RU2799410C1 - Synthetic oligonucleotide primers and a method of highly sensitive detection of african swine fever virus dna by loop isothermal amplification in the presence of internal control sample dna - Google Patents

Abstract

FIELD: molecular diagnostics.

SUBSTANCE: set of oligonucleotide primers and probes for the detection of African swine fever (ASF) virus DNA and bacteriophage lambda DNA as an internal control sample of the study are described. Also a method for detecting ASF virus DNA from biological material using a set of oligonucleotide primers and probes using loop isothermal amplification (LAMP) in the presence of an internal control sample of lambda bacteriophage DNA.

EFFECT: development of a highly sensitive, specific and rapid method for detecting African swine fever virus.

3 cl, 2 dwg, 6 tbl, 3 ex

Description

The invention relates to the field of molecular diagnostics, in particular, to the detection of African swine fever (ASF) virus DNA using a nucleic acid amplification method, namely loop isothermal amplification (LAMP).

The invention can be used in veterinary laboratory diagnostics to detect ASF virus DNA in biological material from animals - whole blood/plasma/serum, smears from mucous membranes, tissue suspensions (lymph nodes, tonsils, spleen, lungs, liver).

African swine fever is a highly contagious viral disease of pigs, characterized by fever, cyanosis of the skin and extensive hemorrhages in the internal organs. Refers to especially dangerous contagious animal diseases, according to the OIE list according to the International Classification of Contagious Animal Diseases, which are defined as "contagious (transmissible) diseases that have the ability to dangerously and rapidly spread regardless of state borders, are accompanied by serious consequences in the field of public economy and health , are important in the international trade in animals and livestock products".

The causative agent of African swine fever is a large DNA-containing virus of the Asfarviridae family (virion diameter is about 200 nm). The virus has a round or icosahedral shape, the structure of the virion is complex, several layers are revealed - the outer supercapsid shell, originating from the cell and acquired in the process of leaving the cell by budding, the icosahedral capsid, consisting of subunits-capsomeres and the core of the layer of fibrillar components and nucleotide. In view of the structural features of the ASF virus, it is very resistant to factors of various nature, and therefore its survival rate in environmental objects and products of pig origin is unusually high [1, 2].

The virus has a high degree of pathogenicity (mortality among animals reaches 100%). The disease is endemic to many countries in South Africa. In 2007, the ASF virus was introduced into the Caucasus region, initially to Georgia, then to Armenia, Azerbaijan and many regions of the Russian Federation and Belarus. Since the beginning of 2014, outbreaks of African swine fever have been recorded in many European countries (Latvia, Lithuania, Estonia, Poland, Hungary, Czech Republic, Romania, Bulgaria, Slovakia, Serbia, Belgium, etc.). In 2018, when ASF spread in China, a country with a huge number of pigs, the situation worsened significantly, later ASF spread to other countries of the Asian continent, including Mongolia, Vietnam, Cambodia, North Korea, Myanmar, Laos, Philippines [3 ].

The developed methods of treatment and specific prevention of the disease are ineffective, therefore, the spread of ASF causes huge economic losses due to the implementation of veterinary and sanitary and quarantine measures and the slaughter of all naturally susceptible livestock in the territory of the infection focus.

Despite many years of experience and available detailed recommendations for laboratory diagnostics, the identification of the ASF virus by traditional methods (according to its biological properties) requires significant costs and time. For laboratory diagnostics, the World Organization for Animal Health (OIE) recommends molecular methods as having high sensitivity and specificity, including PCR (polymerase chain reaction) with detection of amplification products in agarose gel or real-time PCR with hybridization fluorescent probes. The use of similar PCR techniques in the diagnosis of ASF has significantly increased the efficiency of timely interpretation of this etiology [4, 5]. PCR has good analytical and diagnostic characteristics, but requires expensive equipment, and the study takes a lot of time (at least 4-6 hours, including the nucleic acid extraction stage). New methods of isothermal amplification appeared at the beginning of the 21st century and are successfully used to detect a wide range of pathogens of infectious diseases. Thus, the loop amplification method, LAMP, proposed by the Japanese scientist Tsugunori Notomi in 2000 [6], was based on the use of primers to six different regions of the target region of the genome. Subsequently, the method was improved by adding a pair of loop primers [7], providing additional amplification from the loops of the resulting LAMP products, which increased the efficiency of the reaction. The advantage of isothermal methods is the reduction of amplification time from several hours to 15-30 minutes. Another important advantage of isothermal methods is the possibility of their application in resource-limited conditions without the use of sophisticated equipment. An isothermal reaction can proceed at a constant temperature in a thermostat, and the results can be detected visually, for example, due to the turbidity of the solution due to the appearance of a precipitate of magnesium pyrophosphate [8] or a change in the color of pH-sensitive dyes [9].

To detect the ASF virus, several variants of isothermal amplification methods based on various technologies (LAMP, RPA, RAA-CAS12a) have been proposed; however, in most cases, the detection of amplification results is carried out using non-specific probeless detection (for example, using intercalating and pH-dependent dyes [10 , 11] or immunochromatographic strips [12]). In many cases, the declared analytical sensitivity of such rapid methods is quite low, so the sensitivity of RPA with detection on immunochromatographic strips is 150 copies per reaction [13], although in some cases the authors manage to achieve a sensitivity comparable to the sensitivity of the PCR method, so for LAMP with colorimetric detection, the authors [14] claimed a sensitivity of up to 10 copies per reaction. Colorimetric methods have advantages over other non-specific detection methods because they are more sensitive and also more resistant to the presence of opaque substances in the reaction mixture, in contrast to turbidimetric analysis.

