RU2710065C1 - Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification - Google Patents
Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification Download PDFInfo
- Publication number
- RU2710065C1 RU2710065C1 RU2018144588A RU2018144588A RU2710065C1 RU 2710065 C1 RU2710065 C1 RU 2710065C1 RU 2018144588 A RU2018144588 A RU 2018144588A RU 2018144588 A RU2018144588 A RU 2018144588A RU 2710065 C1 RU2710065 C1 RU 2710065C1
- Authority
- RU
- Russia
- Prior art keywords
- reaction
- sample
- virus
- dna
- isothermal amplification
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области ветеринарной вирусологии и биотехнологии, в частности, к выявлению ДНК вируса африканской чумы свиней в полевых условиях, научно-исследовательских учреждениях и лабораториях, с помощью модификации полимеразной цепной реакции (ПЦР), а именно в петлевой изотермической амплификации.The invention relates to the field of veterinary virology and biotechnology, in particular, to the detection of DNA of the African swine fever virus in field conditions, research institutions and laboratories, using the modification of the polymerase chain reaction (PCR), namely in loop isothermal amplification.
Африканская чума свиней (АЧС) - вирусная болезнь домашних и диких свиней, характеризующаяся геморрагическим синдромом, контагиозностью и высокой летальностью, протекающая в сверхострой, острой, подострой, хронической и инаппарантной формах.African swine fever (ASF) is a viral disease of domestic and wild pigs, characterized by hemorrhagic syndrome, contagiousness and high mortality, occurring in super-acute, acute, subacute, chronic and inapparent forms.
Вирус обладает высокой степенью патогенности (смертность среди животных достигает 100%). Разработанные методы лечения и специфической профилактики болезни малоэффективны и приводит к появлению хронической формы болезни, а затем к новым вспышкам инфекции в острой форме. Распространение АЧС наносит огромные экономические потери, складывающиеся из затрат на проведение ветеринарно-санитарных и карантинных мероприятий, убоя всего естественно восприимчивого поголовья на территории очага инфекции, а также затрат, связанных с ограничениями в международной торговле, накладываемыми на неблагополучную страну [1, 11].The virus has a high degree of pathogenicity (mortality among animals reaches 100%). The developed methods of treatment and specific prophylaxis of the disease are ineffective and lead to the appearance of a chronic form of the disease, and then to new outbreaks of infection in the acute form. The spread of ASF causes huge economic losses, consisting of the costs of veterinary-sanitary and quarantine measures, the slaughter of all naturally susceptible livestock on the site of infection, as well as the costs associated with restrictions on international trade imposed on a disadvantaged country [1, 11].
Возбудитель африканской чумы свиней - крупный ДНК-содержащий вирус семейства Asfarviridae. Диаметр вириона около 200 нм. Суперкапсидная оболочка приобретается вирусом в ходе почкования из клетки зрелого вируса и является модифицированной клеточной мембраной.The causative agent of African swine fever is a large DNA-containing virus of the Asfarviridae family. The diameter of the virion is about 200 nm. The supercapsid membrane is acquired by the virus during budding of a mature virus from the cell and is a modified cell membrane.
Особенности морфологии вируса африканской чумы свиней обуславливают его высокую устойчивость и длительную сохранность в окружающей среде. Вирус АЧС может переноситься и распространяться с контаминированными пищевыми отходами, зараженными дикими кабанами, а также клещами рода Ornithodoros [8, 10].The morphological features of the virus of African swine fever virus determine its high stability and long-term preservation in the environment. ASF virus can be transmitted and spread with contaminated food waste infected with wild boars, as well as ticks of the genus Ornithodoros [8, 10].
Заболевание является эндемичным для многих стран Южной Африки. В 2007 г. вирус АЧС был занесен в Кавказский регион, изначально в Грузию, затем в Армению, Азербайджан и во многие регионы Российской Федерации (РФ). С начала 2014 г. вспышки африканской чумы свиней постоянно регистрируются в странах восточной Европы (Польша, Литва, Латвия, Эстония) [5].The disease is endemic to many countries in South Africa. In 2007, the ASF virus was introduced into the Caucasus region, initially to Georgia, then to Armenia, Azerbaijan and many regions of the Russian Federation (RF). Since the beginning of 2014, outbreaks of African swine fever have been continuously recorded in countries of Eastern Europe (Poland, Lithuania, Latvia, Estonia) [5].
Несмотря на многолетней опыт и имеющиеся подробные рекомендации по лабораторной диагностике, идентификация вируса АЧС традиционными методами (по его биологическим свойствам) требует значительных затрат и времени. В связи с этим разработка специфичных и чувствительных экспресс-методов для обнаружения генома вируса африканской чумы свиней в полевых условиях является актуальной задачей.Despite many years of experience and available detailed recommendations for laboratory diagnostics, the identification of ASF virus by traditional methods (according to its biological properties) requires significant costs and time. In this regard, the development of specific and sensitive rapid methods for detecting the genome of the African swine fever virus in the field is an urgent task.
Для лабораторной диагностики для выявления генома возбудителя АЧС Всемирной организацией здравоохранения животных (МЭБ) рекомендуются:For laboratory diagnostics to identify the genome of the ASF pathogen, the World Organization for Animal Health (OIE) recommends:
- классическая ПЦР с детекцией продуктов амплификации в агарозном геле;- classical PCR with detection of amplification products in agarose gel;
- ПЦР в режиме реального времени (ПЦР-РВ).- Real-time PCR (PCR-RV).
По сравнению с вышеперечисленными методами, использование модифицированной ПЦР - петлевой изотермической амплификации или LAMP (Loop-mediated isothermal amplification) позволяет существенно сократить время и ресурсы, и проводить исследования в полевых условиях.Compared with the above methods, the use of modified PCR - loop isothermal amplification or LAMP (Loop-mediated isothermal amplification) can significantly reduce time and resources, and conduct research in the field.
Для стран, эндемичных по африканской чуме свиней, важна скорость постановки диагноза, а применение метода петлевой изотермической амплификации позволит оперативно, непосредственно на месте, проводить диагностические исследования этим методом, поскольку для постановки реакции используются портативные приборы, работающие на аккумуляторах.For countries endemic for African swine fever, the speed of diagnosis is important, and the use of the loop isothermal amplification method will allow you to quickly, directly on the spot, carry out diagnostic studies using this method, since portable devices running on batteries are used to set the reaction.
Метод LAMP, предложенный японским ученым Цугунори Нотоми (Tsugunori Notomi) в 2000 году [9], основывался на использовании праймеров к шести различным участкам целевой области генома.The LAMP method, proposed by the Japanese scientist Tsugunori Notomi in 2000 [9], was based on the use of primers for six different regions of the target region of the genome.
Впоследствии, метод был усовершенствован путем добавления еще одной пары праймеров - петлевых праймеров [4]. При их использовании наработка продукта идет с петель в обе стороны, а не в одну, как в оригинальном методе.Subsequently, the method was improved by adding another pair of primers - loop primers [4]. When using them, the production time of the product goes from the loops in both directions, and not in one, as in the original method.
Известен способ, разработанный Wang J. с соавторами, по выявлению ДНК вируса АЧС метом изотермической рекомбиназной полимеразной амлификациии (РПА). Праймеры в данном наборе подобраны на ген B646L, кодирующий основной капсидный белок р72. Но в данном варианте, разработанная РПА предназначена только для анализа свежеотобранного материала - крови, выделений из носа после простой процедуры лизиса (без экстракции) и линейной амплификации. Недостатком данного метода является также то, что возможна лишь частичная его оптимизация [3].A known method developed by Wang J. et al. To detect ASFV DNA by isothermal recombinase polymerase amplification (RPA). The primers in this kit are selected for the B646L gene encoding the p72 base capsid protein. But in this embodiment, the RPA developed is intended only for the analysis of freshly selected material - blood, nasal secretions after a simple lysis procedure (without extraction) and linear amplification. The disadvantage of this method is that it is only possible to partially optimize it [3].
Известен набор, разработанный сотрудниками TwistDx Ltd, Кембридж, Великобритания для диагностики АЧС методом РПА, праймеры в которой так же подобраны на области гена B646L [2].A known kit was developed by employees of TwistDx Ltd, Cambridge, UK for the diagnosis of ASF using the RPA method, in which primers were also selected for the B646L gene region [2].
Наиболее близким аналогом предлагаемого метода по сути и назначению является метод петлевой изотермической амплификации, разработанный Heather Е. James и др. [6]. В данной работе праймеры подобраны к последовательности гена, кодирующего белок вируса АЧС - топоизомераза II. Отличие данного метода от разработанного нами заключается в использованном участке генома вируса АЧС. Выбранный нами участок, ген KP177R, кодирующий белок р22, в отличии от гена, кодирующего топоизомеразу II, имеет копию на другом конце генома вируса АЧС, что может привести к повышению специфичности реакции и ее чувствительности.The closest analogue of the proposed method in essence and purpose is the isothermal loop amplification method developed by Heather E. James et al. [6]. In this work, primers are matched to the sequence of the gene encoding the ASF virus protein - topoisomerase II. The difference between this method and the one developed by us lies in the used portion of the ASF virus genome. Our selected region, the KP177R gene encoding p22 protein, unlike the gene encoding topoisomerase II, has a copy at the other end of the ASF virus genome, which can lead to an increase in the specificity of the reaction and its sensitivity.
Задачей настоящего изобретения являлась разработка высокочувствительного, экономичного и экспрессного способа выявлять присутствие ДНК вируса АЧС при помощи петлевой изотермической амплификации с целью устранения вышеуказанных недостатков.The present invention was the development of a highly sensitive, economical and rapid method for detecting the presence of ASF virus DNA using loop isothermal amplification in order to eliminate the above disadvantages.
