CN113444773B - Method and kit for detecting tick pathogen nucleic acid based on liquid chip - Google Patents
Method and kit for detecting tick pathogen nucleic acid based on liquid chip Download PDFInfo
- Publication number
- CN113444773B CN113444773B CN202110943575.7A CN202110943575A CN113444773B CN 113444773 B CN113444773 B CN 113444773B CN 202110943575 A CN202110943575 A CN 202110943575A CN 113444773 B CN113444773 B CN 113444773B
- Authority
- CN
- China
- Prior art keywords
- tick
- kit
- nucleic acid
- detecting
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a kit for detecting tick pathogen nucleic acid based on a liquid chip, which belongs to the technical field of tick detection, wherein the method for detecting tick pathogen based on the liquid chip comprises the following steps: s1: the PCR primer, the Tag probe sequence and the double-combination probe sequence are designed, wherein the PCR primer is used for amplifying 6 target gene fragments and 1 reference gene, and the Tag probe is a probe which is designed aiming at 6 target genes and reference genes and is subjected to Aminoliker C12 modification at the 5' end and is used for marking fluorescent microspheres. The method and the kit for detecting the tick pathogen nucleic acid based on the liquid chip adopt the liquid chip technology to carry out high-flux multiplex detection on six common tick-borne pathogens, have the advantages of high detection speed, high sensitivity, complete pathogen coverage and the like, and can be used as a favorable diagnostic tool for detecting and evaluating human and animal infection.
Description
Technical Field
The invention relates to the technical field of tick detection, in particular to a method and a kit for detecting tick pathogen nucleic acid based on a liquid chip.
Background
Ticks are the second most infectious disease vector organism next to mosquitoes, can transmit various zoonosis, and are extremely harmful. Tick-borne pathogens include bacteria, viruses, rickettsia, spirochetes, parasites and the like, and the types of the pathogens are various, but the detection means of the tick-borne pathogens are very limited at present, and related commercial detection kits are lacking. The existing non-diagnostic detection methods have the defects of low sensitivity, complex operation, certain subjectivity in result judgment and the like, almost adopt detection aiming at single pathogen, have insufficient coverage and are easy to cause missed detection.
MASA liquid phase chip (Multi-Analyte Suspension Array, multifunctional suspended dot matrix) technology is a high-throughput detection technology developed in the late 90 s of the 20 th century. The technology can realize high-capacity coding of the microspheres through a unique microsphere fluorescence coding technology, each microsphere has different characteristic fluorescence spectra, and then each coding microsphere is covalently crosslinked with capture molecules such as antigens/antibodies or nucleic acid probes aiming at specific detection objects. In the reaction, each coded microsphere is mixed with a sample of an object to be detected, target molecules in the reaction suspension are specifically combined with capture molecules crosslinked on the surfaces of the microspheres, and detection reactions of up to 50 different detection targets can be completed in one reaction hole at the same time. Finally, respectively identifying microsphere codes and fluorescence intensity of reporter molecules on the microspheres by two laser beams on a matched instrument, thereby realizing qualitative or quantitative analysis of detection indexes. The technical advantages of multi-index joint inspection, strong compatibility, high accuracy, less required samples and the like are very suitable for pathogen detection application.
Disclosure of Invention
This section is intended to outline some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section as well as in the description summary and in the title of the application, to avoid obscuring the purpose of this section, the description summary and the title of the invention, which should not be used to limit the scope of the invention.