However, the general main disadvantage of using all nonspecific detection methods is the increased probability of nonspecific reactions [14]. Fluorescent probes, such as molecular beacons or TaqMan probes [15, 16], are widely used to detect the accumulation of amplification products in PCR diagnostics. These oligonucleotide probes have a fluorophore and a fluorescence quencher, fluorescence is emitted when the quencher molecule moves away from the fluorophore. In the case of a molecular beacon, this occurs when the spire-like structure of the probe is destroyed during its hybridization with the target sequence; in the case of the TaqMan probe, the probe is destroyed during amplification due to the exonuclease activity of Taq DNA polymerase and the quencher is cleaved from the fluorophore. However, both probe types cannot be used to detect LAMP results. Molecular beacons spontaneously unfold at the LAMP reaction temperature (60 to 65°C), which increases the background signal, and TaqMan probes cannot be destroyed by Bst DNA polymerase, which does not have exonuclease activity, unlike Taq DNA polymerase.

The closest analogue of the claimed invention in essence and purpose is the method of loop isothermal amplification using intercalating dyes, developed by the authors of patent RU 2710065 C1. This method is an express test that allows amplification to be carried out within 30-40 minutes, however, its use in well-equipped laboratories is not justified, due to the inability to control the loss of nucleic material and purification from substances inhibiting the amplification reaction during DNA extraction. Moreover, amplification in the presence of intercalating dyes can give false positive results due to non-specific reactions, which impairs the diagnostic performance of the method. The use of an internal control sample from the DNA extraction step, provided in our invention, makes it possible to control the loss of nucleic material and the inhibition of the amplification reaction, which significantly improves the diagnostic sensitivity of the method and reduces the number of false negative results.

In order to eliminate the above disadvantages, the present invention aims to develop a highly sensitive and rapid method for detecting the presence of ASF virus DNA using loop isothermal amplification with hybridization fluorescent probes. The developed method is a fast alternative to PCR and makes it possible to multiplex the detection of ASF virus DNA and DNA of an internal control sample in one test tube using various fluorescent labels. Modified internal FIP primers containing a fluorescence quencher at the 5' end in duplex with a small oligonucleotide containing a fluorophore at the 3' end were used as probes. Also, in contrast to the method proposed in patent RU 2 710 065 C1, which uses as a target a fragment of the gene encoding the p22 protein of the ASF virus, in this work, oligonucleotide primers are selected for the well-studied and often used for the development of PCR methods for detecting the ASF virus of the target - a fragment of the major gene. capsid protein p72 [17, 18, 19, 20].

The task of developing a highly sensitive, specific and rapid method for detecting the ASF virus was solved by creating oligonucleotide primers complementary to the p72 gene region of the ASF virus, as well as creating primers complementary to the region of the right arm of the bacteriophage lambda genome and selecting conditions for their joint loop isothermal amplification, which provides the result within 20-30 minutes.

The essence of the invention lies in a new approach for the detection of ASF virus DNA using a modified loop isothermal amplification using the developed oligonucleotide primers (ASF-F3, ASF-B3, ASF-F, ASF-BL, ASF-FIP, ASF-BIP) flanking a specific a fragment of the ASF virus genome, oligonucleotide primers (IC-F3, IC-B3, IC-F, IC-BL, IC-FIP, IC-BIP) flanking specific fragment of bacteriophage lambda, as well as ASF-FIP-BHQ1/ ASF-R6G probes , IC-FIP- BHQ1/ IC-FAM based on internal FIP primers. The approach used in this invention is based on the use of FIP modified primers carrying a fluorescence quencher at the 5' end in combination with oligonucleotides complementary to the 5' regions of the FIP primers and carrying a fluorophore at the 3' end, as previously described by the authors [24].

The presented method includes the sequences of oligonucleotide primers having the following nucleotide composition:

ASF-F3 ATTACGTCTTATGTCCAGA,

ASF-B3 AGACTGGATATAAGCACTTG,

ASF-F TCACAATATCCAAACAGCAGGT,

ASF-BL TAAGAATAGGTTTGCTYTGGTG,

ASF-FIP ACCAACCCGAAATTCCTTTCACTTTTTGCGTCCGTAATAGRGTRATA,

ASF-BIP GTTCGCTCGTATCATTTTCATTTTTAGGTATCGGTGGAGGGAACY,

IC-F3 AAACGCAACGAGGCTCTA,

IC-B3 GGATTTGTTCAGAACGCTC,

IC-FL ACAGCTTCCGCTGTCTTCTCA,

IC-BL GTTGACGACGACATGGCTC,

IC-FIP CCTGCTGATCTGCGACTTATTTCGAGAGTGCGTTGCTTAAC,

IC-BIP GGATTCCAAAGTTCTCAATGCTTTTGAGAATCGCAGCAACTTGT

ASF-FIP-BHQ1/ ASF-R6G

BHQ1-ACCAACCCGAAATTCCTTTCACTTTTTGCGTCCGTAATAGRGTRATA / GTGAAAGGAATTTCGGGTTGGT-R6G,

IC-FIP-BHQ1/ IC-FAM

BHQ1-CCTGCTGATCTGCGACTTATTTCGAGAGTGCGTTGCTTAAC /

ATAAGTCGCAGATCAGCAGG-FAM.

The method for detecting ASF virus DNA is based on the extraction of DNA from biological material together with the DNA of an exogenous control sample (bacteriophage lambda) and amplification of the obtained DNA in the "real time" mode by the isothermal method. Amplification of a DNA fragment of bacteriophage lambda during the study will indicate the absence of inhibition of the reaction and loss of DNA during extraction, which will eliminate false negative results.

With the DNA samples obtained at the extraction stage, isothermal loop amplification of DNA is carried out using Bst DNA polymerase and a set of specific oligonucleotide primers (ASF-F3, ASF-B3, ASF-F, ASF-BL, ASF-FIP, ASF-BIP, IC-F3 , IC-B3, IC-F, IC-BL, IC-FIP, IC-BIP), including quencher-labeled primers associated with fluorescently labeled oligonucleotides (ASF-FIP-BHQ1/ ASF-R6G, IC-FIP-BHQ1/ IC-FAM). During amplification, the fluorescently labeled oligonucleotide is displaced from the quencher primer, which leads to an increase in the fluorescence intensity.

Fluorescent signal detection is carried out using an amplifier with a fluorescent signal detection system. Thus, during the study, two reactions are carried out simultaneously in one test tube - amplification of the DNA of the ASF virus and amplification of the DNA of the bacteriophage lambda, the results are recorded using two channels of fluorescent detection.

