RU2806908C1 - Method for detecting african swine fever virus dna using specific oligonucleotides by isothermal loop amplification and colorimetric detection of amplification results - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: method for detecting African swine fever virus DNA is described. The method includes carrying out isothermal loop amplification by heating in a thermostat for 50-70 minutes and recording the analysis result by changing the color of the reaction mixture. It differs in that the ASF-F3 oligonucleotide sequences are used as primers in the isothermal loop amplification reaction: SEQ NO1, ASF-B3: SEQ NO2, ASF-FIP: SEQ NO3, ASF-BIP: SEQ NO4.

EFFECT: expanding the scope of means for detecting African swine fever virus DNA.

2 cl, 2 dwg, 2 ex

Description

The invention relates to biotechnology, veterinary virology and molecular biology and represents a method for detecting DNA of the African swine fever virus genotype II. The invention can be used in veterinary medicine.

African swine fever virus (ASFV) causes a severe, highly contagious and fatal disease in both domestic and wild pigs. The ASF virus causes huge economic losses, so a quick and affordable test for determining ASF directly on the farm or at the nearest veterinary point is significant for combating the epizootic.

The proposed detection method is carried out using specific oligonucleotides (primers) by isothermal loop amplification (LAMP) and colorimetric detection of amplification results using pH-sensitive dyes. In Fig. Figure 1 shows an example of a change in the color of the reaction mixture when a) ASF virus DNA is detected in the sample, b) there is no ASF virus DNA in the sample.

State of the art

Currently in Russia, the ASF virus is determined by real-time PCR. Based on this method, several systems have been developed for detecting the ASF virus: RU2645263C1, RU2360971C1, RU2606253C1 [1-3]. The LAMP-based detection method we created is more accessible compared to real-time PCR. To carry out detection by the LAMP method, a thermostat of 60°C is required, in contrast to the above patents, which require complex instruments for detection in real-time PCR mode, which is an advantage of our method and allows it to be used at any veterinary station or on a farm and carry out rapid diagnosis if infection is suspected.

Loop-mediated isothermal amplification (LAMP) is a method of isothermal DNA amplification that uses a polymerase with displacement activity and at least 2 pairs of primers: internal and external. Each of the internal primers has a sequence complementary to one chain of the amplification region at the 3' end and identical to the internal section of the same chain at the 5' end, as a result of which loop structures are formed during the reaction, the number of which increases with each cycle of the reaction [4] . Because four specific primers are used that recognize six different target DNA sequences, LAMP amplifies DNA with high specificity.

A comparison of analytical sensitivity between conventional PCR, Nested polymerase chain reaction, real-time PCR and LAMP showed that LAMP is superior to other methods in such parameters as detection limit and amplification time [5]. In addition, LAMP is less sensitive to the presence of various biological impurities in the reaction mixture than PCR [6], which simplifies sample preparation.

The key point in developing an effective method for detecting pathogens is the selection of specific oligonucleotides that ensure the reaction. The ASF virus genome is characterized by significant variability. The oligonucleotides disclosed in the present invention are specific for the most common strains of the ASF virus in the Russian Federation.

The closest analogue of the proposed technical solution is invention No. RU2710065C1 [7], which discloses oligonucleotide primers for detecting African swine fever virus DNA, selected to detect the p22 virus gene, as well as a method for detecting African swine fever virus DNA using LAMP loop isothermal amplification. To record the results, the intercalating fluorescent dye Sybr Green or turbidimetry is used.

The proposed technical solution differs in the target gene for virus detection and the composition of nucleotide primers: primers specific to the conserved region of the p72 capsid protein gene were developed.

A distinctive feature of the claimed method is the possibility of visual detection by changes in the color of the reaction mixture, based on the use of a pH indicator supplemented with a dye that creates a more contrasting color transition. Dyes are added before the reaction, reducing the chance of contamination by amlikons when opening the tube. Unlike fluorochromes, which can also be used for detection, these indicators are not subject to photobleaching.