In order to solve the technical problems, according to one aspect of the present invention, the following technical solutions are provided:
a method for detecting tick-borne pathogens based on a liquid-phase chip, comprising:
s1: designing a PCR primer, a Tag probe sequence and a double-combined probe sequence, wherein the PCR primer is used for amplifying 6 target gene fragments and 1 reference gene, the Tag probe is a probe which is designed aiming at 6 target genes and reference genes and is subjected to Aminolker C12 modification at the 5' end and is used for marking fluorescent microspheres, and the double-combined probe sequence is used for carrying out specific hybridization with an amplification product of amplifying the target gene fragments by adopting the PCR primer and the Tag fluorescent microspheres;
biotin modification is performed at the 5' end of a PCR primer of a strand complementary to the probe, the PCR primer comprising 7 pairs of primers, the 7 pairs of primer sequences being as follows:
anaplasma upstream primer: AGTCCGGRAGAGGATAGCG;
anaplasma downstream primer: biotin-TTCGCACCTCAGYGTCAG;
borrelia upstream primer: TAATGCTTRTTGGAGAAAATGAC;
borrelia downstream primer: biotin-GCAACYTCAGCCATACCT;
basia upstream primer: CAAGAACGAAAGTTAGGGGMT;
basia downstream primer: biotin-TGATTTCTCTCAAGSTSCTG;
borreliella upstream primer: CTTGTAGATGAGTCTGCGTCTTATTA;
primers downstream of Borreliella: biotin-CTCAGTTCCAGTGTGACCGWTC;
rickettsia upstream primer: ttgtgacggraggtaaacttgt;
rickettsia downstream primer: biotin-ATTATCGGCAGGAGCATCAA;
TBEV upstream primer: GGGCGGTTCTTGTTCTCC;
TBEV downstream primer: biotin-ACACATCACCTCCTTGTCAGACT;
beta-globin upstream primer: GGCTGCCTATCAGAAAGTGGTG;
beta-globin downstream primer: biotin-AGGCAGAATCCAGATGCTCAAG;
the Tag probe sequence is as follows (5, -3):
Anaplasma-T：NH2C12-TGATTGTAGTATGTATTGATAAAG；
Borrelia-T：NH2C12-GATTGTAAGATTTGATAAAGTGTA；
Babesia-T：NH2C12-GATTTGAAGATTATTGGTAATGTA；
Borreliella-T：NH2C12-GATTGATTATTGTGATTTGAATTG；
Rickettsia-T：NH2C12-GATTTGATTGTAAAAGATTGTTGA；
TBEV-T：NH2C12-ATTGGTAAATTGGTAAATGAATTG；
β-globin-T：NH2C12-GTAAGTAATGAATGTAAAAGGATT；
the double binding probe sequence is as follows (5, -3):
Anaplasma-P：CTTTATCAATACATACTACAATCA AGGAGGAACACCAGTGGCGAAG；
Borrelia-P：TACACTTTATCAAATCTTACAATC TGGGAAGAAGCACCAACAGATTATG；
Babesia-P：TACATTACCAATAATCTTCAAATC TAGKGATTGGAGGTCGTCRKT；
Borreliella-P：CAATTCAAATCACAATAATCAAT CCCTACCAAGRCRATGATAAGTAACCG；
Rickettsia-P：TCAACAATCTTTTACAATCAAATC AACTTGTTGCCTGTTACTATTACTGY；
TBEV-P：CAATTCATTTACCAATTTACCAATCCCTGAGCCACCATCACCCAGACACAGAT；
β-globin-P：AATCCTTTTACATTCATTACTTAC GCCCACAAGTATCACTAAGCTCGC；
s2: preparation of liquid phase chip: the fluorescent coding microsphere with the Tag probe in the step S1 and the double-binding probe in the step S1 are coupled to obtain a liquid phase chip;
s3: amplifying the target gene by adopting the PCR primer in the step S1 to obtain an amplified product, hybridizing with the fluorescent reporter molecule and the liquid phase chip obtained in the step S2 to obtain a hybridized product, and reading out a detection result by a liquid phase chip detector.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the step S3 specifically comprises the following steps:
(1) Dispersing the mixed Tag fluorescent microspheres in a detection buffer;
(2) Taking the PCR amplification product obtained in the step S1, uniformly mixing the PCR amplification product in the system, sealing a container opening for accommodating a reaction system, placing the container opening at 95 ℃ for incubation for 2min, transferring the container opening to a 55 ℃ environment, and continuously incubating for 10min;
(3) After incubation, 5. Mu.L of SA-PE is added to seal the mouth of the container again, and after incubation for 5min at 55 ℃, the container is placed in a NovaHT loading plate for machine detection.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the step S3 is carried out under the light-shielding condition.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the assay buffer comprises 31 parts by volume of tetramethylammonium chloride buffer, 10 parts of TE solution, and 4 parts of 10% w/vPEG8000 aqueous solution.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the preparation component proportion and the preparation method of the tetramethylammonium chloride buffer solution are as follows:
225 parts by volume of a 5mol/L aqueous solution of tetramethylammonium chloride, 1.88 parts by volume of a 20% (w/v) double distilled aqueous solution of sarcosyl, 18.75 parts by volume of a pH8.0, 1mol/L Tris-HCl solution, 3.0 parts by volume of a 0.5mol/L EDTA solution and 1.37 parts by volume of double distilled water are mixed and dissolved in a water bath at 68 ℃ and stored at room temperature.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the TE solution comprises the following components in percentage by weight:
1 part by volume of Tris-HCl solution with pH of 8.0 and 1mol/L, 0.2 part by volume of EDTA solution with pH of 8.0 and 0.5mol/L and 100 parts by volume of double distilled water are mixed to obtain the aqueous solution.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: in the hybridization reaction system of the step S3, the molecular ratio of the Tag to the double-binding probe is 1:1.5.
As a preferred embodiment of the method for detecting tick-borne pathogens based on a liquid-phase chip according to the invention, the method comprises the steps of: the preparation method of the fluorescent coding microsphere with the Tag probe in the step S1 comprises the following steps:
uniformly mixing the fluorescent coded microspheres with a 2-N-morpholinoethanesulfonic acid solution with the pH value of 4.5 and the concentration of 0.1M to obtain a coupling system; and then adding a Tag probe and dichloroethane into the coupling system to react in a dark place to obtain the Tag fluorescent coding microsphere.
A method and a kit for detecting tick pathogen nucleic acid based on a liquid chip,
compared with the prior art:
1. the invention combines the multiple PCR technology and the flow dot matrix instrument (NovaHT) technology, and designs a primer group capable of detecting 6 tick-borne pathogens simultaneously. The primer group is used for carrying out multiplex PCR to obtain a target amplification product, then the amplification product, the fluorescent coding microsphere and the streptavidin-phycoerythrin are hybridized, and when the MFI value is read through a flow dot matrix instrument, different types of pathogens are distinguished. The method has the beneficial effects of high speed, high efficiency, strong specificity, high sensitivity, good repeatability and the like, and can be applied to epidemiological investigation and early warning of tick-borne pathogens.
2. The conventional detection methods of tick-borne diseases at present are single item detection, and can not detect multiple pathogens at one time, and compared with the conventional detection methods, the method provided by the invention realizes simultaneous detection of multiple different target molecules in the same sample, realizes high-throughput detection, and can flexibly increase detection items according to the increase of pathogens; meanwhile, the sample consumption is small, the operation is simple, the detection efficiency is high, and the detection cost can be greatly reduced.
3. The PCR product is captured by the specific microsphere probe, which is superior to the traditional multiple detection method in that the result judgment is carried out by using the length of the PCR product fragment, and the detection specificity is stronger.
4. The flow dot matrix instrument (NovaHT) utilizes a biotin-avidin system to amplify signals, and the affinity of the flow dot matrix instrument is up to 1015L/moL, which is 104 times higher than that of a pure antibody, so that the detection result is more sensitive, less interfered by environment and high in stability; the detection sensitivity of the method is 1-2 orders of magnitude higher than that of the common PCR.
5. The flow type dot matrix instrument utilizes the reaction of the microspheres in the solution, overcomes the influence of surface tension, space effect and the like on reaction dynamics when a film chip is detected by macromolecules, greatly improves the repeatability of sample detection, and has reliable and stable detection result: the repeatability of the detection can reach more than 90%, and the linear range is wide.