For the development of primers, the nucleotide sequences of fragments of the genomes of ASF virus isolates from the NCBI databases, including domestic published sequences, were used. The sequences were aligned relative to each other using the Mega-X (ClustalW algorithm) and Ugene (MUSCLE algorithm) programs to identify specific and conserved regions. Then, primers for LAMP were selected on selected genome regions that were quite conservative for the ASF virus. The primers were checked for the absence of significant homology with the nucleotide sequences of all non-target organisms from the NCBI database, which includes the GenBank + EMBL + DDBJ + PDB nucleotide sequences, using the Basic Local Alignment Search Tool BLAST resource [22]. The presence of polymorphisms in the regions of the primers for different sequences of the target virus was also assessed, if necessary, introduced into the oligonucleotide degenerate primers to take into account significant variants. Less significant polymorphisms located inside the primers or at the 5'-end for the F3, B3 primers and the F2, B2 fragments of the FIP, BIP primers or at the 3'-end of the F1c, B1c fragments of the FIP, BIP primers were left without degeneration. Primers for LAMP were selected based on the following criteria: specificity; melting point of primers; composition of primers; distance between primers; absence of significant hairpins; the absence of significant dimers at the 3' ends of the primers; lack of significant dimers with other primers; primer length; GC composition; dinucleotide repeats within the primers, as well as repeats of the same nucleotides more than 3 times in a row, were avoided in the primers.

Specificity was checked using the NCBI database of nucleotide sequences [22]. The melting point of the primers was estimated using the Oligo Calc: Oligonucleotide Properties Calculator online program [23]. For the inner regions of the primers (F1c, B1c, FL, BL) it should be several degrees higher than for the outer ones (F3, B3, F2, B2). The absence of significant secondary structures (hairpins and dimers) was checked using the PrimerSelect program (Dnastar, Inc., Madison, WI). To detect the results of LAMP, modified primers were used that formed a duplex with oligonucleotides bearing a fluorescent label. In the duplex of the modified primer and the fluorescently labeled oligonucleotide formed before the amplification reaction, the fluorophore and the quencher are in close proximity. During loop amplification, Bst DNA polymerase displaces the fluorescently labeled oligonucleotide from the 5' end of the modified primer, which leads to the accumulation of a fluorescent signal in the reaction mixture.

The use of duplexes of a quencher-labeled primer with a complementary oligonucleotide labeled with a fluorophore makes it possible to monitor the reaction of isothermal amplification due to the accumulation of fluorescence when the modified primer is included in the amplification process, followed by displacement of the complementary Bst oligonucleotide by DNA polymerase.

The main characteristics of the calculated oligonucleotides are presented in Table 1.

Table 1 - LAMP primers for detection of ASF virus DNA Name sequence (5′-3′) length ASF-F3 ATTACGTCTTATGTCCAGA 19 ASF-B3 AGACTGGATATAAGCACTTG 20 ASF-FL TCACAATATCCAAACAGCAGGT 21 ASF-BL TAAGAATAGGTTTGCTYTGGTG 20 ASF-FIP ACCAACCCGAAATTCCTTTCACttttTTGCGTCCGTAATAGRGTRATA 48 ASF-BIP GTTCGCTCGTATCATTTTCATttttAGGTATCGGTGGAGGGAACY 46 IC-F3 aaacgcaacgaggctcta 18 IC-B3 GGATTTGTTCAGAACGCTC 19 IC-FL ACAGCTTCCGCTGTCTTCTCA 21 IC-BL gttgacgacgacatggctc 20 IC-FIP CCTGCTGATCTGCGACTTAtttcgagagtgcgttgcttaac 41 IC-BIP ggattccaaagttctcaatgcttttGAGAATCGCAGCAACTTGT 44 ASF-FIP-BHQ1 BHQ1-ACCAACCCGAAATTCCTTTCACTTTTTGCGTCCGTAATAGRGTRATA 48 ASF-R6G GTGAAAGGAATTTCGGGTTGGT-R6G 22 IC-FIP-BHQ1 BHQ1-CCTGCTGATCTGCGACTTATTTCGAGAGTGCGTTGCTTAAC 41 IC-FAM ATAAGTCGCAGATCAGCAGG-FAM 20

* Designations for degenerate nucleotides: Y = C or T, R = A or G.

A 2.5 x LAMP mixture is prepared containing the following components: primers for amplification of ASF virus DNA and bacteriophage lambda DNA (Table 1) in the following concentrations ASF-FIP, IC-FIP - 1.0 μM each, ASF-BIP, IC-BIP - 2.5 µM each, ASF-F3, ASF-B3, IC-F3, IC-B3 - 0.5 µM each, ASF-FL, IC-FL, ASF-BL, IC-BL - 1.0 µM, primer probes ASF-FIP- BHQ1, IC-FIP-BHQ1 at 1.5 µM, ASF-R6G , IC-FAM - 2.0 µM, 1.4 mM each dNTP (Synthol, Russia), sterile deionized water.

To conduct LAMP, DNA is preliminarily extracted from the samples under study in the presence of bacteriophage lambda added before extraction (from the collection of the National Research Center "Kurchatov Institute" GosNIIgenetika) to a concentration of 10^5 - 10^6 copies/ml. For DNA extraction, reagent kits "NK-set-OD", "NK-sorb-OD" OD-Test or other kits of reagents appropriate for the purpose of the biological material under study can be used.

In parallel with DNA samples extracted from biological material from animals, control samples are examined - “K+”, containing DNA of the ASF virus, “K-”, not containing DNA of the ASF virus and bacteriophage lambda, as well as the control sample of the stage of extraction of nucleic acids “OK” containing the DNA of the bacteriophage lambda and not containing the DNA of the ASF virus.

The LAMP assay is preferably carried out in a 25 µl volume of the reaction mixture containing 10 µl of the DNA probe; 5 µl of 5x buffer for LAMP (Genterra, Russia); 8 u.a. Bst DNA polymerase (Genterra, Russia); 10 µl 2.5x LAMP mix; final volume 25 µl.

In a separate tube, prepare the reaction mixture for the required number of samples, which include a negative extraction control (OK), negative and positive amplification controls (K-, K+) plus a margin for one reaction.

The components of the reaction mixture are mixed immediately before the LAMP study. The reaction mixture is gently mixed and added to 15 µl tubes prepared for amplification. Then, 10 μl of DNA samples obtained as a result of extraction from the studied samples are added to the test tubes, control reactions are put - positive control (K +) - 10 μl of the K + sample are added to the test tube with the reaction mixture; negative control (K-) - 10 μl of sample K- is added to the test tube with the reaction mixture; negative extraction control (OK) - 10 μl of the sample extracted from OK is added to the test tube with the reaction mixture. The total reaction volume is 25 μl.

Program the cycler with a fluorescent signal detection system (for example, Rotor-Gene Q (QIAGEN GmbH), Rotor-Gene 6000 (Corbett Research), CFX 96 (Bio-Rad), DTprime (DNA Technology)) to run a program for amplification and detection of a fluorescent signal - 65°С, 30 sec, detection after each cycle on FAM/Green, HEX/Yellow channels, set to 60 cycles. Install test tubes in the cells of the reaction module of the instrument. Upon completion of the amplification, the data obtained are analyzed using the software of the device used to carry out the amplification. Fluorescent signal accumulation curves are analyzed for FAM/Green and HEX/Yellow channels. The results are interpreted based on the presence (or absence) of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which determines the presence (or absence) of the threshold cycle value (Ct) for this DNA sample in the corresponding column of the results table.

The principles for interpreting the results are as follows:

ASF virus DNA detected If a Ct value per channel for the HEX/Yellow fluorophore is determined, the Cycle Threshold (Ct) value per channel for the FAM/Green fluorophore may or may not be detected. ASF virus DNA was not detected if there is no Ct value on the channel for the HEX/Yellow fluorophore, while the cycle threshold (Ct) value for the channel for the FAM/Green fluorophore is less than the boundary value (Ct ≤45). The result is invalid if there is no Ct value on the channel for the HEX/Yellow fluorophore, while the threshold cycle (Ct) value for the channel for the FAM/Green fluorophore is not determined or more than the boundary value is determined (Ct > 45).

In case of obtaining an invalid or doubtful result, it is necessary to re-examine the sample, starting from the stage of DNA extraction. If the result is repeated, it is recommended to retake the material for analysis.

The results are to be taken into account only if the correct results are obtained for the controls of the stages of DNA extraction and amplification: K+ - the value of the threshold cycle is not taken into account for the FAM/Green fluorescence channel, the Ct value <40 is determined for the HEX/Yellow fluorescence channel; K - for both FAM/Green, HEX/Yellow fluorescence channels, there are no values of threshold cycles (Ct); OK - according to the FAM/Green fluorescence channel, the value of the threshold cycle is determined by Ct <40, according to the HEX/Yellow fluorescence channel, the Ct value is absent.

If for the positive control K+ the value of the threshold cycle (Ct) for the channel for the HEX/Yellow fluorophore is absent or exceeds the limit value, it is necessary to repeat the study for all samples (starting from the stage of DNA extraction). High the likelihood of contamination of the laboratory or test samples with amplification products, it is necessary to take measures to identify and eliminate the source of contamination and repeat the study for all samples.

All threshold cycles, Ct, are taken into account only for signals that have risen above the background noise level and have the form of exponential curves. If the value of the threshold cycle (Ct) is determined for the test sample, and there is no characteristic exponential rise on the fluorescence plot, it is necessary to check the correctness of the selected level of the threshold line or the parameters for calculating the baseline. If the result is obtained with the correct threshold and baseline settings, the study for this sample must be repeated.

The essence of the claimed invention is illustrated by examples of the invention.

Example 1. Determination of the specificity of loop isothermal amplification with hybridization-fluorescent probes for the detection of the ASF virus genome.

To assess the specificity of the method, DNA of the Stavropol 01/08 strain of the ASF virus was used, as well as DNA of heterologous viruses that cause diseases in pigs with similar clinical signs - DNA of the Amursky-2019 strain of the classical swine fever virus, DNA of the Samara-96 strain of the virus porcine reproductive and respiratory syndrome, DNA of the Gubkinsky strain of the porcine transmissible gastroenteritis virus; DNA of the strain "Arsky" of the Aujeszky's disease virus from the collection of the Federal State Budgetary Scientific Institution FITsViM.

Loop isothermal amplification was performed according to the program with an increased number of cycles to exclude false positive reactions, the reaction time was 50 minutes (the standard recommended study time is 30 minutes) on a CFX 96 cycler (Bio-Rad) (table 2).

Table 2. Amplification program for determining the specificity of loop isothermal amplification. Cycle Temperature, °С Time Fluorescence signal detection Quantity
cycles 1 65 30 sec FAM/Green, HEX/Yellow 100

The results obtained are presented in Table 3 and in FIG. 1.

The results were interpreted by analyzing the fluorescent signal accumulation curves for each sample using the instrument software. The results were interpreted based on the presence or absence of a Ct value. For a sample containing ASF DNA and a positive amplification control, an amplification signal was obtained at 14 (Ct 25.92) and 13 (Ct 24.61) minutes of the study, respectively, while samples containing DNA of other pathogens were negative up to 50 minutes of research.

Table 3 Determination of the specificity of loop isothermal amplification with hybridization-fluorescent probes for the detection of the ASF virus genome DNA sample Strain Fluorophore Cycle Threshold value per channel Result,
ASF virus DNA Сt, FAM Сt, HEX ASF virus Stavropol 01/08 N/A 25.92 discovered CSF virus Amursky-2019 23.78 N/A not found PRRS virus Samara-96 33.90 N/A not found tgs virus Gubkinsky 26.90 N/A not found Aujeszky's disease virus Arsky 41.56 N/A not found K+ ND 24.61 corresponds K- N/A N/A corresponds OK 33.10 N/A corresponds

All samples containing DNA of heterologous viruses were determined to be negative, not containing DNA of the ASF virus, in the presence of a signal for the detection of DNA of GTV in the range of 14-22 minutes.

Example 2. Determination of the sensitivity of loop isothermal amplification with hybridization-fluorescent probes for detection of the ASF virus genome.

To determine the analytical sensitivity of the method, dilutions of DNA of a recombinant plasmid containing a known concentration of a fragment of the ASF virus genome were prepared.

Loop isothermal amplification was performed at 65°C for 30 minutes with detection of a fluorescent signal every 30 seconds on a CFX 96 amplifier (Bio-Rad). The results are shown in FIG. 2 and in table 4.

The sensitivity of the proposed method is 2*10^3 copies/ml (20 DNA copies per reaction), ASF virus DNA is reproducibly detected in all samples containing recombinant plasmid DNA.

Table 4 Determination of the sensitivity of loop isothermal amplification with hybridization-fluorescent probes for the detection of the ASF virus genome. ASF virus DNA sample,
copies/ml Threshold cycle value by HEX channel Result,
ASF virus DNA Сt min, Сt/2 10^4 25.06 12.5 discovered 10^4 25.57 12.8 discovered 10^4 25.08 12.5 discovered 10^4 25.90 13.0 discovered 10^4 26.21 13.1 discovered 2*10^3 30.54 15.3 discovered 2*10^3 30.02 15.0 discovered 2*10^3 31.12 15.6 discovered 2*10^3 30.01 15.0 discovered 2*10^3 28.03 14.0 discovered 10^3 34.74 17.4 discovered 10^3 N/A N/A not found 10^3 N/A N/A not found 10^3 33.26 16.6 discovered 10^3 N/A N/A not found K+ 21.58 10.8 corresponds K- N/A N/A corresponds

Example 3. Determination of diagnostic sensitivity and specificity of loop isothermal amplification with hybridization-fluorescent probes.

To test the diagnostic sensitivity and specificity of LAMP methods, 42 blood plasma samples and 21 tissue suspension samples (tonsils, spleen, lungs) were used. These samples were preliminarily tested using two diagnostic PCR kits from different manufacturers with a declared analytical sensitivity of at least 1*10^3 copies/ml, designed to detect ASFV in biological material from animals. The results of detection of ASF virus DNA by PCR kits gave completely comparable results, 22 of 42 plasma samples and 11 of 21 tissue suspension samples contained ASF virus DNA (Table 5).

Among 33 samples of biological material containing ASF virus DNA, 26 samples had sufficient viral load with threshold cycles of PCR Ctmean less than 35 cycles, 7 samples had a low content of ASFV DNA in the samples, PCR Ctmean more than 35 cycles.

Loop isothermal amplification was performed according to the program with an increased number of cycles to exclude false positive reactions, the reaction time was 50 minutes (the standard recommended study time is 30 minutes) on a CFX 96 cycler (Bio-Rad) (table 2).

The method presented in this LAMP patent makes it possible to detect ASF virus DNA in all samples with sufficient viral load, the time for accumulation of fluorescence to the threshold level with LAMP is from 12 to 22 minutes. For samples with a low viral load (PCR Ct av > 35), the LAMP method allowed the detection of virus in 6 (7) samples. All 30 PCR negative samples were identified correctly, even with an increase in the reaction time to 50 min, which indicates the high specificity of the developed LAMP method. The results are presented in table 5.

Table 5. Comparison of PCR results with LAMP results on biological samples from animals containing and not containing ASF virus DNA. N sample type PCR LAMP Presence of ASF virus Material PCR 1
Ct PCR 2
Ct PCR,
Ct avg. ASF (HEX), min, Ct/2 EKO (FAM), min, Ct/2 1 positive blood plasma 31.73 36.34 34.0 22.7 33.4 2 positive blood plasma 37.43 38.96 38.2 22.2 42.3 3 positive blood plasma 26.44 23.12 24.8 18.4 25.2 4 positive blood plasma 15.67 18.98 17.3 14.6 31.4 5 positive blood plasma 19.38 31.39 25.4 20.4 nd 6 positive blood plasma 29.13 25.14 27.1 23.7 38.3 7 positive blood plasma 26.81 26.78 26.8 16.8 34.0 8 positive blood plasma 35.61 38.98 37.3 33.5 29.3 9 positive blood plasma 27.62 27.41 27.5 22.5 nd 10 positive blood plasma 32.87 29.62 31.2 26.3 28.1 eleven positive blood plasma 32.50 32.50 32.5 18.3 33.7 12 positive blood plasma 15.76 17.11 16.4 14.9 nd 13 positive blood plasma 12.67 18.93 15.8 16.9 28.9 14 positive blood plasma 28.73 25.78 27.3 17.9 nd 15 positive blood plasma 40.11 39.52 39.8 nd 26.1 16 positive blood plasma 34.25 36.28 35.3 17.9 nd 17 positive blood plasma 19.98 22.54 21.3 22.1 nd 18 positive blood plasma 28.49 30.72 29.6 14.4 31.8 19 positive blood plasma 13.49 12.53 13.0 14.6 nd 20 positive blood plasma 18.64 15.98 17.3 15.3 nd 21 positive blood plasma 20.25 17.98 19.1 17.9 33.7 22 positive blood plasma 35.23 40.72 38.0 15.3 nd 23 positive organ suspension 19.87 23.74 21.8 16.2 nd 24 positive organ suspension 29.07 22.26 25.7 27.0 nd 25 positive organ suspension 27.80 22.96 25.4 15.4 33.6 26 positive organ suspension 14.16 18.29 16.2 17.5 nd 27 positive organ suspension 25.87 23.06 24.5 20.8 29.8 28 positive organ suspension 19.30 22.92 21.2 14.2 28.5 29 positive organ suspension 37.20 38.42 37.8 29.1 24.2 thirty positive organ suspension 32.30 32.34 32.3 21.5 28.4 31 positive organ suspension 38.60 33.56 36.1 19.6 27.8 32 positive organ suspension 20.64 19.50 20.1 14.0 29.3 33 positive organ suspension 22.87 30.51 26.7 18.1 27.9 34 negative blood plasma n/d n/d n/d n/d 24.6 35 negative blood plasma n/d n/d n/d n/d 19.2 36 negative blood plasma n/d n/d n/d n/d 19.4 37 negative blood plasma n/d n/d n/d n/d 24.3 38 negative blood plasma n/d n/d n/d n/d 19.6 39 negative blood plasma n/d n/d n/d n/d 20.4 40 negative blood plasma n/d n/d n/d n/d 20.5 41 negative blood plasma n/d n/d n/d n/d 19.4 42 negative blood plasma n/d n/d n/d n/d 21.6 43 negative blood plasma n/d n/d n/d n/d 20.4 44 negative blood plasma n/d n/d n/d n/d 23.3 45 negative blood plasma n/d n/d n/d n/d 25.1 46 negative blood plasma n/d n/d n/d n/d 20.5 47 negative blood plasma n/d n/d n/d n/d 23.6 48 negative blood plasma n/d n/d n/d n/d 26.6 49 negative blood plasma n/d n/d n/d n/d 19.5 50 negative blood plasma n/d n/d n/d n/d 26.6 51 negative blood plasma n/d n/d n/d n/d 26.6 52 negative blood plasma n/d n/d n/d n/d 25.7 53 negative blood plasma n/d n/d n/d n/d 19.6 54 negative organ suspension n/d n/d n/d n/d 22.2 55 negative organ suspension n/d n/d n/d n/d 24.3 56 negative organ suspension n/d n/d n/d n/d 14.3 57 negative organ suspension n/d n/d n/d n/d 21.4 58 negative organ suspension n/d n/d n/d n/d 19.8 59 negative organ suspension n/d n/d n/d n/d 25.0 60 negative organ suspension n/d n/d n/d n/d 22.4 61 negative organ suspension n/d n/d n/d n/d 21.9 62 negative organ suspension n/d n/d n/d n/d 24.2 63 negative organ suspension n/d n/d n/d n/d 25.8

The diagnostic characteristics of LAMP were calculated using the MEDCALC Internet resource [25] by entering the values of true (TP) and false (FP) positive and true (TN) and false (FN) negative results.

It was shown that the diagnostic sensitivity of the real-time LAMP method with fluorescent probes is practically not inferior in sensitivity to PCR and is 97.0%. At the same time, diagnostic specificity of up to 100% is observed, all samples that do not contain ASF virus DNA are identified correctly (Table 6).

Table 6 - Diagnostic characteristics of LAMP Characteristic Meaning Confidence interval, p=95% Specificity 100 88.43% - 100.00% Sensitivity 97.0 84.24% - 99.92% 32 (out of 33) positive and 30 (out of 30) negative are identified correctly

Literature:

1. Chapman DAG, Darby AC, Da Silva M, Upton C, Radford AD, Dixon LK. Genomic analysis of highly virulent isolate of African swine fever virus. Emerge Infect Dis. 2011 Apr.

2. Blome S, Gabriel C, Beer M. Pathogenesis of African swine fever in domestic pigs and European wild boar. VirusRes. 2013 Apr; 173(1):122-30. doi: 10.1016/j.virusres.2012.10.026. Epub 2012 Nov 6. PMID: 23137735.

3. Dixon LK, Stahl K, Jori F, Vial L, Pfeiffer DU. African Swine Fever Epidemiology and Control. Annu Rev Anim Biosci. 2020 Feb 15;8:221-246. doi: 10.1146/annurev-animal-021419-083741. Epub 2020 Nov 19. PMID: 31743062.

4. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2022, World Organization for Animal Health, 2022.

5. Beltrán Alcrudo, D., Arias, M., Gaillardo, C., Cramer, S. and Penrith, M.L. African swine fever: detection and diagnosis - A guide for veterinarians, FAO, 2017. Animal production and health guide animals No. 19. Rome. Food and Agriculture Organization of the United Nations (FAO). 104 pages

6. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000 Jun 15;28(12): E63. doi: 10.1093/nar/28.12.e63. PMID: 10871386; PMCID: PMC102748.

7. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002 Jun;16(3):223-9. doi: 10.1006/mcpr.2002.0415. PMID: 12144774.

8. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun. 2001 Nov 23;289(1):150-4. doi: 10.1006/bbrc.2001.5921. PMID: 11708792.

9. Tanner NA, Zhang Y, Evans TC Jr. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. biotechniques. 2015 Feb 1;58(2):59-68. doi: 10.2144/000114253. PMID: 25652028.

10. Wang D, Yu J, Wang Y, Zhang M, Li P, Liu M, Liu Y. Development of a real-time loop-mediated isothermal amplification (LAMP) assay and visual LAMP assay for detection of African swine fever virus ( ASFV). J Virol Methods. Feb 2020;276:113775. doi: 10.1016/j.jviromet.2019.113775. Epub 2019 Nov 11. PMID: 31726114.

11. Wang Y, Dai J, Liu Y, Yang J, Hou Q, Ou Y, Ding Y, Ma B, Chen H, Li M, Sun Y, Zheng H, Zhang K, Wubshet AK, Zaberezhny AD, Aliper TI, Tarasiuk K, Pejsak Z, Liu Z, Zhang Y, Zhang J. Development of a Potential Penside Colorimetric LAMP Assay Using Neutral Red for Detection of African Swine Fever Virus. Front Microbiol. 2021 Apr 23;12:609821. doi: 10.3389/fmicb.2021.609821. PMID: 33967972; PMCID: PMC8102904.

12. - Miao, F.; Zhang, J.; Li, N.; Chen, T.; Wang, L.; Zhang, F.; Mi, L.; Zhang, J.; Wang, S.; Wang, Y.; et al. Rapid and Sensitive Recombinase Polymerase Amplification Combined with Lateral Flow Strip for Detecting African Swine Fever Virus. front. microbiol. 2019, 10, 1004.

