RU2700477C1 - Test system for detecting the genome of the causative agent of bordetella bronchiseptica dna in farm livestock - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention is a test system for DNA detection of genome of Brucella spp infection agent in farm livestock by means of polymerase chain reaction in real time, including plastic bottles and test tubes, a thermostable enzyme Tag-polymerase, a reaction buffer, a mixture of four deoxynucleotide triphosphates, an internal control sample, a positive control – a recombinant plasmid containing a fragment of the Brucella spp gene, synthetic oligonucleotide primers and probes marked with dyes, according to the invention for the internal control sample a bacteriophage T4 suspension with concentration of 5×10³ copies of nucleotide sequences per 1 mcl, and for a positive control sample – a mixture of recombinant plasmid DNA containing a fragment of the DNA genome Brucella spp and a fragment of the bacteriophage T4 genome, taken in ratio 1:1.

EFFECT: invention enables reliable diagnosing of Bordetella bronchiseptica DNA exciter.

1 cl, 2 dwg, 4 tbl

Description

The invention relates to veterinary microbiology, in particular to laboratory diagnostics of pathogens of infectious diseases, namely, means for diagnosing infection in animals, both in the practice of the veterinary service and for scientific research.

Bordetellosis is currently a widespread animal disease in many countries of the world. Bordetella bronchiseptica is the causative agent of chronic and, quite often, asymptomatic infections of the respiratory tract (tracheobronchitis) of animals. The causative agent affects animals of all age groups, but the most severe consequences develop in young individuals. The severity of the disease is associated with the presence of pathogenicity factors in B. bronchiseptica: adhesins (filamentous hemagglutinin, pertactin and fimbriae) and toxins (dermonecrotic, adenylate cyclase hemolysin and lipopolysaccharide). The infectious agent remains in the environment for a long time, therefore it is most often found in crowded places of animals (nurseries, farms, private farms) .. The possibility of transmission of the pathogen from natural epizootic foci to animals kept in farms, and, as a result, significant economic losses in the small and medium agricultural business due to the death or decline in animal productivity, determine the need for the detection of B. bronchiseptica and anti-epidemic measures.

Known kit for accelerated laboratory diagnosis of pertussis infection (Bordetella pertussis), providing for the isolation of DNA using a commercial kit, isothermal amplification is carried out using a mixture of No. 1, consisting of 10x PCR-Bst reaction buffer, 2 mM nucleotide mixture (dNTP s), 25 mM MgCl 2, a Betaine solution and three pairs of primers and a mixture of No. 2 containing a working dilution of Bst polymerase at 65 ° C for 60 minutes and 80 ° C for 2 minutes; after electrophoresis in a 2% agarose gel at 160 V for 1 hour, the amplification products are differentiated by comparing the electrophoretic mobility of the obtained DNA fragments with the mobility of the control DNA sample of B. pertussis strain and in the presence of a specific luminous profile similar to the control DNA sample of B. pertussis strain, diagnose the disease with whooping cough (RF Patent No. 2542396, 2014).

A known test system (RF patent No. 2506317, C12Q 1/68, 2014), the genome of the causative agent of infection in farm animals using multiplex polymerase chain reaction with fluorescence detection in real time, including a buffer for polymerase chain reaction, a mixture for it conduction, consisting of deoxynucleoside triphosphates, primers, and fluorescent probes specific for the infection being studied, a mixture of enzymes from DNA polymerase with antibodies that inhibit the activity of TAQ - POLYMERASE enzyme, internal control sample was negative control sample, a positive control sample.

Also known is a test system for detecting the DNA of the genome of the pathogen Bordetella bronchiseptica in farm animals using real-time polymerase chain reaction, including plastic bottles and tubes, thermostable Tag polymerase enzyme, reaction buffer, a mixture of four deoxynucleotide triphosphates, an internal control sample, positive control - recombinant plasmid containing the gene fragment of the pathogen Bordetella bronchiseptica, synthetic oligonucleotide primers and probes for molecular identification of Bordetella bronchiseptica (Mastilenko A.V., Abstract of dissertation for the degree of Candidate of Biological Sciences "Development of identification of bordetella bronchiseptica based on immunochemical and molecular genetic methods", Saratov - 2011, http://rykovodstvo.ru/exsp1 /58953/index.html?page=3).

However, in the known technical solution, a kit for PCR in an agarose body is used and the sequence is directly read by electrophoregram. The length of the fragment that can be decoded by this method is limited by the resolution of the gel electrophoresis method.