Данная задача была решена благодаря созданию олигонуклеотидных праймеров, а также подбору условий для проведения петлевой изотермической амплификации, обеспечивающей получение результата в короткие сроки (в течение 40 минут) и при незначительных материальных затратах, снижая до минимума манипуляции при исследовании образцов крови и тканевых экссудатов в полевых условиях и лабораториях.This problem was solved thanks to the creation of oligonucleotide primers, as well as the selection of conditions for loop isothermal amplification, which provides a result in a short time (within 40 minutes) and at low material cost, minimizing manipulations in the study of blood samples and tissue exudates in the field conditions and laboratories.
Сущность изобретения заключается в новом подходе обнаружения ДНК вируса АЧС с помощью проведения модифицированной ПЦР - петлевой изотермической амплификации (метод LAMP), и с использованием разработанных олигонуклеотидных праймеров (F3 р22, В3 р22, FIP р22, BIP р22, LoopB р22), фланкирующих специфический фрагмент генома вируса АЧС. Представленный метод включает последовательности олигонуклеотидных праймеров, имеющих следующую нуклеотидный состав:The essence of the invention lies in a new approach for detecting ASFV DNA using modified PCR - loop isothermal amplification (LAMP method), and using the developed oligonucleotide primers (F3 p22, B3 p22, FIP p22, BIP p22, LoopB p22) flanking a specific fragment ASF virus genome. The presented method includes sequences of oligonucleotide primers having the following nucleotide composition:
F3 р22 GTTTTACGGATACTGCTGCF3 P22 GTTTTACGGATACTGCTGC
В3 р22 CCTTACCATATTTAAGAACCGGB3 p22 CCTTACCATATTTAAGAACCGG
FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGCFIP p22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC
BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTTBIP p22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT
LoopB р22 CCGATGACTGTACAGGTTGGGLoopB p22 CCGATGACTGTACAGGTTGGG
При помощи указанных олигонуклеотидов (F3 р22, В3 р22, FIP р22, BIP р22, LoopB р22) проводят петлевую изотермическую амплификацию, позволяющую обнаружить геном вируса АЧС. При наличии в исследуемых образцах ДНК вируса АЧС в ходе петлевой изотермической амплификации синтезируются зигзагообразные продукты, содержащие фрагменты генома данного вируса.Using these oligonucleotides (F3 p22, B3 p22, FIP p22, BIP p22, LoopB p22), loop isothermal amplification is performed to detect the ASF virus genome. In the presence of ASF virus DNA in the studied samples during the loop isothermal amplification, zigzag products containing fragments of the genome of this virus are synthesized.
Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК вируса АЧС в образцах крови, пробах органов от инфицированных животных и вируссодержащем материале.The invention can be used in veterinary medicine, clinical and laboratory diagnostics to detect ASFV DNA in blood samples, organ samples from infected animals and virus-containing material.
Техническим результатом изобретения является: расширенный спектр биологического материала (внутренние органы, сыворотка крови, цельная кровь, культура клеток), пригодного для проведения исследований без необходимости использования широкого спектра амплификаторов; сокращение времени для проведения массовых исследований проб на наличие генома вируса африканской чумы свиней.The technical result of the invention is: an expanded spectrum of biological material (internal organs, blood serum, whole blood, cell culture) suitable for research without the need for a wide range of amplifiers; reduction of time for mass studies of samples for the presence of the genome of the virus of African swine fever.
В основе предложенного способа лежит образование специфического продукта, представляющего собой смесь петлеобразных петлевых нуклеотидных структур, варьирующих по длине и структуре петель. Синтез целевого продукта начинается со специфичного связывания сконструированных праймеров с участком гена, кодирующего белок р22 в геноме вируса АЧС.The basis of the proposed method is the formation of a specific product, which is a mixture of loop-shaped loop nucleotide structures that vary in length and structure of the loops. The synthesis of the target product begins with the specific binding of the designed primers to the region of the gene encoding the p22 protein in the ASF virus genome.
Для разработки праймеров из базы данных GenBank были получены полногеномные нуклеотидные последовательности гена р22 отечественных изолятов, а также изолятов Benin97/1, OURT 88/3, L60, NHV, Ken06, BA71V, Е75 вирусов АЧС. Последовательности выравнены с помощью программы «BioEdit 7.0».To develop primers from the GenBank database, genome p22 gene sequences of domestic isolates, as well as isolates of Benin97 / 1, OURT 88/3, L60, NHV, Ken06, BA71V, E75 ASF viruses were obtained. The sequences are aligned using the program "BioEdit 7.0".
Праймеры для LAMP рассчитывались в программе PrimerExplorer V. 4. согласно руководству с учетом использования восьми участков гена. Рассчитаны 20 комплектов праймеров (FIP, BIP, F3, В3) и проведен их анализ с учетом таких параметров, как 5'- и 3-'концевая стабильность праймеров, размер фрагмента, GC-состав праймеров и положение праймеров относительно друг друга.Primers for LAMP were calculated in the PrimerExplorer V. 4. program according to the guidelines, taking into account the use of eight gene regions. 20 sets of primers (FIP, BIP, F3, B3) were calculated and their analysis was carried out taking into account such parameters as the 5'- and 3-terminal stability of the primers, fragment size, GC composition of the primers and the position of the primers relative to each other.
В результате проведенного анализа был отобран 1 комплект праймеров. В завершении процесса подбора праймеров в программе PrimerExplorer V.4. на основе полученных результатов рассчитан и петлевой праймер (Bloop).As a result of the analysis, 1 set of primers was selected. At the end of the process of selecting primers in the program PrimerExplorer V.4. Based on the results obtained, a loop primer (Bloop) was also calculated.
Основная характеристика рассчитанных олигонуклеотидов представлена в таблице 1.The main characteristics of the calculated oligonucleotides are presented in table 1.
По сравнению с ПЦР, где используется только одна пара праймеров, предложенный метод LAMP более специфичен, потому что используемые пары праймеров, гомологичны не двум, а шести участкам целевой молекулы ДНК. Кроме того, регистрировать накопление продукта можно даже визуально по помутнению пробы, которое вызвано появлением осадка пирофосфата магния, выпадающего в ходе реакции.Compared to PCR, where only one pair of primers is used, the proposed LAMP method is more specific, because the used primer pairs are homologous not to two, but six sections of the target DNA molecule. In addition, product accumulation can be detected even visually by clouding of the sample, which is caused by the appearance of a precipitate of magnesium pyrophosphate precipitating during the reaction.
В реакции используется Bst-полимераза, которая, в отличие от Taq-полимеразы, обладает способностью разделять цепи ДНК без нагрева пробы до 95°С. За счет указанного свойства Bst-полимеразы и двух из сконструированных праймеров происходит разделение цепей ДНК при одной температуре, вследствие чего отсутствует необходимость в термоциклировании и использовании для этого сложного оборудования. В процессе петлевой изотермической амплификации происходит образование специфичных петлевых структур с выпадением осадка пирофосфата магния, являющегося побочным продуктом реакции. Результат может быть учтен визуально по выпадающему осадку пирофосфата магния и/или изменению окраски реакционной смеси, а также при добавлении интеркалирующего красителя - с помощью прибора с флуоресцентной детекцией [9].The reaction uses Bst polymerase, which, unlike Taq polymerase, has the ability to separate DNA strands without heating the sample to 95 ° C. Due to the indicated property of Bst polymerase and two of the designed primers, DNA chains are separated at the same temperature, as a result of which there is no need for thermal cycling and the use of sophisticated equipment. In the process of isothermal loop amplification, the formation of specific loop structures occurs with the precipitation of magnesium pyrophosphate, which is a by-product of the reaction. The result can be taken into account visually by the precipitation of magnesium pyrophosphate and / or the color change of the reaction mixture, as well as by adding an intercalating dye, using a device with fluorescence detection [9].
Дополнительным преимуществом метода LAMP является незначительное влияние на ход реакции наличия биологических примесей, как правило, ингибирующих ПЦР. Исследуемый образец можно вносить в реакционную смесь без предварительной очистки вирусной ДНК [7].An additional advantage of the LAMP method is the insignificant effect on the course of the reaction of the presence of biological impurities, usually inhibiting PCR. The test sample can be introduced into the reaction mixture without preliminary purification of viral DNA [7].
Метод LAMP прост в исполнении, дешев (в отличие от других методов изотермической амплификации) и, в случае турбидиметрического или колориметрического учета результатов реакции, не требует использования дорогостоящего оборудования с гибридизационно-флуоресцентной детекцией.The LAMP method is simple to implement, cheap (unlike other isothermal amplification methods) and, in the case of turbidimetric or colorimetric accounting of reaction results, does not require the use of expensive equipment with hybridization-fluorescence detection.
Для проведения петлевой изотермической амплификации в отдельной пробирке готовят реакционную смесь на необходимое количество образцов (N), в число которых входит отрицательный контроль выделения (ОКВ), отрицательный контроль реакции (ОК) и положительный контроль реакции (ПК). Объем смеси для одной пробы составляет 20 мкл, содержащих:To carry out loop isothermal amplification in a separate tube, the reaction mixture is prepared for the required number of samples (N), which include negative emission control (OK), negative reaction control (OK) and positive reaction control (PC). The volume of the mixture for one sample is 20 μl, containing:
При приготовлении смеси необходимо избегать попадания прямого солнечного света, т.к. это приводит к разрушению флуоресцентных красителей. Реакционную смесь перемешивают, покачивая пробирки и центрифугируют, после чего распределяют по 20 мкл в соответствующее число пробирок (количество проб с учетом контрольных образцов + 1 шт.). В последнюю очередь вносят 5 мкл ДНК. Общий объем реакции составляет 25 мкл.When preparing the mixture, direct sunlight should be avoided, as this leads to the destruction of fluorescent dyes. The reaction mixture was stirred by shaking the tubes and centrifuged, after which they were distributed in 20 μl into the corresponding number of tubes (number of samples taking into account control samples + 1 pc.). Lastly, 5 μl of DNA is added. The total reaction volume is 25 μl.
Пробирки помещают в термостат или амплификатор (например, «Rotorgene 6000» (Corbett Research, Австралия)) с программой протекания реакции, приведенной в таблице 2. Время реакции составляет 40 минут.The tubes are placed in a thermostat or amplifier (for example, Rotorgene 6000 (Corbett Research, Australia)) with the reaction program shown in Table 2. The reaction time is 40 minutes.
В случае использования прибора с флуоресцентной детекцией и добавлении интеркалирующего красителя, флуоресценцию измеряют при 63°С на канале Green. Длительность одного цикла составляет 30 секунд, поскольку сигнал регистрируется на шаге амплификации каждые 30 секунд. Результаты интерпретируют, анализируя кривые накопления флуоресцентного сигнала для каждой пробы с помощью программного обеспечения прибора. Пробы считаются положительными, если в пробе есть значение Ct. Пробы считаются отрицательными, если значения Ct не определяются. Все значения Ct (пороговой линии) учитываются только для сигналов, поднявшихся выше фонового уровня шума и имеющих вид экспоненциальных кривых.In the case of using a device with fluorescence detection and the addition of an intercalating dye, fluorescence is measured at 63 ° C on the Green channel. The duration of one cycle is 30 seconds, since the signal is recorded at the amplification step every 30 seconds. The results are interpreted by analyzing the fluorescence signal accumulation curves for each sample using instrument software. Samples are considered positive if the sample has a value of C t . Samples are considered negative if C t values are not determined. All values of C t (threshold line) are taken into account only for signals rising above the background noise level and having the form of exponential curves.
Результаты не подлежат учету, если:Results are not subject to accounting if:
- отсутствует положительный сигнал в пробе с положительным контролем реакции. Это может свидетельствовать о неправильно выбранной программе амплификации и о других ошибках, допущенных на этапе постановки реакции. В таком случае необходимо провести реакцию еще раз.- there is no positive signal in the sample with a positive reaction control. This may indicate an incorrectly selected amplification program and other errors made at the stage of the reaction. In this case, it is necessary to carry out the reaction again.
- появляется любое значение Ct в таблице результатов для отрицательного контроля выделения и для отрицательного контроля реакции на канале Green. Это свидетельствует о наличии контаминации реактивов или образцов. Поэтому результаты анализа по всем пробам считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.- any value of C t appears in the table of results for the negative control of the allocation and for the negative control of the reaction on the Green channel. This indicates the presence of contamination of reagents or samples. Therefore, the results of the analysis for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as take measures to identify and eliminate the source of contamination.
Кроме того, результаты реакции могут быть учтены по изменению окраски реакционной смеси и турбидиметрически.In addition, the results of the reaction can be taken into account by changing the color of the reaction mixture and turbidimetrically.
В случае визуального учета реакции с помощью турбидиметрии, результат считается положительным, если выпадает белый осадок пирофосфата магния. Если проба остается прозрачной, результат считается отрицательным.In the case of visual accounting of the reaction using turbidimetry, the result is considered positive if a white precipitate of magnesium pyrophosphate precipitates. If the sample remains transparent, the result is considered negative.
При колориметрическом учете результатов реакции, цвет реакционной смеси положительной пробы меняется на зеленый; результат считается отрицательным, если цвет реакционной смеси остается без изменений (желтый).When colorimetric accounting for the results of the reaction, the color of the reaction mixture of a positive sample changes to green; the result is considered negative if the color of the reaction mixture remains unchanged (yellow).
Результат считается достоверным только в случае прохождения положительного контроля реакции (ПК) и отсутствия амплификации специфичного продукта для отрицательного контроля реакции (ОК) и отрицательного контроля выделения ДНК (ОКВ).The result is considered reliable only in the case of passing a positive reaction control (PC) and the absence of amplification of a specific product for a negative reaction control (OK) and a negative control of DNA extraction (OKV).
Использование сконструированных синтетических олигонуклеотидных праймеров позволяет проводить амплификацию фрагмента генома только вируса африканской чумы свиней.The use of designed synthetic oligonucleotide primers allows amplification of a fragment of the genome of only the virus of African swine fever.
Сущность предлагаемого изобретения пояснена примерами его использования, которые не ограничивают объем изобретения.The essence of the invention is illustrated by examples of its use, which do not limit the scope of the invention.
Пример 1. Определение специфичности петлевой изотермической амплификации для выявления генома вируса АЧС.Example 1. Determination of the specificity of loop isothermal amplification to identify the ASF virus genome.