13.- Yu LS, Chou SY, Wu HY, Chen YC, Chen YH. Rapid and semi-quantitative colorimetric loop-mediated isothermal amplification detection of ASFV via HSV color model transformation. J Microbiol Immunol Infect. 2021 Oct;54(5):963-970. doi: 10.1016/j.jmii.2020.08.003. Epub 2020 Aug 16. PMID: 32868194.

14. Kubota R, Vine BG, Alvarez AM, Jenkins DM. Detection of Ralstonia solanacearum by loop-mediated isothermal amplification. Phytopathology. 2008 Sep;98(9):1045-51. doi: 10.1094/PHYTO-98-9-1045. PMID: 18943743.

15. Tyagi S Kramer F. 1996. Molecular Beacons: Probes That Fluoresce Upon Hybridization. nature biotechnology. 14.303-8.10.1038/nbt0396-303).

6. Heid CA, Stevens J, Livak KJ, and Williams PM (1996) Real time quantitative PCR. Genome Res 6(10): 986-994.

17. - Zsak, L., Borca, M. V., Risatti, G. R., Zsak, A., French, R. A., Lu, Z., …Rock, D. L. (2005). Preclinical diagnosis of African swine fever in contact-exposed swine by a real-time PCR assay. Journal of Clinical Microbiology, 43, 112-119. https://doi.org/10.1128/JCM.43.1.112-119.2005.

18. Wang Y, Xu L, Noll L, Stoy C, Porter E, Fu J, Feng Y, Peddireddi L, Liu X, Dodd KA, Jia W, Bai J. Development of a real-time PCR assay for detection of African swine fever virus with an endogenous internal control. Transboundary Emerge Dis. 2020 Nov;67(6):2446-2454. doi: 10.1111/tbed.13582. Epub 2020 May 2. PMID: 32306531.

19. Tignon M, Gallardo C, Iscaro C, Hutet E, Van der Stede Y, Kolbasov D, De Mia GM, Le Potier MF, Bishop RP, Arias M, Koenen F. Development and inter-laboratory validation study of an improved new real-time PCR assay with internal control for detection and laboratory diagnosis of African swine fever virus. J Virol Methods. 2011 Dec;178(1-2):161-70. doi: 10.1016/j.jviromet.2011.09.007. Epub 2011 Sep 17. PMID: 21946285.

-Pinero J, Gallardo C, Elizalde M, Robles A,

C, Bishop R, Heath L, Couacy-Hymann E, Fasina FO, Pelayo V, Soler A, Arias M. Molecular diagnosis of African Swine Fever by a new real-time PCR using universal probe library. Transbound Emerg Dis. 2013 Feb;60(1):48-58. doi: 10.1111/j.1865-1682.2012.01317.x. Epub 2012 Mar 7. PMID: 22394449.20.

-Pinero J, Gallardo C, Elizalde M, Robles A,

C, Bishop R, Heath L, Couacy-Hymann E, Fasina FO, Pelayo V, Soler A, Arias M. Molecular diagnosis of African Swine Fever by a new real-time PCR using universal probe library. Transboundary Emerge Dis. 2013 Feb;60(1):48-58. doi: 10.1111/j.1865-1682.2012.01317.x. Epub 2012 Mar 7. PMID: 22394449.

21. Zhao, D. , Liu, R. , Zhang, X. , Li, F. , Wang, J. , Zhang, J. , Liu, X. , Wang, L. , Zhang, J. , Wu, X . , Guan, Y. , Chen, W. , Wang, X. , He, X. , & Bu, Z. (2019). Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerging Microbes & Infections, 8(1), 438-447.

22. National Center for Biotechnology Information (NCBI) [Electronic resource] URL: https://www.ncbi.nlm.nih.gov.

23. Oligo Calc: Oligonucleotide Properties Calculator [Electronic resource] URL: http:// biotools.nubic.northwestern.edu/ OligoCalc. HTML

24. Development of multiplexed reverse-transcription loop-mediated isothermal amplification for detection of SARS-CoV-2 and influenza viral RNA Yinhua Zhang and Nathan A Tanner, BioTechniques 2021 70:3, 167-174.

25. MedCalc's Diagnostic test evaluation calculator https://www.medcalc.org/calc/diagnostic-test.php

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="SYNTHETIC

OLIGONUCLEOTIDE.xml" softwareName="WIPO Sequence"

softwareVersion="2.1.2" productionDate="2022-09-30">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText></ApplicationNumberText>

<FilingDate></FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>01-09-22</ApplicantFileReference>

<ApplicantName languageCode="en">Federal State

budgetary educational institution of higher education "Moscow

State Academy of Veterinary Medicine and Biotechnology - MBA

named after K.I. Scriabin" (FGBOU VO MGAVMiB - MVA named after K.I.

Scriabin)</ApplicantName>

<ApplicantNameLatin>Federalnoe gosudarstvennoe biudzhetnoe

obrazovatelnoe uchrezhdenie vysshego obrazovaniia &quot;Moskovskaia

gosudarstvennaia akademiia veterinarnoi meditsiny i biotechnologii

MVA imeni K.I. Skriabina, FGBOU VO MGAVMiB - MVA imeni K.I.

Skriabina</ApplicantNameLatin>

<InventionTitle languageCode="en">SYNTHETIC OLIGONUCLEOTIDE

PRIMERS AND METHOD FOR HIGHLY SENSITIVE DETECTION OF VIRUS DNA

OF AFRICAN SWINE FEVER BY THE LOOP ISOTHERMAL AMPLIFICATION METHOD

IN THE PRESENCE OF INTERNAL CONTROL DNA</InventionTitle>

<SequenceTotalQuantity>16</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>19</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q1">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>attacgtcttatgtccaga</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>agactggatataagcacttg</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>22</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..22</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q3">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tcacaatatccaaacagcaggt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>22</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..22</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>taagaataggtttgctytggtg</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>47</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..47</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q5">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>accaacccgaaattcctttcactttttgcgtccgtaatagrgtrata</

INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>45</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..45</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gttcgctcgtatcattttcatttttaggtatcggtggagggaacy</IN

SDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>18</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q7">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aaacgcaacgaggctcta</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="8">

<INSDSeq>

<INSDSeq_length>19</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggatttgttcagaacgctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="9">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q9">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>acagcttccgctgtcttctca</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="10">

<INSDSeq>

<INSDSeq_length>19</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q10">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gttgacgacgacatggctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="11">

<INSDSeq>

<INSDSeq_length>41</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..41</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q11">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cctgctgatctgcgacttatttcgagagtgcgttgcttaac</INSDSe

q_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="12">

<INSDSeq>

<INSDSeq_length>44</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..44</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q12">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggattccaaagttctcaatgcttttgagaatcgcagcaacttgt</INS

DSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="13">

<INSDSeq>

<INSDSeq_length>47</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..47</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q13">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>accaacccgaaattcctttcactttttgcgtccgtaatagrgtrata</

INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="14">

<INSDSeq>

<INSDSeq_length>22</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..22</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q14">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gtgaaaggaatttcgggttggt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="15">

<INSDSeq>

<INSDSeq_length>41</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..41</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q15">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cctgctgatctgcgacttatttcgagagtgcgttgcttaac</INSDSe

q_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="16">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q16">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>African swine fever

virus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ataagtcgcagatcagcagg</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (21)

1. A set of synthetic oligonucleotide primers for the detection of African swine fever virus DNA by real-time loop isothermal amplification, containing oligonucleotide primers ASF-F3, ASF-B3, ASF-F, ASF-BL, ASF-FIP, ASF-BIP, flanking a specific fragment of the ASF virus genome, oligonucleotide primers IC-F3, IC-B3, IC-F, IC-BL, IC-FIP, IC-BIP flanking a specific fragment of the bacteriophage lambda, as well as probes ASF-FIP-BHQ1 / ASF-R6G , IC-FIP-BHQ1 / IC-FAM based on internal FIP primers having the following nucleotide composition: ASF-F3 ATTACGTCTTATGTCCAGA, ASF-B3 AGACTGGATATAAGCACTTG, ASF-F TCACAATATCCAAACAGCAGGT, ASF-BL TAAGAATAGGTTTGCTYTGGTG, ASF-FIP ACCAACCCGAAATTCCTTTCACTTTTTGCGTCCGTAATAGRGTRATA, ASF-BIP GTTCGCTCGTATCATTTTCATTTTTAGGTATCGGTGGAGGGAACY, IC-F3 AAACGCAACGAGGCTCTA, IC-B3 GGATTTGTTCAGAACGCTC, IC-FL ACAGCTTCCGCTGTCTTCTCA, IC-BL GTTGACGACGACATGGCTC, IC-FIP CCTGCTGATCTGCGACTTATTTCGAGAGTGCGTTGCTTAAC, IC-BIP GGATTCCAAAGTTCTCAATGCTTTTGAGAATCGCAGCAACTTGT ASF-FIP-BHQ1 / ASF-R6G BHQ1-ACCAACCCGAAATTCCTTTCACTTTTTGCGTCCGTAATAGRGTRATA, GTGAAAGGAATTTCGGGTTGGT-R6G, IC-FIP-BHQ1 / IC-FAM BHQ1-CCTGCTGATCTGCGACTTATTTCGAGAGTGCGTTGCTTAAC, ATAAGTCGCAGATCAGCAGG-FAM. 2. A method for highly sensitive rapid detection of African swine fever virus DNA by loop isothermal amplification in the presence of internal control sample DNA, including amplification of ASF virus DNA isolated from biological material from animals in the "real time" isothermal method using a set of oligonucleotide primers according to item 1, as part of a 2.5 x LAMP reaction mixture containing primers in the following concentrations ASF-FIP, IC-FIP - 1.0 μM each, ASF-BIP, IC-BIP - 2.5 μM each, ASF-F3, ASF-B3 , IC-F3, IC-B3 - 0.5 μM each, ASF-FL, IC-FL, ASF-BL, IC-BL - 1.0 μM, primer probes ASF-FIP-BHQ1, IC-FIP-BHQ1 1.5 μM each, ASF-R6G , IC-FAM - 2.0 μM, 1.4 mM of each dNTP after DNA pre-extraction from test samples in the presence of bacteriophage lambda added to each sample to a concentration in the sample of 10^5–10^6 copies/ml, using for carrying out LAMP positive and negative control samples of the stages of DNA extraction and amplification, the volume of the prepared mixture for one sample is 15 µl, of which 10 µl is a 2.5 x LAMP reaction mixture; 5 µl 5x LAMP buffer; 1 µl of Bst DNA polymerase with an activity of 8 units/µl, the components of the reaction mixture are mixed and added to the tubes prepared for amplification, 15 µl each, then 10 µl of DNA samples are added to the tubes, including control reactions, the amplifier with a fluorescent detection system is programmed to perform the next program - 65 °C, 30 s, detection after each cycle on the FAM/Green, HEX/Yellow channels, 60 cycles are set, after the amplification is completed, the data obtained are analyzed, the fluorescent signal accumulation curves are analyzed, the results are interpreted based on the presence or absence of an intersection fluorescence curve with a threshold line set at the appropriate level, corresponding to 10-20% of the maximum fluorescence level obtained for the K+ sample in the last amplification cycle, the interpretation of the results is as follows - ASF virus DNA is detected if the Ct value is determined on the channel for the HEX/Yellow fluorophore , ASF virus DNA was not detected, if there is no Ct value on the channel for the HEX/Yellow fluorophore, while the Ct value on the channel for the FAM/Green fluorophore is less than the limit value, Сt ≤45, if there is no Ct value on the channel for the HEX/Yellow fluorophore , at the same time, if the Ct value for the channel for the FAM/Green fluorophore is not determined, the sample is re-examined, the results are to be taken into account only if correct results are obtained for the controls of the stages of extraction and DNA amplification. 3. The method according to p. 2, characterized in that it may include amplifying the DNA of the ASF virus using primers according to p. 1 in other ratios and concentrations.

Images