6. The invention has high flexibility and can detect the types of pathogens on the basis of adding and subtracting according to the needs.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following detailed description of the embodiments of the present invention will be given with reference to the accompanying drawings, which are to be understood as merely some embodiments of the present invention, and from which other drawings can be obtained by those skilled in the art without inventive faculty. Wherein:
FIG. 1 is a schematic diagram of hybridization detection of a liquid phase chip of the present invention;
FIG. 2 is a schematic representation of an Anaplasma primer sensitivity test of the invention;
FIG. 3 is a schematic diagram of a sensitivity test of the Babesia primer of the present invention;
FIG. 4 is a schematic representation of a Borrelia primer sensitivity test of the present invention;
FIG. 5 is a schematic representation of a Borrelliella primer sensitivity test of the present invention;
FIG. 6 is a schematic representation of a sensitivity test for Rickettsia primers of the present invention;
FIG. 7 is a schematic diagram of a TBEV primer sensitivity test of the present invention.
Detailed Description
In order that the above objects, features and advantages of the invention will be readily understood, a more particular description of the invention will be rendered by reference to the appended drawings.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways other than those described herein, and persons skilled in the art will readily appreciate that the present invention is not limited to the specific embodiments disclosed below.
In the following detailed description of the embodiments of the present invention, the cross-sectional view of the device structure is not partially enlarged to a general scale for the convenience of description, and the schematic is merely an example, which should not limit the scope of the present invention. In addition, the three-dimensional dimensions of length, width and depth should be included in actual fabrication.
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.
Example 1
1. Liquid phase chip preparation
Taking out 40u1 (1×105) NovaStar magnetic fluorescent microspheres with modified surface carboxyl groups developed by Wuhan New Endocarpium virus disease engineering Co., ltd., centrifuging at 12000rpm for 2min, discarding supernatant, adding 5u10.1M MES solution (2- (N-morpholino) ethanesulfonic acid) with pH of 4.5 into the precipitate, and mixing to obtain a coupling system. The Tag probe solution was diluted to 0.1mM and lul was added to the coupling system. Then 2.5u1 l of 0mg/ml EDC (dichloroethane) was added, and after mixing, the mixture was left in the dark for 30min. 2.5u1 l of 0mg/ml EDC was added again, mixed well and left in the dark for 30min. Washing once with 0.2m1 volume percent 0.02% Tween-20 and 0.1% SDS dodecyl sodium sulfate solution respectively, and finally re-suspending the microspheres in 10u11 xTE (pH 8.0, wherein the material composition is lM Tris-HCl,1mL;0.5mM EDTA,0.2mL, and 100mL of double distilled water) to obtain fluorescent microspheres coupled with Tag probes.
The fluorescent microspheres coupled with the Tag probes were mixed uniformly, the number of the microspheres was counted by a hemocytometer (the number of 4 large squares at four corners was counted and converted to the number of microspheres per microliter), and the microspheres were stored at 4℃in a dark place. Mixing the 6 fluorescent microspheres coupled with Tag probes, diluting the mixture by using 1.5 xTMAC buffer solution to ensure that the concentration of each microsphere is 100 per u1, and obtaining a liquid phase chip to be hybridized and detected.
The preparation method of the 1.5 xTMAC buffer, namely the aqueous solution of tetramethylammonium chloride, comprises the following steps of:
5mol/L TMAC (tetramethylammonium chloride), 225mL;
20% (w/v) sarkosyl (sodium dodecyl sarcosinate), 1.88mL;
1mol/L Tris-HCl，pH 8.0，18.75mL；
0.5mol/L EDTA，pH 8.0，3.0mL；
double distilled water, 1.37mL;
and (5) storing in a refrigerator at the temperature of 4 ℃ after sub-packaging.
Hybridization in TMAC facilitates the confirmation of true positive hybridization of the correct pairing of nucleotide sequences, allows hybridization temperatures to vary only with oligonucleotide length, and allows for efficient elimination of false positive results from GC-rich sequences.