Для оценки специфичности метода использовали 6 проб, содержащих ДНК вируса АЧС и 5 проб содержащих ДНК гетерологичных вирусов, вызывающих болезни свиней с аналогичными клиническими признаками (вирусы: классической чумы свиней (КЧС), болезни Ауески (БА), репродуктивно-респираторного синдрома свиней (РРСС), ротавирусной инфекции свиней (РВИС), трансмиссивного гастроэнтерита свиней (ТГС)), а также 1 пробу содержащую ДНК Е. coli. Результаты интерпретировали по наличию или отсутствию Ct в соответствующей графе. Результаты представлены в таблице 3.To assess the specificity of the method, 6 samples containing DNA of ASF virus and 5 samples containing DNA of heterologous viruses that cause swine diseases with similar clinical signs (viruses: classical swine fever (CSF), Aujeszky's disease (BA), reproductive and respiratory syndrome of pigs (PRSS) were used ), porcine rotavirus infection (PBIS), porcine transmissible gastroenteritis (TGS)), as well as 1 sample containing E. coli DNA. The results were interpreted by the presence or absence of Ct in the corresponding column. The results are presented in table 3.
Петлевую изотермическую амплификацию и регистрацию результатов проводили по программе, описанной выше.Loop isothermal amplification and registration of the results was carried out according to the program described above.
Пробирки поместили в амплификатор «Rotorgene 6000» (Corbett Research, Австралия)) с программой протекания реакции, приведенной в таблице 2. Время реакции составило 40 минут. Флуоресценцию измеряли при 63°С на канале Green. Длительность одного цикла составляет 30 секунд, поскольку сигнал регистрируется на шаге амплификации каждые 30 секунд. Результаты интерпретировали, анализируя кривые накопления флуоресцентного сигнала для каждой пробы с помощью программного обеспечения прибора.The tubes were placed in a Rotorgene 6000 thermocycler (Corbett Research, Australia)) with the reaction program shown in Table 2. The reaction time was 40 minutes. Fluorescence was measured at 63 ° C on the Green channel. The duration of one cycle is 30 seconds, since the signal is recorded at the amplification step every 30 seconds. The results were interpreted by analyzing the fluorescence signal accumulation curves for each sample using instrument software.
Результаты интерпретировали на основании наличия или отсутствия значения Ct. Значение Ct варьировало от 24,09 до 38,97 у проб содержащих ДНК вируса АЧС. С помощью метода петлевой изотермической амплификации выявлены все положительные образцы, в то время как образцы, содержащие ДНК других возбудителей, были отрицательные.The results were interpreted based on the presence or absence of the Ct value. The Ct value ranged from 24.09 to 38.97 in samples containing ASF virus DNA. Using the loop isothermal amplification method, all positive samples were detected, while samples containing DNA of other pathogens were negative.
Пример 2. Определение чувствительности петлевой изотермической амплификации для выявления генома вируса АЧС.Example 2. Determination of the sensitivity of loop isothermal amplification to detect the ASF virus genome.
Для определения аналитической чувствительности метода были приготовлены 5 десятикратных разведений ДНК изолята вируса АЧС. Результаты представлены в таблице 4.To determine the analytical sensitivity of the method, five ten-fold dilutions of ASFV DNA isolate were prepared. The results are presented in table 4.
Чувствительность предложенного метода составляет 1 lg ГАдЕ, что составляет 10-15 ГАдЕ50.The sensitivity of the proposed method is 1 lg GADE, which is 10-15 GADE 50 .
Таким образом, изобретение может быть использовано в ветеринарной практике для выявления генетического материала вируса африканской чумы свиней в биологических образцах при проведении скрининговых исследований, для решения научно-исследовательских задач по мониторингу распространения АЧС. Использование специфических праймеров и метод петлевой изотермической амплификации позволяет выявить генетический материал вируса АЧС при проведении массовых исследований проб.Thus, the invention can be used in veterinary practice to identify the genetic material of the virus of African swine fever in biological samples during screening studies, to solve research problems in monitoring the spread of ASF. The use of specific primers and the method of loop isothermal amplification allows us to identify the genetic material of the ASF virus during mass studies of samples.
Источники информации, принятые во внимание при составлении описания изобретения:Sources of information taken into account when drawing up the description of the invention:
1. Африканская чума свиней: монография. - Макаров В.В. - М.: РУДН, 2011. - 268 с1. African swine fever: a monograph. - Makarov V.V. - M.: RUDN, 2011 .-- 268 s.
2. Презентация Тревора Дрю на международном ветеринарном конгрессе 2015 г.2. Presentation of Trevor Drew at the 2015 International Veterinary Congress
3. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus., Wang J, Wang J Geng Y, Yuan W., Can J Vet Res. 2017 Oct; 81(4): 308-3123. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus., Wang J, Wang J Geng Y, Yuan W., Can J Vet Res. 2017 Oct; 81 (4): 308-312
4. Accelerated reaction by loop-mediated isothermal amplification using loop primers. - Nagamine K., Hase Т., Notomi T. (2002).. Molecular and cellular probes 16, 223-229.4. Accelerated reaction by loop-mediated isothermal amplification using loop primers. - Nagamine K., Hase T., Notomi T. (2002) .. Molecular and cellular probes 16, 223-229.
5. African swine fever: an epidemiological update - 
6. Detection of African swine fever virus by loop-mediated isothermal amplification. - Heather E. James, K. Ebert, R. McGonigle, Scott M. Reid, Neil Boonham, Jennifer A. Tomlinson, Geoffrey H. Hutchings, Mick Denyer, Chris A.L. Oura, Juliet P. Dukes, Donald P. King6. Detection of African swine fever virus by loop-mediated isothermal amplification. - Heather E. James, K. Ebert, R. McGonigle, Scott M. Reid, Neil Boonham, Jennifer A. Tomlinson, Geoffrey H. Hutchings, Mick Denyer, Chris A.L. Oura, Juliet P. Dukes, Donald P. King
7. Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP). - Shirato K., Yano Т., Senba S., Akachi S., Kobayashi Т., Nishinaka Т., Matsuyama S. (2014). Virology journal 11, 1397. Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP). - Shirato K., Yano T., Senba S., Akachi S., Kobayashi T., Nishinaka T., Matsuyama S. (2014). Virology journal 11, 139
8. Genomic analysis of highly virulent isolate of African swine fever virus. - Chapman DAG, Darby AC, Da Silva M, Upton C, Radford AD, Dixon LK. Emerg Infect Dis. 2011.8. Genomic analysis of highly virulent isolate of African swine fever virus. - Chapman DAG, Darby AC, Da Silva M, Upton C, Radford AD, Dixon LK. Emerg Infect Dis. 2011.
9. Loop-mediated isothermal amplification of DNA. - Notomi Т., Okayama H., Masubuchi H., Yonekawa Т., Watanabe K., Amino N., Hase T. (2000). Nucleic acids research 28, E63.9. Loop-mediated isothermal amplification of DNA. - Notomi T., Okayama H., Masubuchi H., Yonekawa T., Watanabe K., Amino N., Hase T. (2000). Nucleic acids research 28, E63.
10. Pathogenesis of African swine fever in domestic pigs and European wild boar - Blome S., Gabriel C, Beer M. // Virus research. - 2013. - T. 173. - №. 1. - C. 122-130.10. Pathogenesis of African swine fever in domestic pigs and European wild boar - Blome S., Gabriel C, Beer M. // Virus research. - 2013. - T. 173. - No. 1. - C. 122-130.
11. Purification and properties of African swine fever virus - Carrascosa A.L. et al. // Journal of virology. - 1985. - T. 54. - №. 2. - C. 337-344.11. Purification and properties of African swine fever virus - Carrascosa A.L. et al. // Journal of virology. - 1985. - T. 54. - No. 2. - C. 337-344.
- - отсутствие сигнала, проба отрицательна- - no signal, the sample is negative
«-» - отсутствие сигнала, проба отрицательна“-” - no signal, the sample is negative
«К» - отрицательный контроль реакции"K" - negative reaction control
Claims (3)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018144588A RU2710065C1 (en) | 2018-12-14 | 2018-12-14 | Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018144588A RU2710065C1 (en) | 2018-12-14 | 2018-12-14 | Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2710065C1 true RU2710065C1 (en) | 2019-12-24 |
Family
ID=69022743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2018144588A RU2710065C1 (en) | 2018-12-14 | 2018-12-14 | Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2710065C1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215311A (en) * | 2021-04-23 | 2021-08-06 | 华南农业大学 | Primer combination and kit for identifying African swine fever virus gene deletion strain and African swine fever epidemic strain by centrifugal microfluidic chip |
| NL2031407B1 (en) * | 2022-03-25 | 2022-12-30 | Maoming Branch Guangdong Laboratory For Lingnan Modern Agriculture | Primer Set, Probe, Kit and Application for Detecting African Swine Fever Virus |
| RU2799410C1 (en) * | 2022-10-06 | 2023-07-05 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К.И. Скрябина" (ФГБОУ ВО МГАВМиБ - МВА имени К.И. Скрябина) | Synthetic oligonucleotide primers and a method of highly sensitive detection of african swine fever virus dna by loop isothermal amplification in the presence of internal control sample dna |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2360971C1 (en) * | 2007-11-23 | 2009-07-10 | ГНУ ВНИИ ветеринарной вирусологии и микробиологии | Method and test system to detect dna of african swine fever virus by means of specific oligonucleotide primers in polymerase chain reaction |
| RU2639572C1 (en) * | 2016-10-21 | 2017-12-21 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Method for biomaterial preparation to control quality of swine house disinfection from african swine fever virus |
| WO2018069450A1 (en) * | 2016-10-14 | 2018-04-19 | Aarhus Universitet | Methylation biomarkers for lung cancer |
-
2018
- 2018-12-14 RU RU2018144588A patent/RU2710065C1/en active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2360971C1 (en) * | 2007-11-23 | 2009-07-10 | ГНУ ВНИИ ветеринарной вирусологии и микробиологии | Method and test system to detect dna of african swine fever virus by means of specific oligonucleotide primers in polymerase chain reaction |
| WO2018069450A1 (en) * | 2016-10-14 | 2018-04-19 | Aarhus Universitet | Methylation biomarkers for lung cancer |
| RU2639572C1 (en) * | 2016-10-21 | 2017-12-21 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Method for biomaterial preparation to control quality of swine house disinfection from african swine fever virus |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215311A (en) * | 2021-04-23 | 2021-08-06 | 华南农业大学 | Primer combination and kit for identifying African swine fever virus gene deletion strain and African swine fever epidemic strain by centrifugal microfluidic chip |
| NL2031407B1 (en) * | 2022-03-25 | 2022-12-30 | Maoming Branch Guangdong Laboratory For Lingnan Modern Agriculture | Primer Set, Probe, Kit and Application for Detecting African Swine Fever Virus |
| RU2799410C1 (en) * | 2022-10-06 | 2023-07-05 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К.И. Скрябина" (ФГБОУ ВО МГАВМиБ - МВА имени К.И. Скрябина) | Synthetic oligonucleotide primers and a method of highly sensitive detection of african swine fever virus dna by loop isothermal amplification in the presence of internal control sample dna |
| RU2806908C1 (en) * | 2022-12-23 | 2023-11-08 | Федеральное государственное учреждение "Федеральный исследовательский центр "Фундаментальные основы биотехнологии" Российской академии наук" | Method for detecting african swine fever virus dna using specific oligonucleotides by isothermal loop amplification and colorimetric detection of amplification results |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Soliman et al. | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral hemorrhagic septicaemia virus (VHS) | |
| RU2680094C1 (en) | Test system for detection of dna of leptospirosis causative agent (leptospira speciales) in agricultural animals | |
| RU2727054C1 (en) | Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction | |
| CN110699490B (en) | RAA constant-temperature fluorescence detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| RU2710065C1 (en) | Synthetic oligonucleotide primers and method for detecting dna of asf virus by loop isothermal amplification | |
| CN112725543B (en) | Characteristic nucleic acid identification primer group, kit and detection method for human norovirus GII.4 | |
| RU2694558C1 (en) | Method for genome detection of coronavirus infection causative agent in cattle | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| RU2714045C1 (en) | Oligonucleotide primers and a fluorescent-labeled probe, a method and a test system for detecting genome of virus of infective nodular dermatitis (nodular dermatitis) of cattle in real-time polymerase chain reaction | |
| RU2726242C1 (en) | Test system for detecting dna of lumpy skin disease virus (lsdv) in biological material of animals using a polymerase chain reaction in real time | |
| RU2694501C1 (en) | Test system for genome detection of rotavirus agent of type a in agricultural animals by means of multiplex polymerase chain reaction with fluorescent detection in real time | |
| RU2698662C1 (en) | Test system for detecting rna of agent of arteritis virus in horses | |
| RU2694499C1 (en) | Test system for detecting coronavirus infection pathogen genome in cattle by means of multiplex polymerase chain reaction with fluorescent detection in real time | |
| RU2700481C1 (en) | Method for detecting rna of an arteritis virus agent in horses | |
| Paraguison et al. | Possible use of RNA isolate from inactivated vaccine for external positive control in reverse transcription-based detection of foot-and-mouth disease virus in bull semen | |
| RU2731716C1 (en) | Kit for differentiating cattle pestiviruses and method for differentiating cattle pestiviruses | |
| Singh et al. | Development and Standardization of Visual Loop Mediated Isothermal Amplification (LAMP) Assay for Specific Diagnosis of Johne's Disease | |
| RU2740097C1 (en) | Method for detecting a new type coronavirus infection agent genome (ncov19) in primates | |
| RU2700450C1 (en) | Test system for detecting provirus dna of bovine leukosis virus (blv) | |
| RU2719719C1 (en) | Method for detection of dna of nodular dermatitis virus (lsdv) in animal biological material by means of polymerase chain reaction in real time | |
| RU2728342C1 (en) | Set of oligonucleotide primers and probes and method for detecting bovine pestivirus h | |
| RU2741887C1 (en) | Test system for genome detection of a coronavirus infection agent of new type (ncov19) in primates | |
| RU2799410C1 (en) | Synthetic oligonucleotide primers and a method of highly sensitive detection of african swine fever virus dna by loop isothermal amplification in the presence of internal control sample dna | |
| RU2696306C1 (en) | Method for detecting rna of schmallenberg disease virus in farm animals | |
| RU2700254C1 (en) | Test system for detecting dna of rhinotracheitis virus (bovine herpes virus 1, bohv-1) in cattle |