RU2700476C1 - Method for detecting salmonella (salmonella spp) dna in biological material of animals, food and animal and vegetable fodders - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for detecting salmonella DNA (Salmonella spp.) In biological material, food and fodders of animal and vegetable origin, involving DNA recovery by sorption method, staged one-stage polymerase chain reaction – with simultaneous amplification cycles with real-time detection using salmonella-specific (Salmonella spp.) oligonucleotide primers, probes, dyes and control samples in the form of internal and positive, measurement of a specific signal and a control signal through channels of corresponding dyes and interpretation of results, according to the invention, fluorescent detection is carried out, measuring a JOE(HEX)/Yellow channel for accumulating a fluorescent signal for a specific salmonella (Salmonella spp.) DNA signal, and a FAM/Green channel of the internal control sample signal, if the accumulation curves of the fluorescent signal reach 35th cycle, the result of the reaction is considered to be positive, and if the curves do not cross the threshold line or cross it after 35 cycles, the result of the reaction is negative, and the interpretation of the results is carried out based on the presence/absence of the intersection of the fluorescence curve with the threshold line, wherein for internal control sample suspension of bacteriophage T4 with concentration of 5×10³ copies of nucleotide sequences at 1 mcl, and a positive control sample is a mixture of recombinant plasmid DNA containing a fragment of the genome of salmonella (Salmonella spp.) DNA and a fragment of the bacteriophage T4 genome, taken in ratio 1:1.

EFFECT: invention enables reliable diagnosis of salmonella (Salmonella spp) DNA exciter in biological material, food products and fodders of animal and plant origin.

1 cl, 3 dwg, 4 tbl

Description

The invention relates to veterinary microbiology, in particular to laboratory diagnostics of pathogens of infectious diseases, namely, means for diagnosing infection in animals, both in the practice of the veterinary service and for scientific research.

A known method for the determination of microorganisms of the genus Salmonella, including the selection of biomaterial in the form of cloacal swabs or pathological material of farm birds, DNA isolation, identification of the genomic DNA of a microorganism of the genus Salmonella in PCR using specially selected primers (patent RU 2360004, class C12Q 1/68, G01N 33 / 569, 2009).

The closest is the method of molecular genetic identification of the Salmonella DNA pathogen genome using a polymerase chain reaction, including the extraction of DNA from biological material from infected animals by the sorption method, the setting up of a one-stage polymerase chain reaction - with simultaneous real-time amplification cycles using site-specific detection genome of the pathogen Salmonella DNA oligonucleotide primers, probes, dyes and control samples in the form of and positive friction, the measurement of the specific signal, and control signal channels corresponding dyes and the interpretation of results (patent RU 2410440, Cl. C12Q 1/68, G01N 33/569, 2011, p. 28).

However, in the known method, the sequence is directly read by electrophoregram. The length of the fragment that can be decoded by this method is limited by the resolution of the gel electrophoresis method, in addition - limited functionality.

A common drawback of the known technical solutions is the lack of the possibility of obtaining reliable diagnostics for identifying the genome of the pathogen Salmonella (Salmonella spp.)

The technical result is to obtain a reliable diagnosis of the pathogen Salmonella DNA (Salmonella spp.) In biological material, food and feed of animal and vegetable origin.

The technical result is achieved by the fact that in the method for detecting Salmonella DNA (Salmonella spp.) In biological material, food, and animal and vegetable feed, including the isolation of DNA by the sorption method, the formulation of a one-stage polymerase chain reaction - with simultaneous amplification cycles with real-time detection using oligonucleotide primers, probes, dyes and control samples specific for the Salmonella genome site (Salmonella spp.) as internal and positive Measuring a specific signal and a control signal through the channels of the corresponding dyes and interpreting the results according to the invention carry out fluorescence detection, measure the accumulation of the fluorescent signal for the specific Salmonella DNA signal (Salmonella spp.) using the JOE (HEX) / Yellow channel, and the signal through the FAM / Green channel internal control sample, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle , The result of the reaction - negative, but interpretation of the results is performed based on the presence / absence of the intersection of the fluorescence curve with the threshold line, thus for internal control sample using T4 bacteriophage suspension with a concentration of 5 × ¹⁰ March copies of nucleotide sequences to 1 l, and for A positive control sample uses a mixture of recombinant plasmid DNA containing a fragment of the Salmonella DNA genome (Salmonella spp.) and a fragment of the bacteriophage T4 genome taken in a 1: 1 ratio, with the following nucleotides GOVERNMENTAL sequences:

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд

- probe

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд.

- probe.

The novelty of the claimed technical solution lies in the fact that in order to obtain a reliable diagnosis of the causative agent of Salmonella DNA in biological material, food and animal and vegetable feed, the reaction is carried out in one PCR tube (one tube) using Salmonella spp specific to the genome (Salmonella spp .) oligonucleotide primers of a fluorescently labeled probe and different types of control, for which various forms of T4 bacteriophage material are used: a suspension and a fragment of the genome with specific mu primers and probe. Such a real-time PCR setup reduces and simplifies the analysis procedure, reduces the risk of contamination. In addition, fluorescence detection of amplification products is carried out using the principle of cleavage of the fluorescent label at the 5 'end of the oligonucleotide probe.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The inventive method is recommended for use in veterinary virology, and in particular to Salmonella diagnostic tools (Salmonella spp.) Both in the practice of the veterinary service and for scientific research, which meets the criterion of "industrial applicability".

The invention is illustrated by drawings, which show screenshots of graphs, in FIG. 1 shows the FAM / Green channel of the internal control signal, FIG. 2 - channel JOE (HEX) / Yellow accumulation of a fluorescent signal for a specific Salmonella DNA signal (Salmonella spp.), FIG. 3 - quantitative data table of quantitative data for Cycling A.Yellow (Salmonella spp.) And A. Green (EKO).

The method for detecting Salmonella DNA (Salmonella spp.) In biological material, food and animal and plant feed is as follows

Preliminarily, the DNA of the genome of the pathogen Salmonella (Salmonella spp.) Is isolated by sorption method and the following material is used for the study:

- Whole blood. Blood is drawn into a test tube with 6% EDTA at the rate of 50 μl of EDTA solution per 1 ml of blood, the closed tube with blood is turned over several times.

- Fragments of parenchymal organs are taken into a sterile container;

- Feces weighing 5 g are collected in a sterile plastic container;

- The placenta and fruit membranes from aborted animals are taken into a sterile container;

- Milk, taken in a volume of 10-30 ml in sterile dishes;

- Food products are selected in sterile containers;

- Chicken embryos, eggs;

- Poultry meat, pork, processed products, offal;

- Feed of animal and vegetable origin;

- Cell cultures.

Then, a one-stage polymerase chain reaction is carried out with the addition of an internal positive control, which is used as a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl and 45 amplification cycles are carried out with fluorescence detection in real time using pathogen-specific for the genome site oligonucleotide primers of a fluorescently-labeled probe and control samples. For a positive control sample, a mixture of recombinant plasmid DNAs containing a fragment of the Salmonella DNA genome (Salmonella spp.) And a fragment of the bacteriophage T4 genome taken in a 1: 1 ratio, with the following nucleotide sequences, is used:

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд

- probe

- прямой праймер

- direct primer

- обратный праймер

- reverse primer

- зонд.

- probe.

Next, the accumulation of the fluorescent signal is measured by the channels: JOE (HEX) / Yellow for a specific signal; FAM / Green for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

The use of different forms of T4 bacteriophage material for different types of control: a suspension and a fragment of the genome with specific primers and a probe, is due to the fact that this allows you to control the correct course of the reaction in each tube, and also controls the stage of DNA extraction from samples.

Sequence selection and calculation of the primary structure of oligonucleotide primers and probes.

Salmonella-specific primers (Salmonella spp.) Were selected based on the mitochondrial DNA sequence of the Salmonella genome (Salmonella spp.) (Salmonella enterica strain DA34833 chromosome, complete genome, access code: CP029595.1, section between 1313797 and 1313904). Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity. To detect amplification products, an SalP oligonucleotide fluorescence-labeled probe (complementary to the nucleotide sequence region limited by the annealing positions of the BBrF1 and BBrR1 primers) was selected. To quench spontaneous fluorescence, a BHQ-1 quencher was attached at the 3'-end of the oligonucleotide probe. The probe was labeled with HEX dye. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

Bacteriophage T4 having genomic DNA of the order of 169-170 thousand nucleotide pairs (Enterobacteria phage T4T, complete genome GenBank: HM137666.1) was used as an internal control. As a result of the analysis, a region between 400 and 500 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity.

To detect amplification products, an oligonucleotide fluorescently labeled T4P probe was selected that is complementary to the portion of the nucleotide sequence limited to the annealing positions of the T4F and T4R primers. The probe was labeled with Fam. Using the program "0ligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

An example of a specific implementation of the method for identifying the genome of the pathogen Salmonella (Salmonella spp.) In biological material, food and animal and vegetable feed consists of several stages.

Preparation of test samples

- Samples of whole blood, preserved EDTA, cell cultures are used to isolate DNA without prior preparation.

- From feces (1-5 g) prepare a 10% suspension in sterile saline. A feces suspension is decanted for 5-10 minutes. 1 ml of supernatant was collected and transferred to a clean 1.5 ml tube, centrifuged at 5000 rpm on a MiniSpin centrifuge, Eppendorf, for 5 minutes. RNA extraction from clarified feces extract is carried out immediately, if possible. If necessary, the storage is frozen.

- The test samples of tissues, organs and products (small pieces up to 1 g by weight) are homogenized using sterile porcelain mortars and pestles or automatic homogenizers. Then prepare a 10% suspension in sterile saline or phosphate buffer. The suspension was transferred to a 1.5 ml tube and centrifuged at 600-1600 g (3000 rpm on a MiniSpin centrifuge, Eppendorf, Germany) for 2 minutes. An aliquot of the supernatant (0.1 ml) is used for DNA extraction.

- In the study of chicken embryos in the shell, a hole is pierced and a sterile syringe is taken into a test tube with a volume of 1.5 ml of 1.0-1.5 ml of allantoic fluid.

- Milk in a volume of up to 10 ml is centrifuged at 3 thousand rpm for 10-15 minutes. The supernatant was carefully removed, leaving about 0.2 ml of liquid above the sediment. The precipitate was resuspended in the remaining supernatant and 0.1 ml of the suspension was used to isolate DNA.

- Feed and food products are thoroughly homogenized, a 10% suspension is prepared in sterile physiological saline. Decanted for 10 minutes. 1 ml of the supernatant was taken and transferred to a clean 1.5 ml tube, centrifuged at 5000 rpm on a MiniSpin centrifuge (Eppendorf, Germany) for 5 minutes. An aliquot of the supernatant (0.1 ml) is used for DNA extraction.

Analysis

The study is carried out using a set of reagents "PCR-SALMONELLE3-FACTOR".

The analysis consists of three stages:

- NK extraction (at this stage, reagents for extraction are additionally used, for example, the DNA / RNA-C-FACTOR kit);

- carrying out RT PCR;

- accounting for the results of the analysis.

Extraction (isolation) of NK from the studied samples is carried out as follows.

The required number of 1.5 ml disposable tubes was selected, including a negative selection control. Pipette into all test samples tubes, including a negative control (OKO) test tube, 10 μl of SALMONELLA internal control sample (EQA) as a suspension of T4 bacteriophage with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl, if the concentration copies of nucleotide sequences deviates up or down, then the repetition of doubtful samples is observed.

The test samples are introduced in the volume according to the instructions for the kit for ND extraction; in the test tube of the negative selection control, instead of the test sample, the OKO is introduced (designate the tube as VK-).

DNA is isolated from the analyzed and control samples according to the protocol of the manufacturer's instructions for the kit for the selection of NK.

Isolated DNA can be stored for one week at a temperature of 2 ° C to 8 ° C or for a year at a temperature not exceeding minus 16 ° C.

Perform one-stage PCR RT in one test tube.

The set consists of a set of reagents for conducting multiplex commissioning (set No. 1) and a set of control samples (set No. 2). The kit is available in two versions:

1) For analysis of 55 samples (including control samples);

2) For analysis of 110 samples (including control samples). The composition of the sets are shown in Tables 1 and 2.

The kits are used in accordance with the instructions for use of the PCR-SALMONELLE3-FACTOR reagent kit for the detection of Salmonella DNA (Salmonella spp.) In biological material, food and animal and plant feed by polymerase chain reaction (PCR) with fluorescence detection in real-time mode TU 21.10.60-144-51062356-2017 (http://www.vetfaktor.ru/.).

The total volume of the reaction mixture is 25 μl, the volume of the DNA sample is 10 μl. The success of the reaction is monitored using a positive control sample (PKO) of Salmonella (Salmonella spp.), An internal control sample (CTP) of Salmonella (Salmonella spp.), And BUFER DNA, where bacteriophage suspension T4 with a concentration of 5 is used for the internal control sample (CTP). × 10 ³ copies of nucleotide sequences per 1 μl, and for a positive control sample (FFP), a mixture of recombinant plasmid DNAs containing a fragment of the Salmonella DNA genome (Salmonella spp.) And a fragment of the T4 bacteriophage genome taken in the ratio and 1: 1, taken in 5000 copies of a specific volume in 10 μl (in a 1: 1 ratio).

In a separate tube mix the components of the kit based on each reaction:

5 μl PCR mixture of Salmonella (Salmonella spp.)

10 μl of PCB mix buffer Salmonella (Salmonella spp.)

0.5 μl TAQ POLYMERASE

Then mix the mixture on a vortex and drop off droplets by short centrifugation. Select the required number of tubes for amplification of the DNA of the investigated and control samples. Add 15 μl of the prepared reaction mixture. Using tips with a filter in prepared tubes make:

a) in a test tube negative control PCR (K-) 10 μl of DNA buffer;

b) in a series of test tubes for the samples under study - 10 μl of the DNA of the corresponding sample is added to each;

c) in vitro, positive PCR control (K +) - 10 μl PKO salmonella (Salmonella spp.)

The PCR reaction of RS is carried out with fluorescence detection.

To carry out the amplification, the Rotor Gene instrument was used. The temperature-time regime of amplification on the Rotor Gene is presented in Table 3.

Prepare the tubes prepared for PCR in the amplifier cells. Program the device according to the manufacturer's instructions.

Next, an interpretation of the analysis results is performed. In all samples except the sample — negative sample — (K-), a fluorescence growth curve is observed (Figure 1). In four samples, including clinical sample k88_3668 and a positive control sample (+) in duplicate, a fluorescence growth curve was observed. In vitro, a negative sample - (K-) - the fluorescence growth curve is absent (figure 2).

The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for real-time PCR in accordance with the manufacturer's instructions for the device and in accordance with Appendices 1, 2, 3 and 4 of the Instruction.

The results of PCR analysis are taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).

The result is considered reliable in the case of the correct passage of positive and negative controls for amplification and DNA extraction in accordance with table 4.

To prove the effectiveness of using PCR with fluorescence detection in real time, a comparative analysis of the sensitivity of the claimed technical solution with the prototype was carried out, in which the PCR method with electrophoretic detection was used. The sensitivity of PCR with fluorescence detection when detecting Salmonella DNA was 3.5–4.3% higher than PCR with electrophoretic detection.

Claims (7)

A method for detecting Salmonella DNA (Salmonella spp.) In biological material, food, and animal and plant feed, including DNA extraction by the sorption method, setting up a one-stage polymerase chain reaction - with simultaneous real-time amplification cycles using detection specific to the genome site Salmonella (Salmonella spp.) oligonucleotide primers, probes, dyes and control samples in the form of internal and positive, measurement of a specific signal and signal monitoring the channels of the corresponding dyes and interpreting the results, characterized in that they carry out fluorescence detection, measure the accumulation of the fluorescent signal for the specific Salmonella DNA signal (Salmonella spp.) using the JOE (HEX) / Yellow channel, and the internal control signal through the FAM / Green channel of the sample, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, then the reaction result is negative, and int The results are evaluated based on the presence / absence of the intersection of the fluorescence curve with the threshold line, while for the internal control sample, a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl is used, and for a positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the Salmonella DNA genome (Salmonella spp.) and a fragment of the bacteriophage T4 genome, taken in a 1: 1 ratio, with the following nucleotide sequences: SALF CTACGGGAAGGTGATACGCC - direct primer SALR TTATGCCAAGTCAGGGGCTG - reverse primer SALP HEX CATTGCGGGATTGTCCAGC BHQ1 - Probe T4F TACATATAAATCACGCAAAGC - direct primer T4R TAGTATGGCTAATCTTATTGG - reverse primer T4P FAM ACATTGGCACTGACCGAGTTC BHQ1 - probe.

Images