Wherein 20% (w/v) Sarkosyl solution is prepared as Sarkosyl 20g, 100mL double distilled water, and can be completely dissolved in water bath at 68 ℃ without high pressure and stored at room temperature.
2. Sample detection
1. PCR amplification
Detecting 8 samples, and carrying out PCR amplification on each sample to be detected:
1) Ensuring that the PCR reaction establishment area and the pipettor are clean and pollution-free;
2) Taking out PCR amplification reagent stored at-20deg.C, and placing on a refrigeration pore plate or ice;
3) The PCR reaction system Master Mix was prepared according to the following table, suggesting 1 more reaction than required. For example: the sample detected by the experiment needs 9 reactions, and the consumption in the split charging process is considered, and the sample is calculated according to the quantity of 10 reactions;
TABLE 1 preparation of PCR reaction System Master Mix
4) Flick Master Mix, instantaneous centrifugation;
5) Taking 15 mu L of Master Mix in a refrigeration pore plate or a PCR reaction tube precooled on ice, and putting the PCR reaction tube on ice after the tube cover is tightly covered;
6) Transferring the PCR reaction tube added with the Master Mix in the step 5 to a template sample adding area together with a refrigerating pore plate or ice to ensure that the template sample adding area, a pipettor and the like are pollution-free;
7) Taking out a nucleic acid sample to be detected, flicking the mixed sample, and performing instantaneous centrifugation;
8) Adding 5 mu L of sample into a corresponding PCR reaction tube, uniformly mixing the sample, and performing instantaneous centrifugation to ensure that liquid is immersed into the bottom of the tube;
9) Placing the well mixed PCR reaction tube on a fluorescent quantitative PCR instrument, and running a PCR program;
TABLE 2PCR cycle conditions
10 After the reaction is completed, analyzing the fluorescent quantitative result, and transferring the product to a refrigerator at-80 ℃ after short-term storage at-20 ℃ and long-term storage. 2. Hybridization assay
Ensure that the detection area and the pipettor are clean and pollution-free.
Taking out the mixed Tag microsphere and the detection buffer solution at the temperature of 2-8 ℃ and placing the mixed Tag microsphere and the detection buffer solution on a light-shielding pipe frame in a detection area.
The mixed microsphere solutions were prepared as shown in the following table, suggesting 1 more than the required reaction amount. For example: the samples tested for the experiment required 9 hybridization reactions, calculated as the amount of 10 reactions, taking into account the consumption during the split-charging.
TABLE 3 preparation of solutions
Mixing the Tag microsphere, and shaking for 15-30sec.
The mixed Tag microspheres after shaking are added to the detection buffer.
Vortex and mix the microsphere solution, add 51 μl each into 8-joint tubes.
The PCR product was removed at 4℃and placed on a refrigerated well plate in the detection zone.
Vortex shaking and mixing the PCR products, and instantaneous centrifuging.
And 5 mu L of PCR product is taken and added into the corresponding detection reagent reaction hole, and the mixture is blown and evenly mixed by a liquid transfer device.
Attaching an easy-to-puncture membrane, placing the reaction tube in a PCR instrument, setting the denaturation at 95 ℃ for 2min, and incubating at 59 ℃ for 10min.
After incubation, the easy-to-puncture membrane is directly pierced by a gun head, 5 mu L of SA-PE is added, the easy-to-puncture membrane is attached again, incubation is carried out for 5min at 59 ℃ in a dark place, and the octant is placed in a NovaHT sample adding disc for machine detection.
TABLE 4 schematic table of liquid phase chip detection results
Remarks: a fluorescence number greater than 50000 is positive and less than 10000 is negative.
Although the invention has been described hereinabove with reference to embodiments, various modifications thereof may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the features of the disclosed embodiments may be combined with each other in any manner as long as there is no structural conflict, and the exhaustive description of these combinations is not given in this specification merely for the sake of omitting the descriptions and saving resources. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.
Claims (8)
1. A kit for detecting tick pathogen nucleic acid based on a liquid chip is characterized by comprising PCR primers, a Tag probe sequence, a double-binding probe sequence and fluorescent microspheres,
the application method of the kit for detecting the tick pathogen nucleic acid based on the liquid chip comprises the following steps of:
s1: designing a PCR primer, a Tag probe sequence and a double-combined probe sequence, wherein the PCR primer is used for amplifying 6 target gene fragments and 1 reference gene, the Tag probe is a probe which is designed aiming at 6 target genes and reference genes and is subjected to Aminolker C12 modification at the 5' end and is used for marking fluorescent microspheres, and the double-combined probe sequence is used for carrying out specific hybridization with an amplification product of amplifying the target gene fragments by adopting the PCR primer and the Tag probe which is used for marking the fluorescent microspheres;
the 5' end of the PCR primer is subjected to biotin modification, the PCR primer comprises 7 pairs of primers, and the sequences of the 7 pairs of primers are as follows:
anaplasma upstream primer: AGTCCGGRAGAGGATAGCG;
anaplasma downstream primer: biotin-TTCGCACCTCAGYGTCAG;
borrelia upstream primer: TAATGCTTRTTGGAGAAAATGAC;
borrelia downstream primer: biotin-GCAACYTCAGCCATACCT;
basia upstream primer: CAAGAACGAAAGTTAGGGGMT;
basia downstream primer: biotin-TGATTTCTCTCAAGSTSCTG;
borreliella upstream primer: CTTGTAGATGAGTCTGCGTCTTATTA;
primers downstream of Borreliella: biotin-CTCAGTTCCAGTGTGACCGWTC;
rickettsia upstream primer: ttgtgacggraggtaaacttgt;
rickettsia downstream primer: biotin-ATTATCGGCAGGAGCATCAA;
TBEV upstream primer: GGGCGGTTCTTGTTCTCC;
TBEV downstream primer: biotin-ACACATCACCTCCTTGTCAGACT;
beta-globin upstream primer: GGCTGCCTATCAGAAAGTGGTG;
beta-globin downstream primer: biotin-AGGCAGAATCCAGATGCTCAAG;
the Tag probe sequence is as follows (5 ， -3 ， ）：
Anaplasma-T：NH2C12-TGATTGTAGTATGTATTGATAAAG；
Borrelia-T：NH2C12-GATTGTAAGATTTGATAAAGTGTA；
Babesia-T：NH2C12-GATTTGAAGATTATTGGTAATGTA；
Borreliella-T：NH2C12-GATTGATTATTGTGATTTGAATTG；
Rickettsia-T：NH2C12-GATTTGATTGTAAAAGATTGTTGA；
TBEV-T：NH2C12-ATTGGTAAATTGGTAAATGAATTG；
β-globin-T：NH2C12-GTAAGTAATGAATGTAAAAGGATT；
The double binding probe sequence is as follows (5 ， -3 ， ）：
Anaplasma-P：CTTTATCAATACATACTACAATCA AGGAGGAACACCAGTGGCGAAG；
Borrelia-P：TACACTTTATCAAATCTTACAATC TGGGAAGAAGCACCAACAGATTATG；
Babesia-P：TACATTACCAATAATCTTCAAATC TAGKGATTGGAGGTCGTCRKT；
Borreliella-P：CAATTCAAATCACAATAATCAAT CCCTACCAAGRCRATGATAAGTAACCG；
Rickettsia-P：TCAACAATCTTTTACAATCAAATC AACTTGTTGCCTGTTACTATTACTGY；
TBEV-P：CAATTCATTTACCAATTTACCAATCCCTGAGCCACCATCACCCAGACACAGAT；
β-globin-P： AATCCTTTTACATTCATTACTTAC GCCCACAAGTATCACTAAGCTCGC；
S2: preparation of liquid phase chip: the fluorescent microsphere of the Tag probe in the step S1 and the double-binding probe in the step S1 are coupled to obtain a liquid phase chip;
s3: amplifying the target gene by adopting the PCR primer in the step S1 to obtain an amplified product, hybridizing with the liquid phase chip obtained in the step S2 to obtain a hybridized product, and reading out a detection result by a liquid phase chip detector.
2. The kit for detecting nucleic acid of a tick pathogen based on a liquid chip according to claim 1, wherein the step S3 specifically comprises:
(1) Dispersing the mixed fluorescent microsphere of the Tag probe and the double-binding probe in a detection buffer solution;
(2) Taking the PCR amplification product obtained in the step S1, uniformly mixing the PCR amplification product in the system, sealing a container opening for accommodating a reaction system, placing the container opening at 95 ℃ for incubation for 2min, transferring the container opening to a 55 ℃ environment, and continuously incubating for 10min;
(3) After incubation, 5. Mu.L of SA-PE is added to seal the mouth of the container again, and after incubation for 5min at 55 ℃, the container is placed in a NovaHT loading plate for machine detection.
3. The kit for detecting tick pathogen nucleic acid based on a liquid chip according to claim 1, wherein the step S3 is performed in a dark place.
4. A kit for detection of tick pathogen nucleic acid based on a liquid chip according to claim 2, wherein the detection buffer comprises 31 parts by volume of tetramethylammonium chloride buffer, 10 parts of TE solution, and 4 parts of 10% w/v peg8000 in water.
5. The kit for detecting tick pathogen nucleic acid based on the liquid chip according to claim 4, wherein the preparation component ratio and the preparation method of the tetramethylammonium chloride buffer solution are as follows:
225 parts by volume of a 5mol/L aqueous solution of tetramethylammonium chloride, 1.88 parts by volume of a 20% (w/v) double distilled aqueous solution of sarcosyl, 18.75 parts by volume of a pH8.0, 1mol/L Tris-HCl solution, 3.0 parts by volume of a 0.5mol/L EDTA solution and 1.37 parts by volume of double distilled water are mixed and dissolved in a water bath at 68 ℃ and stored at room temperature.
6. The kit for detecting tick pathogen nucleic acid based on the liquid chip according to claim 4, wherein the TE solution is prepared by the following components in proportion:
1 part by volume of Tris-HCl solution with pH of 8.0 and 1mol/L, 0.2 part by volume of EDTA solution with pH of 8.0 and 0.5mol/L and 100 parts by volume of double distilled water are mixed to obtain the aqueous solution.
7. The kit for detecting tick pathogen nucleic acid according to any of claims 2-6, wherein the hybridization reaction system of step S3 has a ratio of Tag probe to double binding probe of 1:1.5.
8. The kit for detecting nucleic acid of a tick pathogen based on a liquid chip according to claim 1, wherein the preparation method of the fluorescent microsphere of the Tag probe in the step S1 is as follows:
uniformly mixing fluorescent microspheres with a 0.1M 2-N-morpholinoethanesulfonic acid solution with the pH value of 4.5 to obtain a coupling system; and then adding a Tag probe and dichloroethane into the coupling system to react in a dark place to obtain the Tag fluorescent microsphere.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110943575.7A CN113444773B (en) | 2021-08-17 | 2021-08-17 | Method and kit for detecting tick pathogen nucleic acid based on liquid chip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110943575.7A CN113444773B (en) | 2021-08-17 | 2021-08-17 | Method and kit for detecting tick pathogen nucleic acid based on liquid chip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113444773A CN113444773A (en) | 2021-09-28 |
| CN113444773B true CN113444773B (en) | 2023-06-16 |
Family
ID=77818600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110943575.7A Active CN113444773B (en) | 2021-08-17 | 2021-08-17 | Method and kit for detecting tick pathogen nucleic acid based on liquid chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113444773B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114058716A (en) * | 2021-12-08 | 2022-02-18 | 河套学院 | Method for analyzing diversity of tick-borne pathogens |
| CN115553287B (en) * | 2022-10-27 | 2023-08-08 | 北京标驰泽惠生物科技有限公司 | Tick preservation solution and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831604A (en) * | 2021-02-05 | 2021-05-25 | 美格医学检验所(广州)有限公司 | Pathogenic microorganism detection primer group, kit and method based on targeted sequencing |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103173567B (en) * | 2013-03-27 | 2015-01-14 | 中国检验检疫科学研究院 | Suspension-array multiple non-diagnostic detection method for tick-borne pathogens |
| CN104651498A (en) * | 2015-01-23 | 2015-05-27 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Preparation and application of rickettsia discrimination detection gene chip |
| AU2020102093A4 (en) * | 2020-09-01 | 2020-10-08 | Chinese Academy Of Inspection And Quarantine | A test kit for simultaneously detecting ten insect-borne disease pathogens and application thereof |
| CN112553379B (en) * | 2020-12-30 | 2022-08-19 | 湖北新纵科病毒疾病工程技术有限公司 | Method and kit for detecting respiratory infectious disease virus based on liquid chip |
-
2021
- 2021-08-17 CN CN202110943575.7A patent/CN113444773B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831604A (en) * | 2021-02-05 | 2021-05-25 | 美格医学检验所(广州)有限公司 | Pathogenic microorganism detection primer group, kit and method based on targeted sequencing |
Non-Patent Citations (3)
| Title |
|---|
| Multiplex 5 Nuclease-Quantitative PCR for Diagnosis of Relapsing Fever in a Large Tanzanian Cohort;Megan E. Reller,;JOURNAL OF CLINICAL MICROBIOLOGY;第49卷(第9期);第3245–3249页 * |
| Multiplex real-time PCR diagnostic of relapsing fevers in Africa;Haitham Elbir;《PLOS Neglected Tropical Diseases》;第7卷(第1期);第1-5页 * |
| 伯氏疏螺旋体分型多重实时荧光定量PCR检测方法的建立;蔡婧;王建成;孙肖红;徐宝梁;王静;富英群;侯咏;杨宇;;中国国境卫生检疫杂志;38(第01期);第1-5页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113444773A (en) | 2021-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4268944B2 (en) | Nucleic acid detection or quantification method | |
| CN113444773B (en) | Method and kit for detecting tick pathogen nucleic acid based on liquid chip | |
| WO2017181339A1 (en) | Method and kit for simultaneous detection of protein ligand and gene | |
| WO1990002205A1 (en) | Detection of nucleic acid sequences using particle agglutination | |
| CN105301237A (en) | Method for detecting nucleic acid by colloidal gold chromatography technology and reagent kit | |
| CN112961861B (en) | Metamitron aptamer, screening method and application of metamitron aptamer to metamitron detection | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| CN105018590A (en) | Detection kit capable of simultaneous detection of protein ligand and genes and application thereof | |
| CN103911447A (en) | Primers, probes and method for detecting plasmodium | |
| CN109811036A (en) | The methods intersected amplification and combine bio-sensing detection mycobacterium tuberculosis complex more | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN103131760A (en) | Suspension chip detection method capable of simultaneously detecting six treatment microbes | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| CN108624653A (en) | A kind of kit of quantum dot detection of nucleic acids for bloodstream infection pathogen | |
| CN110734990A (en) | Detection reagent, kit and application thereof | |
| CN112553379B (en) | Method and kit for detecting respiratory infectious disease virus based on liquid chip | |
| WO2021039777A1 (en) | Method for examining rheumatoid arthritis | |
| Wang et al. | Label-free cross-priming amplification coupled with endonuclease restriction and nanoparticles-based biosensor for simultaneous detection of nucleic acids and prevention of carryover contamination | |
| CN108396029B (en) | A group of oligonucleotide aptamers capable of specifically recognizing Escherichia coli O157H 7 in different growth stages | |
| CN106319091A (en) | Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus) | |
| CN101429545A (en) | Method for detecting Shigella by using suspension chip technology | |
| CN111172305B (en) | Method and kit for detecting escherichia coli | |
| CN112410447B (en) | Amplification primer group of pseudomonas aeruginosa and detection method | |
| CN101487047B (en) | Method for detecting Vibrio cholerae O1 by suspending chip technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |