q fever of an animal by using L AMP fluorescence method, which is characterized by comprising the following steps:
1) extracting a nucleic acid sample of an object to be detected;
2) switching on a power supply to preheat the constant-temperature fluorescent gene detector, and setting reaction parameters; the reaction parameters were set to 63 ℃, reaction time: 60 min;
3) adding 8 mu L water, the primer pair 1 mu L as claimed in claim 1 or claim 2, 1 mu L polymerase and 0.5 mu L fluorescent dye into 12.5 mu L reaction liquid, and fully mixing to obtain reaction premix liquid;
4) adding 2.5 mu L of glycerol on a reaction tube cover, fully mixing the nucleic acid sample obtained in the step 1) of 2 mu L with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector to detect a fluorescent signal;
5) according to the positive judgment method in the DHelix1610 detection instrument, the judgment can be carried out according to an amplification curve, an obvious amplification curve exists, the curve amplified by the upstream primer and the downstream primer is judged to be positive when the relative fluorescence value is more than 1500mV, and the judgment that the curve is negative when the relative fluorescence value is less than 1500mV and the curve is not obviously amplified is judged to be negative.
6. The method of claim 4, wherein the upstream primer and the downstream primer are used at a concentration of 1 to 50 μ M; preferably 10. mu.M;
the concentration of the probe is 1-50 mu M; preferably 10. mu.M.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010361884.9A CN111455079A (en) | 2020-04-30 | 2020-04-30 | L AMP primer for detecting Q fever of animals and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010361884.9A CN111455079A (en) | 2020-04-30 | 2020-04-30 | L AMP primer for detecting Q fever of animals and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111455079A true CN111455079A (en) | 2020-07-28 |
Family
ID=71678637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010361884.9A Pending CN111455079A (en) | 2020-04-30 | 2020-04-30 | L AMP primer for detecting Q fever of animals and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111455079A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102851386A (en) * | 2012-09-28 | 2013-01-02 | 中国检验检疫科学研究院 | Non-diagnostic method for detecting coxiella burnetii with loop-mediated isothermal amplification (LAMP) technology |
| CN105255884A (en) * | 2015-11-24 | 2016-01-20 | 吉林出入境检验检疫局检验检疫技术中心 | Detection primer set of bainite rickettsia and detection reagent of detection primer set and real-time fluorescent quantitative PCR method |
| KR102044683B1 (en) * | 2018-08-01 | 2019-12-02 | 대한민국 | Pepetide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same |
-
2020
- 2020-04-30 CN CN202010361884.9A patent/CN111455079A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102851386A (en) * | 2012-09-28 | 2013-01-02 | 中国检验检疫科学研究院 | Non-diagnostic method for detecting coxiella burnetii with loop-mediated isothermal amplification (LAMP) technology |
| CN105255884A (en) * | 2015-11-24 | 2016-01-20 | 吉林出入境检验检疫局检验检疫技术中心 | Detection primer set of bainite rickettsia and detection reagent of detection primer set and real-time fluorescent quantitative PCR method |
| KR102044683B1 (en) * | 2018-08-01 | 2019-12-02 | 대한민국 | Pepetide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same |
Non-Patent Citations (4)
| Title |
|---|
| HUA-WEI CHEN等: "Development of loop-mediated isothermal amplification assays for rapidand easy detection of Coxiella Burnetii", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| KT391020.1: "KT391020.1", 《NCBI》 * |
| 谭贵良等: "《现代分子生物学及其组学技术在食品安全监测中的应用》", 30 June 2014, 中山大学出版社 * |
| 贾广乐等: "Q热贝氏柯克斯体环介导等温扩增实时浊度检测法的建立", 《中国畜牧兽医》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN106957927B (en) | African swine fever fluorescent PCR detection reagent, African swine fever fluorescent PCR detection kit and application thereof | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| AU2020101240A4 (en) | One kind A Loop-mediated Isothermal Amplification Kit for Porcine Fine Ring Virus Type 1 and Its Application | |
| CN112176103A (en) | African swine fever virus fluorescence ERA constant temperature rapid detection kit | |
| CN111270019A (en) | Primer group for detecting African swine fever virus, fluorescence visualization rapid detection kit and method | |
| CN111621580A (en) | RAA primer, probe and detection method for detecting pasteurellosis multocida | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN115478120A (en) | Method for simultaneously detecting nodavirus and decapod iridovirus 1 of macrobrachium rosenbergii | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN111118186A (en) | RAA primer, probe and detection method for detecting eperythrozoonosis of pig | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN110592285A (en) | RAA primer probe for detecting Nipah virus and detection method | |
| CN111455079A (en) | L AMP primer for detecting Q fever of animals and detection method | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN115558707A (en) | Visible foot-and-mouth disease, vesicular stomatitis and bluetongue multiple RT-LAMP detection method and primers | |
| CN105779656A (en) | Porcine torque teno sus virus type 2 loop-mediated isothermal amplification kit and application thereof | |
| CN113373263A (en) | Primer and kit for detecting LSDV (localized surface plasmon resonance) | |
| CN113308570A (en) | African swine fever virus nucleic acid extraction-free triple fluorescence quantitative PCR detection composition, method and kit | |
| CN105821160A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for porcine kobuvirus and application thereof | |
| CN107254527B (en) | Visual rapid detection kit and method for macrobrachium rosenbergii spiroplasma | |
| CN111979355A (en) | TaqMan probe method fluorescent quantitative PCR detection kit for large yellow croaker iridovirus and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |