RU2696306C1 - Method for detecting rna of schmallenberg disease virus in farm animals - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for extracting RNA from biological material by choice: whole blood, blood serum, tissue and organ fragments by sorption method, synthesis of cDNA on RNA matrix by single-step staging with addition of internal and positive control samples of multiplex reverse transcription reaction and polymerase chain reaction – with 45 amplification cycles with real-time detection using oligonucleotide primers of the Schmallenberg virus specific for the region of the genome of the fluorescent-labeled probe and control samples, measuring accumulation of a fluorescent signal through channels of corresponding fluorescent dyes and interpreting results based on the presence/absence of intersection of the fluorescence curve with the threshold line Threshold, according to the invention for internal control sample suspension of bacteriophage MS2 with concentration of 5 × 10³ copies of nucleotide sequences per 1 mcl, and for a positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the genome of the Schmallenberg virus exciter and a fragment of the bacteriophage MS2 genome taken in ratio 1:1, with the following nucleotide sequences: Shm-F 5 'TCAGATTGTCATGCCCCTTGC 3' – forward primer; Shm-R 5' TCGGCCCCAGGTGCAAATC 3' – reverse primer; Shm-Z JOE-ACCATCGGCCCAGGTGCATCCCTTA-BHQ1 – probe; MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3 – forward primer; MS2R, 5'-GTACGGGCGACCCCACGATGAC-3' – reverse primer; MS2P, 5'-Cy5-CACATCGATAGATCAAGGTGCCTACAAGC-3' BHQ2 – probe, wherein accumulation of fluorescent signal is measured in channels: JOE/Yellow for specific signal of Schmallenberg virus agent; Cy5/Red for the internal control signal, if the fluorescence signal accumulation curves are up to 35 cycles, the result of the reaction is considered positive, and if the curves do not cross the threshold line or cross it after 35 cycles, the result of the reaction is negative.

EFFECT: invention enables higher diagnostic accuracy in the method for detecting RNA of the Schmallenberg disease virus in farm animals.

1 cl, 4 tbl, 3 dwg

Description

The invention relates to veterinary virology, and in particular to means for diagnosing viral and infectious diseases in animals, in particular to methods for detecting RNA of the Schmallenberg disease virus in animals.

A known method for detecting infections by multiplex PCR with real-time detection (RF patent No. 2460803, C12Q 1/68, 2014), including the isolation of RNA from biological material of infected individuals by the sorption method, cDNA synthesis on the RNA matrix by staging one-step with the addition of internal and positive control of samples of the multiplex reverse transcription reaction and polymerase chain reaction with 45 amplification cycles with real-time detection using site-specific genomes irusnogo pathogen oligonucleotide primers fluorescently-labeled probe and reference samples, measuring the accumulation of the fluorescent signal on channels corresponding fluorescent dyes and interpretation of the results based on the presence or absence of the intersection of the curve with the fluorescence threshold line - Threshold.

The closest technical essence is the method for detecting the RNA of the Schmallenberg disease virus in animals, including the isolation of RNA from the biological material of choice: whole blood, blood serum, tissue and organ fragments by the sorption method, cDNA synthesis on the RNA matrix by one-stage formulation with the addition of an internal and positive control samples of the multiplex reverse transcription reaction and polymerase chain reaction - with 45 amplification cycles with real-time detection using specific oligonucleotide primers of a fluorescently labeled probe and control samples specific for the Schmallenberg virus pathogen genome, measuring the accumulation of the fluorescent signal through the channels of the corresponding fluorescent dyes and interpreting the results based on the presence / absence of the intersection of the fluorescence curve with threshold line No. 159 Patent No. 1 of Threshold No. 159/1516 (Patent No. 1, No. 169 (Patent No. 1, No. 16, No. 16, Pat. 68, 2014 - prototype

The disadvantage of the prototype is the lack of specificity and sensitivity of oligonucleotide primers, fluorescently-labeled probe and control samples, which affects the accuracy of diagnosis.

The technical result is to increase the accuracy of diagnosis.

The technical result is achieved in that in a method for detecting RNA of the Schmallenberg disease virus in farm animals, comprising isolating RNA from a biological material of choice: whole blood, blood serum, tissue and organ fragments by the sorption method, cDNA synthesis on an RNA matrix by staging with addition of internal and positive control samples of the multiplex reverse transcription reaction and polymerase chain reaction - with 45 amplification cycles with real-time detection using oligonucleotide primers specific for the Schmallenberg virus pathogen genome of the fluorescently labeled probe and control samples, measuring the accumulation of the fluorescent signal through the channels of the corresponding fluorescent dyes and interpreting the results based on the presence / absence of the intersection of the fluorescence curve with the threshold line of the internal sample for the threshold, according to the invention a suspension of bacteriophage MS2 with a concentration of 5 × 10 ³ copies of the nucleotide sequence d per 1 μl, and for a positive control sample, a mixture of recombinant plasmid DNAs containing a fragment of the Schmallenberg virus pathogen genome and a bacteriophage MS2 genome fragment taken in a 1: 1 ratio with the following nucleotide sequences is used:

while the accumulation of the fluorescent signal is measured by the channels:

JOE / Yellow for a specific Schmallenberg virus pathogen signal;

Cy5 / Red for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

The novelty of the claimed technical solution lies in the fact that to obtain a reliable diagnosis of the Schmallenberg disease virus, two sequential reactions are used: reverse transcription of viral RNA to obtain cDNA and polymerase chain reaction for amplification of a fragment of the obtained cDNA matrix. Both reactions are carried out sequentially in one PCR tube (one tube) using oligonucleotide primers specific for the arteritis genome region, a fluorescently labeled probe, and different types of control, for which different forms of MS2 bacteriophage material are used: suspension and a fragment of the genome with primers specific to it and a probe. This real-time RT-PCR formulation shortens and simplifies the analysis procedure, reduces the risk of contamination and the possibility of errors when transferring cDNA to another PCR tube. In addition, the detection of amplification products is carried out using the principle of cleavage of the fluorescent label at the 5 'end of the oligonucleotide probe.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The inventive method is recommended for use in veterinary virology, and in particular to diagnostic tools for the causative agent of the Schmallenberg disease virus, which meets the criterion of "industrial applicability".

The invention is illustrated in the drawing, which shows screenshots of graphs and tables, in Fig. 1 - the Cy5 / Red channel is presented - for testing the signal of the internal control sample (CTP), in Fig. 2 shows the JOE / Yellow channel for a specific Schmallenberg virus pathogen signal; in fig. 3 is a table of quantitative data for Cycling A. A. Yellow (Schmallenberg virus) and A. Red (CTP).

A method for detecting RNA of the Schmallenberg disease virus in farm animals is as follows.

For research, RNA is isolated using the biological material of animals of choice: whole blood, blood serum, tissue and organ fragments taken from animals infected with the Schmallenberg virus causative agent. For an internal control sample, a suspension of bacteriophage MS2 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl is used, and for a positive control sample, a mixture of recombinant plasmid DNAs containing a fragment of the Schmallenberg virus causative agent genome and a bacteriophage MS2 genome fragment taken in a 1: 1 ratio is used. , with the following nucleotide sequences:

Then, the accumulation of the fluorescent signal is measured; the channels are: JOE / Yellow for a specific Schmallenberg virus pathogen signal; Cy5 / Red for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

The Schmallenberg disease virus is a member of the Bunyaviridae family, the genus Orthobunyavirus, the Simbu serogroup. The virus consists of three segments called S (short), M (medium) and L (long) and is transmitted through blood-sucking insects. The primers are complementary to the conserved region of the nucleocapsid protein N gene of the Schmallenberg disease virus (Schmallenberg virus N, NSs genes for nucleocapsid protein, non-structural protein, complete cds, strain: 167 / Wiltshire / 2012, access code LC309157.1, region between 360 and 446) and are not complementary to any parts of the genomes of other viruses. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested using BLAST to confirm their specificity. To detect amplification products, an Shm-Z oligonucleotide fluorescently-labeled probe (complementary to the nucleotide sequence region limited by the annealing positions of the Shm-F and Shm-R primers) was selected. The probe was labeled with HEX dye. To quench spontaneous fluorescence at the 3'-end of the oligonucleotide probe, a BHQ-1 quencher is attached. Using the Oligo 6.0 program, the basic properties of the calculated oligonucleotides are described, which determined the possibility of their use in PCR.

Using the O1igo 6.0 program, the nucleotide sequence of the bacteriophage MS2 (Enterobacteria phage MS2 isolate ST4, complete genome. ACCESSION EF204940) was analyzed. The bacteriophage MS2 contains single-stranded positively oriented RNA of 3569 bases. As a result of the analysis within the maturation protein gene, a region between 200 and 350 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. An MS2P oligonucleotide fluorescently labeled probe complementary to the nucleotide sequence region bounded by the annealing positions of the MS2F and MS2R primers was selected to detect amplification products. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

An example of a specific implementation of the method for detecting RNA of the Schmallenberg disease virus in farm animals.

For research using the following material:

- Whole blood is taken into a tube with EDTA, it is advisable to use disposable blood collection systems. A closed tube with blood is turned over several times.

- Blood serum to receive it take 5 ml of blood in a test tube without anticoagulant. It is advisable to use disposable blood collection systems.

- Fragments of the tissues and organs of dead animals (brain, spinal cord, placenta, umbilical cord) are taken into a sterile container.

- Amniotic fluid of newborn animals with malformations and stillborn fetuses, take at least 1 ml in sterile tubes.

- Blood-sucking insects, virus carriers (mosquitoes, biting midges), select at least 20 individuals in a container.

The test samples are prepared as follows.

Samples of whole blood with EDTA, blood serum, amniotic fluid are used without prior preparation. 50 μl of whole blood, amniotic fluid or 100 μl of serum are used for RNA extraction.

Small pieces of up to 1 g in weight are cut from tissues and organs. Triturated in separate porcelain mortars, add 5-10 ml of sterile saline and mix thoroughly. The mixture was left to stand at room temperature for 3 minutes, after which 50 μl of the upper phase was transferred to Eppendorf tubes and used for RNA extraction.

A mosquito sample (using 20-40 individuals) is ground in 1 ml of sterile physiological saline using sterile porcelain mortars and pestles. The resulting suspensions are centrifuged at 12 thousand rpm for 1 min. For the extraction of RNA using 100 μl of supernatant.

Next, an analysis is carried out using a set of reagents "PCR-SHMALLENBERG-FACTOR"

The kit consists of kits 1 and 2 of reagents for conducting reverse transcription and multiplex RT PCR and control samples.

The kits are used in accordance with the instructions for use of the PCR-SHMALLENBERG-FACTOR reagent kit for the detection of Schmallenberg virus RNA in biological material by reverse transcription and polymerase chain reaction (PCR) with real-time fluorescence detection (RT PCR) TU 21.10. 60-122-51062356-2016 (for in vitro diagnostics) http://www.vetfaktor.ru/.

The composition of the kit is shown in tables 1 and 2.

* Light opalescence possible

The analysis consists of three stages:

- extraction of (nucleic acids) NK;

- conducting RT-PCR RV;

- accounting for the results of the analysis.

The RT-PCR reaction of the RT is carried out in a single tube.

Extraction (isolation) of NK from clinical material

The required number of 1.5 ml disposable tubes was selected, including a negative selection control. Pipette into all tubes, including a tube for the negative control sample (OKO), an internal control sample (EKO SHMAL) of 10 μl.

Pipette the test samples in volume according to the instructions for the kit for the selection of NK, add OKO in the test tube of the negative control of the selection instead of the test sample (the tube is designated as VK-).

Select NK from the analyzed and control samples according to the protocol of the manufacturer’s instructions for the selection of NK.

Isolated RNA can be stored for up to 3 hours at a temperature of 2 ° C to 8 ° C or for a month at a temperature not exceeding minus 68 ° C.

Sample preparation for RT-PCR RT

The total volume of the reaction mixture is 25 μl, the volume of the RNA sample is 10 μl.

Successful progress of the reaction is monitored using a positive control sample (SCHMAL PKO), SCHMAL EQA and RNA buffer.

In a separate tube mix the components of the kit based on each reaction:

5 μl PCR MIX SCHMAL

10 μl PCR Buffer SCHMAL

0.75 μl RT PCR ENZ

Vortex the mixture and mix the drops by short centrifugation. The required number of tubes is selected for amplification of the NK of the studied and control samples. Then add 15 μl of the prepared reaction mixture, using tips with a filter in the prepared tubes:

a) in a test tube negative control PCR (K-) 10 μl of RNA buffer;

b) in a series of test tubes for the samples under investigation - add 10 μl of the corresponding sample NK to each, (including VK- sample);

c) in a test tube with positive PCR control (K +) 10 μl of SCHMAL PCO.

RT-PCR RV with fluorescence detection

The parameters of the temperature-time mode of amplification on the device "Rotor-Gene Q" are presented in table 3.

Place prepared tubes for PCR in amplifier cells. Program the device according to the manufacturer's instructions.

After completion of the amplification program, the waste tubes are disposed of in accordance with MU 1.3. 2569 -09.

Analysis analysis

The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for PCR in accordance with the manufacturer's instructions for the device and in accordance with Appendices 2, 3, 4 and 5 of the Instructions.

Analysis of the results of RT-PCR of the RT is carried out by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).

The result is considered reliable if the positive and negative controls for amplification and extraction of ND are correctly passed in accordance with Table 4 and Fig. 1, 2, 3.

The appearance of any Ct value (see table 4, Fig. 1.2) of the results for negative control of the VK- extraction stage on the JOE (HEX) / Yellow channel and for negative control of the RT-PCR K- stage on any of the channels indicates the presence of contamination reagents or samples. In this case, the results of the analysis for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as take measures to identify and eliminate the source of contamination.

Samples for which the Ct value is absent or exceeds the 35th cycle through the Cy5 / Red channel (while the JOE (HEX) / Yellow channel also does not have the Ct value) require repeated testing from the PCR step (table 4. Delay in threshold cycle values for the studied of samples on the Cy5 / Red channel indicates the presence of inhibitors in the samples or errors in the formulation of the RT-PCR reaction. It is required to conduct a study starting from the stage of NK extraction.

The sample is considered positive (Schmallenberg virus RNA detected) if an exponential signal growth is observed on the JOE (HEX) / Yellow channel, while the Ct values of the control samples are within normal limits (Table 4, Fig. 2, 3). If the Ct value for the test sample through the JOE (HEX) / Yellow channel is determined after the 37th cycle with the correct passage of the positive and negative controls, it is considered controversial and re-examined from the stage of NC extraction. If during re-staging a similar result is observed (Ct on the JOE (HEX) / Yellow> 37 channel), repeated sampling from the same animal is required for PCR studies and / or the use of alternative diagnostic methods.

To assess the specificity of the proposed internal and positive control samples for the reverse transcription method and polymerase chain reaction (PCR) with real-time fluorescence detection (RT PCR RT) RT-PCR RT ”to identify Schmallenberg virus RNA in biological material, RNA preparations isolated from samples containing heterologous viruses and blood from intact animals.

The absence of nonspecific reactions of the components of the kit with respect to the NK of the following viruses and microorganisms was shown: Bovine coronavirus, Bovine leukemia virus, Bovine respiratory syncytial virus, Bovine viral diarrhoea virus, Rotavirus, Brucella abortus, Pasteurella multocida, Leptospira interrogans, Listeria tuberocerbocerium bacterocerium bacterocerium bacteroceromycerocytomycerocytomycerocytomycerocytomycerocytoma , Escherichia coli, Campylobacter fetus, Clostridium perfringens, Salmonella dublin, Staphylococcus aureus, Yersinia enterocolitica, Yersinia pseudotuberculosis. The absence of nonspecific reactions of the kit components with respect to cattle DNA, sheep, pig, chicken, human, and also mosquitoes of the genus Culex was also shown.

To assess the sensitivity of RT-PCR, the reaction was carried out using a transcript obtained as a matrix of the titrated preparation obtained on a recombinant plasmid containing a fragment of the Schmallenberg disease virus genome limited by primers ShmF and ShmR. The sensitivity of the system was 10 ⁵ g-eq / ml.

Claims (5)

A method for detecting RNA of the Schmallenberg disease virus in farm animals, comprising isolating RNA from a biological material of choice: whole blood, blood serum, tissue and organ fragments by the sorption method, cDNA synthesis on an RNA matrix by staging a one-step reaction with the addition of internal and positive control samples of a multiplex reverse reaction transcription and polymerase chain reaction - with 45 amplification cycles with real-time detection using the site-specific genome and the Schmallenberg virus causative agent of the oligonucleotide primers of the fluorescently labeled probe and control samples, measuring the accumulation of the fluorescent signal through the channels of the corresponding fluorescent dyes and interpreting the results based on the presence / absence of the intersection of the fluorescence curve with the Threshold line, characterized in that the suspension uses an internal control suspension MS2 a concentration of 5 × ¹⁰ March copies of nucleotide sequences to 1 l, and for the positive control of Samples were - a mixture of recombinant plasmid DNA containing viral genome Schmallenberg pathogen fragment and the genome of the bacteriophage MS2, taken in the ratio 1: 1 with the following nucleotide sequences:

while the accumulation of the fluorescent signal is measured by the channels: JOE / Yellow for a specific Schmallenberg virus pathogen signal; Cy5 / Red for the internal control signal, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative.

Images