A common disadvantage of the known technical solutions is the lack of the possibility of obtaining reliable diagnostics for the detection of the genome of the pathogen DNA of the Bordetella bronchiseptica infection in farm animals.

The technical result is to obtain reliable diagnosis of the pathogen DNA Bordetella bronchiseptica.

The technical result is achieved by the fact that in a test system for detecting DNA of the genome of the causative agent of Brucella spp infection in farm animals using real-time polymerase chain reaction, including plastic bottles and tubes, thermostable Tag polymerase enzyme, a buffer for the reaction, a mixture of four deoxynucleotide triphosphates, internal control sample, positive control - recombinant plasmid containing the gene fragment of the pathogen Brucella spp, synthetic oligonucleotide primers Probes labeled with dyes of the invention for internal control sample using T4 bacteriophage suspension with a concentration of 5 × ¹⁰ March copies of nucleotide sequences to 1 l, and for the positive control - a mixture of recombinant plasmid DNA containing the genomic DNA fragment Brucella spp and a fragment of the T4 bacteriophage genome taken in a ratio of 1: 1, with the following nucleotide sequences:

B7 F TGAAGCTGCCTGCATCGGTC direct primer

B7R CATAATGGCCGGGTGTTGGCT reverse primer

B7P HEX -CAACAGCATGCAGCTTGGTCGTCAATC-BHQ1 probe

T4F TACATATAAATCACGCAAAGC - direct primer

T4R TAGTATGGCTAATCTTATTGG - reverse primer

T4P FAM ACATTGGCACTGACCGAGTTC - probe

The novelty of the claimed technical solution lies in the fact that to obtain a reliable diagnosis of the DNA pathogen Brucella spp. animal infections use a test system to conduct a reaction in one PCR tube (one tube) using specific for the Brucella spp genome region oligonucleotide primers of a fluorescently labeled probe and different types of controls for which various forms of T4 bacteriophage material are used: suspension and a fragment of the genome with specific primers and a probe. This setting of real-time GCR reduces and simplifies the analysis procedure, reduces the risk of contamination. In addition, fluorescence detection of amplification products is carried out using the principle of cleavage of the fluorescent label at the 5 'end of the oligonucleotide probe.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The claimed technical solution is recommended for use in veterinary virology, namely, the diagnostic tools Brucella spp. infections in animals, both in the practice of the veterinary service, and for scientific research, which meets the criterion of "industrial applicability".

The invention is illustrated by drawings, which show screenshots of graphs, in FIG. 1 - the FAM channel is presented - for testing the signal from the internal control sample - CTP; in FIG. Channel 2 HEX - for testing the presence of Bordetella bronchiseptica DNA. Test system for identifying the genome of the pathogen Brucella spp. infections in farm animals are used as follows.

DNA of the Bordetella bronchiseptica pathogen genome is preliminarily isolated from biological material taken from infected animals of choice: oropharyngeal swabs, transnasal or bronchoalveolar swabs, fragments of the lungs, bronchi, trachea from the sorption method. Then, a one-stage polymerase chain reaction is set up with the addition of an internal positive control, which is used as a suspension of bacteriophage T4 with a concentration of 5 × 10 copies of nucleotide sequences per 1 μl and 45 amplification cycles are performed with fluorescence detection in real time using oligonucleotide-specific pathogens primers fluorescently-labeled probe and control samples. For a positive control sample, a mixture of recombinant plasmid DNAs containing a Bordetella bronchiseptica DNA genome fragment and a bacteriophage T4 genome fragment taken in a 1: 1 ratio with the following nucleotide sequences is used:

BBrF1 GAAACCCAGGCCGCAAATTC - direct primer

BBrR1 CCCAGGCGCTCGAACAATA - reverse primer

BBRP1 [R6G] TAT AGC CGC CGC AAA CCAC [BHQ1] - probe

T4F TACATATAAATCACGCAAAGC - direct primer

T4R TAGTATGGCTAATCTTATTGG - reverse primer

T4P FAM ACATTGGCACTGACCGAGTTC - probe

Next, the accumulation of the fluorescent signal is measured by the channels: JOE (HEX) / Yellow for a specific signal; FAM / Green for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

The use of different forms of T4 bacteriophage material for different types of control: a suspension and a fragment of the genome with specific primers and a probe, is due to the fact that this allows you to control the correct course of the reaction in each tube, and also controls the stage of DNA extraction from samples.

Sequence selection and calculation of the primary structure of oligonucleotide primers and probes.

Primers specific for Bordetella bronchiseptica were selected based on the mitochondrial DNA sequence of the Bordetella bronchiseptica genome (Bordetella bronchiseptica strain D755 chromosome, complete genome, CP020651.1, plot between 4945015 and 4945092). Primers were designed using Primer Express Software v3.0 (Applied Bio-systems) and tested using BLAST to confirm their specificity. To detect amplification products, an oligonucleotide fluorescently-labeled BBrP1 probe was selected (complementary to the nucleotide sequence region limited by the annealing positions of BBrF1 and BBrR1 primers). The probe was labeled with HEX dye. To quench spontaneous fluorescence, a BHQ-1 quencher is attached at the 3'-end of the oligonucleotide probe. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

Bacteriophage T4 having genomic DNA of the order of 169-170 thousand nucleotide pairs (Enterobacteria phage T4T, complete genome GenBank: HM137666.1) was used as an internal control. As a result of the analysis, a region between 400 and 500 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity.

To detect amplification products, an oligonucleotide fluorescently labeled T4P probe was selected that is complementary to the portion of the nucleotide sequence limited to the annealing positions of the T4F and T4R primers. The probe was labeled with Fam. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

An example of a specific application of the test system to identify the genome of the causative agent of Bordetella bronchiseptica) infection in agricultural animals.

For research, B. bronchiseptica (hereinafter referred to as B. Bronchiseptica) is used from infected animals by choice of the following material: oropharyngeal swabs; transnasal or bronchoalveolar swabs; fragments of the lungs, bronchi, trachea and cell cultures.

Then carry out sample preparation. Smears and swabs are examined without prior preparation. Cultures in liquid media are examined without preliminary preparation, bacterial colonies are resuspended in 0.5 ml of physiological saline. The studied samples of fragments of the lungs, bronchi and trachea (small pieces up to 1 g by weight) are homogenized using sterile porcelain mortars and pestles or automatic homogenizers. Then prepare a 10% suspension in sterile saline or phosphate buffer. The suspension was transferred to a 1.5 ml tube and centrifuged at 600-1600 g (3000 rpm on a MiniS-pin centrifuge, Eppendorf, Germany) for 2 minutes. An aliquot of the supernatant (0.1 ml) is used for DNA extraction.

Next, carry out an analysis consisting of three stages:

- extraction of nucleitide acids (NK);

- real-time PCR reaction of RS with fluorescence detection;

- accounting for the results of the analysis.

Perform one-stage PCR RT in one test tube. For extraction (isolation) of NK from the test samples, the required number of disposable test tubes with a volume of 1.5 ml is selected, including a negative control of isolation. Pipette 10 μl of B. Bronchiseptica internal control sample (CBS) into all test tubes with the test samples, including a negative control sample (CLE), using a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl.

The set consists of a set of reagents for conducting multiplex commissioning (set No. 1) and a set of control samples (set No. 2). The compositions of the sets are shown in tables 1 and 2.

The kit is available in two versions:

1. For analysis of 55 samples (including control samples);

2. For analysis of 110 samples (including control samples).

The kits are used in accordance with the instruction for the use of the PCR-BORDETELLEZ-FACTOR reagent kit to detect virus DNA (Bordetella bronchiseptica) in biological material by polymerase chain reaction (PCR) with real-time fluorescence detection TU 21.10.60-156-51062356 -2018 http://www.vetfaktor.ru/.

The test samples are introduced in the volume according to the instructions for the set for ND extraction; a negative control sample (OKO) is introduced into the test tube of the negative control of the selection instead of the test sample (the tube is designated as VK-).

DNA is isolated from the analyzed and control samples according to the protocol of the manufacturer's instructions for the kit for the selection of NK.

Isolated DNA can be stored for one week at a temperature of 2 ° C to 8 ° C or for a year at a temperature not exceeding minus 16 ° C. Prepare samples for PCR as follows. The total volume of the reaction mixture is 25 μl, the volume of the DNA sample is 10 μl. The success of the reaction is monitored using a positive control sample (PKO) B. Bronchiseptica, ATP B. Bronchiseptica and DNA BUFFER, where for the internal control sample (CTP) use a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl, if the concentration copies of nucleotide sequences deviates to a greater or lesser extent, then duplicates of dubious samples are observed, and for a positive control sample (FFP), a mixture of recombinant plasmid DNA containing their fragment of the B. bronchiseptica DNA genome and the T4 bacteriophage genome fragment taken in a 1: 1 ratio, taken in 5,000 copies of a specific fragment in 10 μl (in a 1: 1 ratio).

In a separate tube mix the components of the kit based on each reaction:

5 μl PCR mixture of B. bronchiseptica

10 μl of the PCR mixture BUFFER B. Bronchiseptica

0.5 μl TAQ POLYMERASE

Then mix the mixture on a vortex and drop off droplets by short centrifugation. Select the required number of tubes for amplification of the DNA of the investigated and control samples. Add 15 μl of the prepared reaction mixture. Using tips with a filter in prepared tubes make:

a) in a test tube negative control PCR (K-) 10 μl of DNA buffer;

b) in a series of test tubes for the samples under study - 10 μl of the DNA of the corresponding sample is added to each;

c) in vitro positive PCR control (K +) - 10 μl of V. Bronchiseptica PCO.

The PCR reaction of RS is carried out with fluorescence detection.

The parameters of the temperature-time amplification mode on the Rotor-Gene Q, DT-96, CFX96 and LightCycIer® devices are indicated in Appendices 1, 2, 3 and 4 of the Instructions, respectively. For the amplification was used the device "DT-96".

Prepare the tubes prepared for PCR in the amplifier cells. Program the device in accordance with the manufacturer's instructions and in accordance with Appendices 1, 2, 3 and 4 of the Instruction. Next, an interpretation of the analysis results is performed. In all samples except the sample — negative sample — (K-), a fluorescence growth curve is observed (Figure 1). In four samples, including clinical sample L88_3668 and a positive control sample (+) in two repetitions, a fluorescence growth curve was observed. In vitro - a negative sample (K-) - the fluorescence growth curve is absent (figure 2).

The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for real-time PCR in accordance with the manufacturer's instructions for the device and in accordance with Appendices 1, 2,3 and 4 of the Instruction.

The results of PCR analysis are taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).

The result is considered reliable if the positive and negative DNA amplification and extraction controls are correctly passed in accordance with Table 4, FIG. 12.

The sample is considered positive (pathogen DNA (Bordetella bronchiseptica) is present) if an exponential signal growth is observed on the JOE (HEX) / Yellow channel (Fig. 2), while the Ct values of the control samples are within normal limits (Table 4). If the Ct value is determined later than the 32nd cycle for the test sample via the JOE (HEX) / Yellow channel with the correct passage of the positive and negative controls, it is considered controversial and re-examined from the stage of NC extraction. If during re-staging a similar result is observed (Ct on the JOE (HEX) / Yellow channel is more than 32), re-sampling of the material from the same animal is required for PCR studies and / or the use of alternative diagnostic methods.

If the Ct value on the JOE (HEX) / Yellow channel is less than 32 when examining re-taken material from an animal, the sample should be considered positive.

The sample is considered negative (no DNA of the pathogen (Bordetella bronchiseptica)) if there is no increase in the fluorescence signal on the JOE (HEX) / Yellow channel, while the Ct values on the FAM / Green channel and Ct of the control samples are within normal limits (Table 4, FIG. . 12).

To prove the effectiveness of using PCR with fluorescence detection in real time, a comparative analysis of the sensitivity of the claimed technical solution with the prototype was carried out, in which the PCR method with electrophoretic detection was used. The sensitivity of PCR with fluorescence detection in the detection of the genome of the pathogen genome of the pathogen Bordetella bronchiseptica was found to be 3.7–4.3% higher than PCR with electrophoretic detection.

Claims (7)

Real-time polymerase chain reaction test system for detecting Bordetella bronchiseptica genome DNA in farm animals, including plastic vials and tubes, thermostable Tag polymerase enzyme, reaction formulation buffer, a mixture of four deoxynucleotide triphosphates, an internal control sample, positive control - a recombinant plasmid containing a gene fragment of the pathogen Bordetella bronchiseptica, synthetic oligonucleotide primers and a probe, characterized in that for internal its control sample uses a suspension of T4 bacteriophage with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl, and for a positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the Bordetella bronchiseptica DNA genome and a fragment of the T4 bacteriophage genome taken in a 1: 1 ratio, with the following nucleotide sequences: BBrF1 GAAACCCAGGCCGCAAATTC - direct primer BBrR1 CCCAGGCGCTCGAACAATA - reverse primer BBRP1 [R6G] TATAGCCGCCGCAAACCAC [BHQ1] - probe T4F TACATATAAATCACGCAAAGC - direct primer T4R TAGTATGGCTAATCTTATTGG - reverse primer T4P FAMACATTGGCACTGACCGAGTTC - probe.

Images