RU2703400C1 - Method for detecting a genome of a brucella infection agent (brucella speciales) in farm animals - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention represents a method for detecting a genome of a brucellosis infection agent (Brucella spp.) in agricultural animals, involving recovering DNA from biological material from infected animals by a sorption method, staged one-stage polymerase chain reaction – with simultaneous amplification cycles with real-time detection using oligonucleotide primers specific for the genome region (Brucella spp.), probes, dyes and control samples in form of internal and positive, measurement of specific signal and control signal through channels of corresponding dyes and interpretation of results, where fluorescent detection is carried out, measuring a JOE(HEX)/Yellow accumulation of a fluorescent signal for a specific signal for testing the genome of the brucellosis infection agent (Brucella spp.), and FAM/Green channel – signal of internal control sample, if fluorescence signal accumulation curves are up to 35 cycle, result of reaction is considered positive, and if the curves do not cross the threshold line or cross it after 35 cycles, the result of the reaction is negative, and the interpretation of the results is carried out based on the presence/absence of the intersection of the fluorescence curve with the threshold line, wherein for internal control sample suspension of bacteriophage T4 with concentration of 5×10³ copies of nucleotide sequences at 1 mcl, and for a positive control sample a mixture of recombinant plasmid DNA containing a DNA fragment of Brucella spp. DNA is used and a fragment of bacteriophage T4 genome, taken in ratio 1:1, with the following nucleotide sequences: B7F TGAAGCTGCCTGCATCGGTC – forward primer, B7R CATAATGGCCGGGTGTTGGCT – reverse primer, B7P HEX-CAACAGCATGCAGCTTGGTCGTCAATC-BHQ1 – probe, T4F TACATATAAATCACGCAAAGC – forward primer, T4R TAGTATGGCTAATCTTATTGG – reverse primer, T4P FAM ACATTGGCACTGACCGAGTTC – probe.

EFFECT: invention enables reliable diagnosis of the Brucella speciales DNA exciter.

1 cl, 3 dwg, 4 tbl

Description

The invention relates to veterinary microbiology, in particular to laboratory diagnostics of pathogens of infectious diseases, namely, means for diagnosing infection in animals, both in the practice of the veterinary service and for scientific research.

A known method for detecting infections in clinical samples by the method of multiplex PNR with real-time detection (RF patent No. 2506317, C12Q 1/68, 2014), including the extraction of DNA from biological material from infected individuals by the sorption method, one-stage formulation with the addition of internal positive for controlling the multiplex reverse transcription reaction and polymerase chain reaction - with 45 amplification cycles with real-time detection using oligonucleotide-specific genome sites x primers of the fluorescently-labeled probe and control samples, measuring the accumulation of the fluorescent signal through the channels of the corresponding fluorescent dyes and interpreting the results based on the presence / absence of the intersection of the fluorescence curve with the threshold line (Threshold).

Also known is a method for isolating the causative agent of anthrax, brucellosis from other closely related species of the genus Bacillus, which includes sample preparation, DNA isolation, PCR, which use oligonucleotide primers, amplification followed by electrophoretic analysis of amplification products (RF patent 2514663, class C12Q68, cl. 2014)

The closest is the method of molecular genetic identification of Brucella spp. using a polymerase chain reaction (RF patent No. 2621864), including the extraction of DNA from biological material from infected animals by the sorption method, the formulation of a one-stage polymerase chain reaction - with simultaneous carrying out no more than 40 amplification cycles with real-time detection using site-specific Brucella genome spp.oligonucleotide primers, probes, dyes and control samples in the form of internal and positive, measurement of a specific signal and a control signal through the channels corresponding uyuschih dyes and interpretation of the results

However, in the known method, the sequence is directly read by electrophoregram. The length of the fragment that can be decoded by this method is limited by the resolution of the gel electrophoresis method.

A common drawback of the known technical solutions is the lack of the possibility of obtaining reliable diagnostics for identifying the genome of the pathogen DNA Brucella spp. Infection in farm animals.

The technical result is to obtain reliable diagnosis of the DNA pathogen Brucella spp ..

The technical result is achieved by the fact that in the method for detecting the genome of the causative agent of brucellosis infection (Brucella spp.) In farm animals, including the extraction of DNA from biological material from infected animals by the sorption method, the formulation of a one-stage polymerase chain reaction - with simultaneous carrying out no more than 40 amplification cycles with detection in real time using site-specific genomes (Brucella spp). oligonucleotide primers, probes, dyes and control samples in the form of internal and positive, measurement of a specific signal and a control signal through the channels of the corresponding dyes and interpretation of the results, according to the invention, fluorescence detection is carried out, the fluorescence signal accumulation for a specific signal is measured using the JOE (HEX) / Yellow channel testing the presence of the genome of the causative agent of brucellosis infection (Brucella spp.), and through the FAM / Green channel - the signal of the internal control sample, if the fluorescence accumulation curves of the centered signal go out to the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative, and the results are interpreted based on the presence / absence of the intersection of the fluorescence curve with the threshold line, Thus for internal control sample using T4 bacteriophage suspension with a concentration of 5 × ¹⁰ March copies of nucleotide sequences to 1 l, and for the positive control sample is a mixture of recombination -invariant plasmid DNA containing the genome DNA fragment Brucella spp. and a fragment of the genome of the bacteriophage T4 taken in the ratio 1: 1, with the following nucleotide sequences:

прямой праймер

direct primer

обратный праймер

reverse primer

зонд

probe

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд.

- probe.

The novelty of the claimed technical solution lies in the fact that to obtain a reliable diagnosis of the DNA pathogen Brucella spp. animal infections carry out the reaction in one PCR tube (one tube) using specific for the Brucella spp genome region. oligonucleotide primers of the fluorescently labeled probe and different types of control for which different forms of T4 bacteriophage material are used: suspension and a fragment of the genome with specific to it primers and probe. Such a real-time PCR setup reduces and simplifies the analysis procedure, reduces the risk of contamination. In addition, fluorescence detection of amplification products is carried out using the principle of cleavage of the fluorescent label at the 5 'end of the oligonucleotide probe.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The inventive method is recommended for use in veterinary virology, namely, the diagnostic tools Brucella spp. infections in animals, both in the practice of the veterinary service, and for scientific research, which meets the criterion of "industrial applicability".

The invention is illustrated by drawings, which show screenshots of graphs, in FIG. 1 - the FAM channel is presented - for testing the signal from the internal control sample - CTP; in FIG. 2 Channel JOE (HEX) / Yellow accumulation of a fluorescent signal for a specific signal for testing the presence of the genome of the causative agent of brucellosis infection (Brucella spp.), In FIG. 3 - a table of quantitative data for Cycling A. Yellow (Brucella spp) and A. Green (EKR).

A method for identifying the genome of the pathogen Brucella spp. infection in farm animals is as follows.

The DNA of the genome of the pathogen Brucella spp is preliminarily sorbed. from biological material taken from infected animals of choice:

1. Whole blood, blood plasma, blood serum. Blood is drawn into a test tube with 6% EDTA at the rate of 50 μl of EDTA solution per 1 ml of blood, the closed tube with blood is turned over several times. To obtain serum, blood is taken into a test tube without an anticoagulant;

2. Milk, taken in a volume of 10-30 ml in sterile dishes;

3. The contents of the abdominal cavity and stomach, spleen, liver of an aborted fetus;

4. The placenta and fruit membranes from aborted animals;

5. Content burs, hygrom;

6. Pieces of parenchymal organs (liver, spleen);

7. Paired lymph nodes paraaortic, arched, inguinal, pelvic) are taken entirely from both sides;

8. Testes with appendages from males with signs of orchitis or epididymitis.

Culture of microorganisms:

- cultures in liquid media, without preliminary preparation;

- bacterial colonies, resuspend in 0.5 ml of physiological saline.

Then, a one-stage polymerase chain reaction is carried out with the addition of an internal positive control, which is used as a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl, if the concentration of copies of nucleotide sequences deviates up or down, then duplicate samples are observed . 45 amplification cycles with fluorescence detection in real time are carried out using oligonucleotide primers specific for the pathogen genome of the fluorescence-labeled probe and control samples. For a positive control sample, a mixture of recombinant plasmid DNAs containing a fragment of the Brucella spp DNA genome and a bacteriophage T4 genome fragment taken in a 1: 1 ratio with the following nucleotide sequences is used:

прямой праймер

direct primer

обратный праймер

reverse primer

зонд

probe

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд

- probe

Next, the accumulation of the fluorescent signal is measured by the channels: JOE (HEX) / Yellow for a specific signal of the genome of the causative agent of brucellosis infection (Brucella spp.); FAM / Green for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not Cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

The use of different forms of T4 bacteriophage material for different types of control: a suspension and a fragment of the genome with specific primers and a probe, is due to the fact that this allows you to control the correct course of the reaction in each tube, and also controls the stage of DNA extraction from samples.

Sequence selection and calculation of the primary structure of oligonucleotide primers and probes.

Primers specific for Brucella spp. Were selected based on the mitochondrial DNA sequence of the Brucella genome (Brucella canis strain GB1 chromosome II, complete sequence, CP027642.1, plot between 251426 and 251535). Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity. To detect amplification products, a B7P oligonucleotide fluorescently-labeled probe was selected (complementary to the nucleotide sequence region limited by the annealing positions of B7F and B7R primers). The probe was labeled with HEX dye. To quench spontaneous fluorescence, a BHQ-1 quencher is attached at the 3'-end of the oligonucleotide probe. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

Bacteriophage T4 having genomic DNA of the order of 169-170 thousand nucleotide pairs (Enterobacteria phage T4T, complete genome GenBank: HM137666.1) was used as an internal control sample. As a result of the analysis, a region between 400 and 500 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity.

To detect amplification products, an T4P oligonucleotide fluorescently-labeled probe was selected that is complementary to the nucleotide sequence region bounded by the annealing positions of the T4F and T4R primers. The probe was labeled with Fam. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

An example of a specific implementation of the method for detecting the genome of the pathogen Brucella spp. Infection in agricultural animals.

Samples of whole blood, canned EDTA, synovial fluid, punctate from the lymph nodes, the contents of bursa and hygroma, microorganism cultures are used to isolate DNA without preliminary preparation.

To obtain serum, blood tubes (without anticoagulant) are allowed to stand at room temperature for 30 minutes until a clot forms completely. It is then centrifuged at 600-1600 g (3000 rpm on a MiniSpin centrifuge, Eppendorf, Germany) for 10 minutes at room temperature. The serum is transferred by separate filter tips to sterile 1.5 ml tubes.

To obtain a plasma, the tube with whole blood is centrifuged for 10 min at 1000 g (if the blood stood at a temperature of 2 ° C to 8 ° C for more than 1 hour after taking it, then the tube should be carefully turned several times to evenly mix the blood). Transfer plasma in an amount of at least 1 ml with disposable filter tips into sterile 1.5 ml tubes.

Samples of parenchymal organs, testes, fruit membranes, 1 cm ³ placenta, entire lymph nodes, are homogenized using sterile porcelain mortars and pestles, then a 10% suspension is prepared in sterile saline or phosphate buffer. The suspension is transferred into a 1.5 ml tube and centrifuged at 600-1600 g (3000 rpm on a MiniSpin centrifuge, Eppendorf, Germany) for 2 minutes. An aliquot of the supernatant (0.1 ml) is used for DNA extraction.

Milk in a volume of up to 10 ml is disinfected and centrifuged at 3 thousand rpm for 10-15 minutes. The supernatant was carefully removed, leaving about 0.2 ml of liquid above the sediment. The precipitate was resuspended in the remaining supernatant and 0.1 ml of the suspension was used to isolate DNA.

Analysis

Analysis using a set of reagents "PCR-BRUTZELLEZ-FACTOR" consists of three stages:

экстракция НК (на этом этапе дополнительно используют реактивы для экстракции, например набор «ДНК/РНК-С-ФАКТОР»);

NK extraction (at this stage, reagents for extraction are additionally used, for example, the DNA / RNA-C-FACTOR kit);

проведение ПЦР с флуоресцентной детекцией в режиме реального времени;

real-time PCR with fluorescence detection;

учет результатов анализа.

recording analysis results.

Next, carry out an analysis consisting of three stages:

экстракция нуклеотидных кислот (НК);

nucleotide acid (NK) extraction;

проведение реакции ПЦР РВ с флуоресцентной детекцией в режиме реального времени;

real-time PCR reaction of RS with fluorescence detection;

учет результатов анализа.

recording analysis results.

Perform one-stage PCR RT in one test tube.

For extraction (isolation) of NK from the test samples, the required number of disposable test tubes with a volume of 1.5 ml is selected, including a negative control of isolation. Pipette 10 μl of Brucella spp.B internal control sample (BAC) into each test tube containing the test sample, including a negative control sample (OKO), using a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl.

The set consists of a set of reagents for conducting multiplex commissioning (set No. 1) and a set of control samples (set No. 2).

The kit is available in two versions:

1) For analysis of 55 samples (including control samples);

2) For analysis of 110 samples (including control samples).

The composition of the kits are shown in Tables 1 and 2.

The kits are used in accordance with the instructions for use of the PCR-BRUCELLOSE-FACTOR reagent kit for detecting virus DNA (Brucella spp.) In biological material by polymerase chain reaction (PCR) with real-time fluorescence detection TU 21.10.60-103- 51062356-2015 (http://www.vetfaktor.ru/.).

The test samples are introduced in the volume according to the instructions for the kit for ND extraction; in the test tube of the negative control of isolation, instead of the test sample, the OKO is introduced (the tube is designated as VK-).

DNA is isolated from the analyzed and control samples according to the protocol of the manufacturer's instructions for the kit for the selection of NK.

Isolated DNA can be stored for one week at a temperature of 2 ° C to 8 ° C or for a year at a temperature not exceeding minus 16 ° C.

Prepare samples for PCR as follows.

The total volume of the reaction mixture is 25 μl, the volume of the DNA sample is 10 μl.

Successful passage of the reaction is monitored using BKO Brucella spp., BKO Brucella spp. and BUFFER DNA, where a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl is used for an internal control sample (CTP), and a mixture of recombinant plasmid DNA containing a fragment of the Brucella spp DNA genome is used for a positive control sample (PFC). n fragment of the genome of the bacteriophage T4, taken in a 1: 1 ratio, taken in 5000 copies of a specific fragment in 10 μl (in a 1: 1 ratio).

In a separate tube mix the components of the kit based on each reaction:

5 μl PCR mixture of Brucella spp.

10 μl of a mixture of NDP BUFFER Brucella spp.

0.5 μl TAQ POLYMERASE

Then mix the mixture on a vortex. and drop drops by short-term centrifugation. Select the required number of tubes for amplification of the DNA of the investigated and control samples. Add 15 μl of the prepared reaction mixture. Using tips with a filter in prepared tubes make:

a) in a test tube negative control PCR (K-) 10 μl of DNA buffer;

b) in a series of test tubes for the samples under study - 10 μl of the DNA of the corresponding sample is added to each;

c) in vitro positive PCR control (K +) - 10 μl of Brucella spp.

The PCR reaction of RS is carried out with fluorescence detection. For amplification was used the device "Rotor Gene Q".

The parameters of the temperature-time mode of amplification on the device "Rotor-Gene Q" are presented in table 3.

Prepare the tubes prepared for PCR in the amplifier cells. Program the device according to the manufacturer's instructions.

Next, an interpretation of the analysis results is carried out. In all samples except the sample — negative sample — (K-), a fluorescence growth curve is observed (Figure 1). In four samples, including clinical sample k88_3668 and a positive control sample (+) in duplicate, a fluorescence growth curve was observed. In vitro - a negative sample - (K-) - the fluorescence growth curve is absent (figure 2).

The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for real-time PCR in accordance with the manufacturer's instructions for the device.

The results of PCR analysis were taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).

The result is considered reliable in the case of the correct passage of positive and negative controls for amplification and DNA extraction in accordance with table 4.

To prove the effectiveness of using PCR with fluorescence detection in real time, a comparative analysis of the sensitivity of the claimed technical solution with the prototype was carried out, in which the PCR method with electrophoretic detection was used. The sensitivity of PCR with fluorescence detection was revealed when detecting the genome of the causative agent of brucellosis infection (Brucella spp.) 3.0-3.3% higher than PCR with electrophoretic detection.

Claims (7)

A method for identifying the genome of the causative agent of brucellosis infection (Brucella spp.) In farm animals, including the extraction of DNA from biological material from infected animals by the sorption method, the formulation of a one-stage polymerase chain reaction - with simultaneous amplification cycles with real-time detection using site-specific genomes ( Brucella spp.) Oligonucleotide primers, probes, dyes and control samples in the form of internal and positive, measurement of a specific signal and with the control needle through the channels of the corresponding dyes and the interpretation of the results, characterized in that they carry out fluorescence detection, measure the accumulation of the fluorescent signal for the specific test signal for the presence of the genome of the pathogen of brucellosis infection (Brucella spp.) using the JOE (HEX) / Yellow channel, and the channel FAM / Green is the signal of the internal control sample, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it After the 35th cycle, the reaction result is negative, and the results are interpreted based on the presence / absence of the intersection of the fluorescence curve with the threshold line, while for the internal control sample, a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl is used, and for a positive control sample, a mixture of recombinant plasmid DNAs containing a fragment of the Brucella spp DNA genome is used. and a fragment of the genome of the bacteriophage T4, taken in the ratio 1: 1, with the following nucleotide sequences: B7F TGAAGCTGCCTGCATCGGTC - direct primer, B7R CATAATGGCCGGGTGTTGGCT - reverse primer, B7P HEX-CAACAGCATGCAGCTTGGTCGTCAATC-BHQ1 - probe, T4F TACATATAAATCACGCAAAGC - direct primer, T4R TAGTATGGCTAATCTTATTGG - reverse primer, T4P FAM ACATTGGCACTGACCGAGTTC - probe.

Images