In the claimed technical solution, the concentrations of the components of the buffer solution were optimized to ensure the activity of Bst polymerase and at the same time make it possible to record changes in pH. To detect changes in pH, the mixture contains an indicator and a dye, which provide a contrasting visual transition in case of a positive reaction. The essential features that distinguish the proposed technical solution from analogues are:

- nucleotide sequences of primers

- optimized composition of the amplification mixture

- visual detection of the reaction result using a pH indicator and dye

EXAMPLE 1

The reaction mixture was prepared by cooling on ice. The composition of the reaction mixture was as follows:

1.5 mmol/l Tris-HCl, pH=8.8

10 mmol/l (NH4)2SO4

10 mmol/l KCl

6 mmol/l MgSO4

0.4 mmol/l ATP,

0.4 mmol/l CTP,

0.4 mmol/l GTP,

0.4 mmol/l TTP,

0.1% Triton X-100

0.2 µmol/l oligonucleotide ASF-F3

0.2 µmol/L oligonucleotide ASF-B3

1.6 µmol/L oligonucleotide ASF-FIP

1.6 µmol/L oligonucleotide ASF-BIP

50 µmol/l methylene blue

50 µmol/l phenol red

1 µl Bst polymerase (16 u.a.)

deionized water, free from nucleases - up to 24 µl

1 µl of the analyzed sample containing ASF virus DNA was added to 24 µl of the reaction mixture. As a negative control, 1 μL of deionized water was used instead of the test sample solution. The reaction was carried out by heating in a thermostat at 60°C for 50 minutes. As a result of the reaction, in the positive sample the color of the reaction mixture changed from purple to green; in the negative control, the color of the reaction mixture did not change (Fig. 1).

EXAMPLE 2

The reaction mixture in a volume of 25 μl was prepared while cooling on ice. The composition of the reaction mixture was as follows:

3 mmol/l Tris-HCl, pH=8.8

10 mmol/l (NH4)2SO4

10 mmol/l KCl

6 mmol/l MgSO4

0.4 mmol/l ATP,

0.4 mmol/l CTP,

0.4 mmol/l GTP,

0.4 mmol/l TTP,

0.1% Triton X-100

0.2 µmol/l oligonucleotide ASF-F3

0.2 µmol/L oligonucleotide ASF-B3

1.6 µmol/L oligonucleotide ASF-FIP

1.6 µmol/L oligonucleotide ASF-BIP

50 µmol/l methylene blue

50 µmol/l phenol red

1 µl Bst polymerase (16 u.a.)

deionized water, free from nucleases - up to 24 µl

1 µl of the analyzed sample containing ASF virus DNA was added to 24 µl of the reaction mixture. As a negative control, 1 μL of deionized water was used instead of the test sample solution. The reaction was carried out by heating in a thermostat at 60°C for 50 minutes. As a result of the reaction in the sample with control DNA and in the negative control, the color of the reaction mixture did not change (Fig. 2). EXAMPLE 2 differed from EXAMPLE 1 in the buffer capacity of the solution, by changing which it was possible to achieve the optimal composition of the reaction mixture, ensuring the passage of the reaction and the possibility of recording the results.

Information sources

1. Potapova A. Yu., Serdyuk I. Yu., Dzhailidi G. A., Chernykh O. Yu., Krivonos R. A., Koshchaev A. G., Lysenko A. A., Shevchenko A. A.; Federal State Budgetary Educational Institution of Higher Education "Kuban State Agrarian University named after I.T. Trubilin", LLC "Innovative Diagnostic Systems". Test system for detecting African swine fever virus DNA using polymerase chain reaction in real time 2017. RF Patent No. RU 2645263 C1 Date of application: 04/05/2017

2. Kalabekov I.M., Zhigaleva O.N., Vlasova N.N., Tsybanov S.Zh., Kolbasov D.V.; State Scientific Research Institute of Veterinary Virology and Microbiology. Method and test system for detecting African swine fever virus DNA using specific oligonucleotide primers in a polymerase chain reaction. RF patent No. RU2360971C1. Application date 11/23/2007

3. Kudryashov, D. A., Burmakina, G. S., Titov, I. A., Tsybanov, S. Zh., Malogolovkin, A. S.; All-Russian Research Institute of Veterinary Virology and Microbiology of the Russian Agricultural Academy. Oligonucleotide primers and a fluorescent probe with an internal quencher, complementary to the P30 gene region (CP204L) of the African swine fever virus, for use in real-time polymerase chain reaction. RF patent No. RU 2606253 C1. Application date 02/15/2016

4. Notomi T., Mori Y., Tomita N., Kanda H. Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects // J. Microbiol. 2015. Vol. 53, No. 1. P. 1-5.

5. Foo P.C., Nurul Najian A.B., Muhamad N.A., Ahamad M., Mohamed M., Yean Yean C., Lim B.H. Loop-mediated isothermal amplification (LAMP) reaction as a viable PCR substitute for diagnostic applications: a comparative analysis study of LAMP, conventional PCR, nested PCR (nPCR) and real-time PCR (qPCR) based on Entamoeba histolytica DNA derived from // BMC Biotechnol. 2020. Vol. 20, No. 1. P. 34.

6. Kaneko H., Kawana T., Fukushima E., Suzutani T. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances // J. Biochem. Biophys. Methods. 2007. Vol. 70, No. 3. P. 499-501

7. Elsukova A. A., Vlasova N. N., Igolkin A. S.; FSBI "ARRIAH." Synthetic oligonucleotide primers and a method for detecting ASF virus DNA using loop isothermal amplification. RF Patent No. RU2710065C1. Application date 12/14/2018

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="Detection method

DNA of the African swine fever virus using specific

oligonucleotides by isothermal loop amplification and

colorimetric detection of amplification results.xml"

softwareName="WIPO Sequence" softwareVersion="2.2.0"

productionDate="2023-01-10">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>2022134169</ApplicationNumberText>

<FilingDate>2022-12-23</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>https://www.fips.ru/registers-doc-view/fips_s

ervlet?DB=RUPATAP&amp;DocNumber=2022134169&amp;TypeFile=html</Applican

tFileReference>

<ApplicantName languageCode="ru">Federal state

institution "Federal Research Center" Fundamental

Fundamentals of Biotechnology" of the Russian Academy of Sciences</ApplicantName>

<ApplicantNameLatin>Federal Research Center &quot;Fundamentals of

Biotechnology&quot; of the Russian Academy of

Sciences</ApplicantNameLatin>

<InventorName languageCode="ru">Goncharenko Anna

Vladimirovna</InventorName>

<InventorNameLatin>Goncharenko Anna Vladimirovna</InventorNameLatin>

<InventionTitle languageCode="en">Method for detecting viral DNA

African swine fever using specific oligonucleotides

by isothermal loop amplification and colorimetric

detection of amplification results</InventionTitle>

<SequenceTotalQuantity>4</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q13">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tgcagaactttgatggaaat</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>18</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q14">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>attatgcagcccactcac</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>50</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..50</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q15">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ccgttacgtatccgatcacattaccttatcgataagattgataccatga

g</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>45</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..45</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q16">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tcagatatagatgaacatgcgtctgcacgcagagataagctttca</IN

SDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (2)

1. A method for detecting DNA of the African swine fever virus, including carrying out isothermal loop amplification by heating in a thermostat for 50-70 minutes and recording the result of the analysis by changing the color of the reaction mixture, characterized in that oligonucleotide sequences are used as primers in the isothermal loop amplification reaction ASF-F3: SEQ NO1, ASF-B3: SEQ NO2, ASF-FIP: SEQ NO3, ASF-BIP: SEQ NO4. 2. A method for detecting African swine fever virus DNA according to claim 1, characterized in that the reaction is carried out in a low-capacity buffer in the presence of a combination of a pH indicator phenol red and a methylene blue dye and the reaction results are recorded by visual colorimetric assessment: in negative control and in samples where there is no ASF virus DNA, there will be a dark purple color, in the positive control and in samples where ASF virus DNA is present, the reaction mixture becomes green.