CN110734990A - Detection reagent, kit and application thereof - Google Patents
Detection reagent, kit and application thereof Download PDFInfo
- Publication number
- CN110734990A CN110734990A CN201911086292.4A CN201911086292A CN110734990A CN 110734990 A CN110734990 A CN 110734990A CN 201911086292 A CN201911086292 A CN 201911086292A CN 110734990 A CN110734990 A CN 110734990A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- nucleic acid
- band
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses detection reagents, a kit and application thereof, wherein the detection reagents comprise any or a plurality of combinations of four primer pairs, the four primer pairs comprise a primer pair, a third primer and a fourth primer, the primer and the second primer have sequences respectively shown as SEQ ID NO 1 and SEQ ID NO 2, the second primer pair comprises a third primer and a fourth primer, the sequences of the third primer and the fourth primer are respectively shown as SEQ ID NO 3 and SEQ ID NO 4, the third primer pair comprises a fifth primer and a sixth primer, the sequences of the fifth primer and the sixth primer are respectively shown as SEQ ID NO 5 and SEQ ID NO 6, the fourth primer pair comprises a seventh primer and an eighth primer, the sequences of the seventh primer and the eighth primer are respectively shown as SEQ ID NO 7 and SEQ ID NO 8, the detection method provided by the invention is to amplify gene segments with proper lengths by using marked specific primers, the high specificity of detection can be ensured, and the accuracy of detection results is improved.
Description
Technical Field
The invention relates to detection reagents and kits, in particular to detection reagents and kits for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae and streptococcus agalactiae and application thereof, and belongs to the technical field of molecular biology and immunology.
Background
Pathogenic bacteria such as escherichia coli, staphylococcus aureus, streptococcus dysgalactiae, streptococcus agalactiae and the like exist widely in in nature, and can pollute food, water and the like, thereby threatening the life safety of human beings and animals.
For example, for escherichia coli, staphylococcus aureus, streptococcus lactis and streptococcus agalactiae, the conventional detection method comprises the steps of sample treatment, enrichment culture, separation culture, dyeing observation and the like, and the detection method is a clinical detection 'gold standard', but the workload is high, and the detection period needs about weeks.
The method belongs to quantitative tests, has many advantages same as those of a test tube fermentation technology, has the most obvious advantages of the membrane filtration technology over the test tube fermentation technology that the membrane filtration technology is very convenient for detecting water samples with larger volume, can increase the sensitivity and the reliability of detection, has the defects of low specificity and easy erroneous judgment of results caused by the influence of other bacteria in the water samples, is used as a speculative test like , and needs to be confirmed by other methods in step , has the most important problems of an enzyme activity detection method (an enzyme substrate method) which is time-saving and labor-saving (18-24h) compared with the traditional method and has high specificity and high reagent cost, and an immunological method has the biggest problem of cross reactivity of a commercial monoclonal antibody or a polyclonal antibody and various intestinal bacteria, is easy to cause false positive and needs to prepare a monoclonal antibody or a polyclonal antibody with higher specificity.
the method based on molecular biology has unique advantages, the molecular biology identification can overcome the defects that the pathogenic bacteria can be detected within hours, the operation is simple and convenient, the research on detecting the microorganism by applying the PCR detection technology is more and more, compared with the traditional microorganism separation, culture and identification method, the PCR detection technology reduces the cycle length of detection and saves the cost required by detection, is suitable for clinical epidemiological investigation of Escherichia coli and investigation of individual cow and cow infection conditions in cow groups, early prevention control and accurate determination of the pathogen of the Escherichia coli, early and rapid clinical treatment and economic loss reduction, is effective good methods, and in addition, the PCR detection technology has higher specificity and sensitivity, the defect is that the method needs to combine with an electrophoresis tank, agarose gel and other instrument reagents, uses toxic substances such as nucleic acid dye and the like, needs a nucleic acid gel imager for later analysis, and has high requirements on experimental safety protection.
However, the existing detection methods have the disadvantages of complicated operation, susceptibility to environmental influences, susceptibility to infection, unsuitability for early diagnosis, large detection result error and the like, so that rapid, accurate and convenient diagnosis methods are urgently needed.
Disclosure of Invention
The invention mainly aims to provide detection reagents, kits and applications thereof, which can be used for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae and streptococcus agalactiae more sensitively, quickly, conveniently, safely and cheaply, so as to overcome the defects in the prior art.
In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:
the embodiment of the invention provides detection reagents, which comprise any or more combinations of the following four primer pairs, wherein the four primer pairs comprise:
the th primer pair comprises a th primer and a second primer with sequences shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively;
a second primer pair comprising primers having the sequences shown in SEQ ID NO: 3. SEQ ID NO: 4, a third primer and a fourth primer;
a third primer pair comprising primers with sequences as shown in SEQ ID NO: 5. SEQ ID NO: 6, a fifth primer and a sixth primer;
a fourth primer pair comprising primers with sequences as shown in SEQ ID NO: 7. SEQ ID NO: 8, and a seventh primer and an eighth primer shown in the figure.
, at least primer pairs of at least primers further have nucleic acid markers at their 5' ends, wherein the nucleic acid markers include any of FITC, FAM, HEX, TET, TAMRA, ROX, VIC, NED, Alexa flow, biotin, digoxin, cy3, and cy 5.
Further , each primer pair contains two primers with the nucleic acid marker at the 5' end.
, the detecting reagent further comprises DNA polymerase and PCR conventional components.
The embodiment of the invention also provides kits, which comprise the detection reagent and the nucleic acid immunochromatographic test strip, wherein the nucleic acid immunochromatographic test strip comprises a bottom plate, a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water absorption pad, and the nitrocellulose membrane is provided with a detection band (sprayed with digoxin antibody) and a quality control band (sprayed with goat-anti-mouse secondary antibody).
, attaching a complex formed by antibodies and colored particles on the gold label pad, arranging a second antibody on the detection band, and arranging a third antibody on the quality control band, wherein the antibodies are antibodies of the nucleic acid markers, the second antibodies are antibodies or ligands of the acid markers, and the third antibodies are antibodies capable of binding antibodies from specified species.
, the third antibody is goat anti-mouse polyclonal antibody, and the colored particles are spherical red colloidal gold particles labeled with fluorescein isothiocyanate antibodies.
In some more specific embodiments, sample pad, gold mark pad, cellulose nitrate membrane and the pad that absorbs water are all placed on the bottom plate, the sample pad is located bottom plate end, the pad that absorbs water is located the other end of bottom plate, the gold mark pad is located and partial pressure is placed in the sample pad bottom near sample pad end, cellulose nitrate membrane sets up in the middle of gold mark pad and the pad that absorbs water and has partial coincidence with gold mark pad, the pad that absorbs water, there are detection area and the quality control area of spraying on the cellulose nitrate membrane, it is located and is close to gold mark pad side to detect the area, the quality control area is located and is close to pad side that absorbs water, it sets up respectively at the both ends of lateral chromatography matrix membrane to absorb water filter paper pad, the combination pad sets up on the filter paper pad that absorbs water, there is fixed interval between gold mark pad and the pad that absorbs water.
In more specific embodiments, when a kit containing the nucleic acid immunochromatographic strip is used for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae, and streptococcus agalactiae, antibodies (e.g., FITC antibodies) are incubated with the colloidal gold particles , the antibodies are coated on the surfaces of the colloidal gold particles through electrostatic binding force to form colored cross-linked substances, the cross-linked substances are dropped on the gold label pad and dried for later use, the second antibodies are fixed on the nitrocellulose membrane in a line shape to form a detection band (line), and the third antibodies are fixed on the nitrocellulose membrane in a line shape to form a quality control band (line).
Preferably, the water-absorbing filter paper pad is glass fiber RB 65, the lateral chromatography matrix membrane is cellulose nitrate membrane Sartorius CN 140, the water-absorbing pad is CH 37, and the bottom plate is SM 31-40.
, the embodiment of the present invention also provides a developing solution (0.4% NaCl) for nucleic acid sequence detection, which can effectively develop PCR amplification products and make antigen and antibody effectively bind.
The embodiment of the invention also provides the application of the detection reagent or the kit in preparing a product for detecting pathogenic bacteria.
The embodiment of the invention also provides products applied to a pathogenic bacteria detection method, wherein the products comprise the kit of any of claims 5-7, and the detection method comprises the following steps:
amplifying the nucleic acid extracted from the sample to be tested by a PCR amplification reaction using at least primer pairs among the four primer pairs,
dripping the amplified product onto the nucleic acid immunochromatographic test paper of the kit, and observing whether a colored band is formed on the detection band and the finger control band; if colored bands visible to naked eyes are formed on the detection band and the quality control band, the detection band and the quality control band are judged to be positive; if no colored band is formed on the detection band and a macroscopic colored band is formed on the quality control band, judging the detection band to be negative; and if no colored band is formed on the quality control band, judging that the band is invalid.
, the pathogenic bacteria include any or more of Escherichia coli, Staphylococcus aureus, Streptococcus dysgalactiae and Streptococcus agalactiae.
Compared with the prior art, the invention has the advantages that:
1) according to the invention, the sensitivity of detecting food-borne pathogenic bacteria is improved by combining a PCR amplification technology and a specific binding technology of an antigen antibody, and the final signal amplification is realized by using a colloidal gold labeled antibody technology and a PCR product amplification dual strategy, so that the visual detection of escherichia coli is realized;
2) the method provided by the invention has the advantages of rapidness, visualization, ultrasensitiveness and the like; the method has important significance for improving the detection sensitivity of food-borne pathogenic bacteria, reducing the cost and realizing convenience, and is greatly helpful for popularizing the embodiment of the invention with insufficient experimental environment or carrying out rapid detection of escherichia coli;
3) as a general technical platform for detecting nucleic acid amplification products, the method and the nucleic acid immunochromatographic test strip thereof provided by the invention can be used for common food-borne pathogenic bacteria such as staphylococcus aureus, salmonella , enterohemorrhagic escherichia coli, listeria monocytogenes, shigella, vibrio parahaemolyticus and the like in the fields of agriculture and animal husbandry and food industry, food-borne pathogenic bacteria clinical detection, customs inspection and inspection, environmental monitoring, infectious disease prevention and control and the like, and are detection objects of the nucleic acid immunochromatographic test strip.
Drawings
FIG. 1a is a schematic diagram illustrating the detection principle of the detection kit for Escherichia coli, Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus agalactiae in an exemplary embodiment of the present invention;
FIG. 1b is a schematic diagram showing the results of the determination of the detection kit for Escherichia coli, Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus agalactiae in an exemplary embodiment of the present invention;
FIG. 2a is a graph showing the appearance of colloidal gold solutions of different particle sizes in example 1 of the present invention;
FIG. 2b is a scanning ultraviolet spectrophotometer of colloidal gold solution of different particle sizes in example 1 of the present invention;
FIG. 2c is a graph showing the color development effect of the test strip of colloidal gold solution with different particle sizes in example 1;
FIG. 3a is a diagram showing an electrophoretic analysis of a nucleic acid for detecting specificity of Escherichia coli in example 2 of the present invention;
FIG. 3b is the analysis chart of the immunochromatographic test strip for the specific detection of Escherichia coli in example 2 of the present invention;
FIG. 4a is a diagram of the nucleic acid electrophoresis analysis for the detection of E.coli with sensitivity in example 3 of the present invention;
FIG. 4b is the test strip analysis chart of the nucleic acid immunochromatography for detecting the sensitivity of Escherichia coli in example 3 of the present invention;
FIG. 5a is a graph showing the appearance of colloidal gold solutions of different particle sizes in example 4 of the present invention;
FIG. 5b is a scanning ultraviolet spectrophotometer of colloidal gold solution of different particle sizes in example 4 of the present invention;
FIG. 5c is a graph showing the color development effect of the colloidal gold solution test strip of different particle sizes in example 4 of the present invention;
FIG. 6a is the specific detection nucleic acid electrophoresis analysis chart of Staphylococcus aureus in example 5 of the present invention;
FIG. 6b is the analysis chart of the nucleic acid immunochromatographic test strip for the specific detection of Staphylococcus aureus in example 5 of the present invention;
FIG. 7a is a diagram of nucleic acid electrophoresis analysis for the sensitive detection of Staphylococcus aureus in example 6 of the present invention;
FIG. 7b is the analytic diagram of the nucleic acid immunochromatographic test strip for the sensitive detection of Staphylococcus aureus in example 6 of the present invention;
FIG. 8a is an appearance diagram of colloidal gold solutions of different particle sizes in example 7 of the present invention;
FIG. 8b is a UV spectrophotometer scan of colloidal gold solutions of different particle sizes in example 7 of the present invention;
FIG. 8c is a graph showing the color development effect of the test strip of colloidal gold solution with different particle sizes in example 7;
FIG. 9a is a diagram showing an electrophoretic analysis of a nucleic acid for detecting the specificity of Streptococcus dysgalactiae in example 8 of the present invention;
FIG. 9b is an analysis chart of the nucleic acid immunochromatographic strip for the specific detection of Streptococcus dysgalactiae in example 8 of the present invention;
FIG. 10a is a photograph which shows an electrophoretic analysis of nucleic acid for the sensitive detection of Streptococcus dysgalactiae in example 9 of the present invention;
FIG. 10b is an analytical chart of a nucleic acid immunochromatographic strip for the sensitive detection of Streptococcus dysgalactiae in example 9 of the present invention;
FIG. 11a is a graph showing the appearance of colloidal gold solutions of different particle sizes in example 10 of the present invention;
FIG. 11b is a UV spectrophotometer scan of colloidal gold solutions of different particle sizes in example 10 of the present invention;
FIG. 11c is a graph showing the color development effect of the test strip of colloidal gold solution with different particle sizes in example 10;
FIG. 12a is a photograph which shows an electrophoretic analysis of a nucleic acid for specifically detecting Streptococcus agalactiae in example 11 of the present invention;
FIG. 12b is a diagram of an immunochromatographic test strip for the specific detection of Streptococcus agalactiae in example 11 of the present invention;
FIG. 13a is a photograph which shows an electrophoretic analysis of a nucleic acid for the sensitive detection of Streptococcus agalactiae in example 12 of the present invention;
FIG. 13b is an analytical chart of a nucleic acid immunochromatographic strip for the sensitive detection of Streptococcus agalactiae in example 12 of the present invention.
Detailed Description
The present inventors have long studied and practiced a great deal to provide a technical solution of the present invention, which will be explained in step as follows.
Technical terms used in the description of the present invention are explained:
colloidal gold, also called colloidal gold, is a stable and uniform gold particle suspension formed after gold salt is reduced into a gold simple substance and suspended in liquid in a single dispersed state.
Nucleic acid polymerase: enzymes for synthesizing long nucleic acid chains; it is divided into two major classes, DNA polymerase and RNA polymerase.
Primer DNA Synthesis initiator is typically pairs of single stranded oligonucleotides, and after hybridization to the template, DNA synthesis starts at its 3' end.
Marking: methods for coupling detectable signal molecules (e.g., haptens, fluorescent, radioactive, etc.) to single-stranded oligonucleotides.
And (3) hybridization: in particular to the formation of a double-stranded structure of complementary DNA single strands through base pairing.
Unfolding: and the PCR product after the amplification reaction moves from the bottom end of the water absorption pad of the test strip to the detection line and the quality control line under the chromatography action of the development buffer solution.
Nucleic acid (A): the generic names deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Antigens and haptens: a substance having immunogenicity. Typically a macromolecular protein or cellular component. However, some small molecules are also immunogenic and are called haptens (Hapten). Haptens are often used to label probes.
Antibody: a protein molecule capable of specifically binding to an antigen or hapten.
Complex: a conjugate formed by specifically combining two or more molecules.
Primer dimer during Polymerase Chain Reaction (PCR), a dimer molecule formed by annealing primer pairs or single primers to each other, a dimer formed by two different primers is a heterodimer and may cause binding with a species antibody to cause false positive due to the presence of two labels, and a dimer formed by annealing a single primer is a homodimer and only has labels without causing false positive, but excessive dimer formation may reduce amplification efficiency.
The immunochromatography test strip comprises: medical tools for rapid detection, also known as color generation thin film chromatography.
The method for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae and streptococcus agalactiae provided by the embodiment of the invention greatly simplifies the detection procedure after nucleic acid amplification, saves the detection cost, has simple, clear and intuitive judgment of results (the detection principle and the results are shown in the attached drawings 1a and ab), and has the following advantages when being used as novel detection technologies after nucleic acid amplification:
is applied to serve as a general technical platform for detecting nucleic acid amplification products, the method and the test strip thereof can be widely applied to fields of agriculture and animal husbandry and food industry, clinical detection of food-borne pathogenic bacteria, customs inspection and inspection, environmental monitoring, control of infectious diseases and the like, and common food-borne pathogenic bacteria such as staphylococcus aureus, salmonella , enterohemorrhagic escherichia coli, listeria monocytogenes, shigella, vibrio parahaemolyticus and the like are all objects of the test strip for detecting the nucleic acid amplification products.
The method has the advantages of simple operation, no need of professional operation, availability of the embodiment of the invention, and capability of being used in -line prevention and control mechanisms and farms, rapidness in reading the result after 5 minutes of detection, convenience in directly observing by naked eyes without electrophoresis and gel imaging systems, sensitivity in detection, high specificity, more accurate result due to the use of specific labeled primers in the detection process, low cost and detection expense greatly lower than those of gel electrophoresis and ELISA detection.
In an exemplary embodiment of the present invention, methods for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae or streptococcus agalactiae by using a nucleic acid immunochromatographic test strip comprise the following steps:
1) two unique amplification primers were provided:
wherein, the sequence (SEQ ID NO: 1) of an upstream primer Ecol-FITC-F (namely the th primer) used for detecting the escherichia coli is 5'-ATCAACCGAGATTCCCCCAGT-3', the 5 'end of the upstream primer is marked by a nucleic acid marker such as Fluorescein Isothiocyanate (FITC) and the like, the sequence (SEQ ID NO: 2) of a downstream primer Ecol-DIG-R (namely the second primer) is 5'-TCACTATCGGTCAGTCAGGAG-3', the 5' end of the downstream primer is marked by a nucleic acid marker such as Digoxin (DIG) and the like, a DNA fragment with the length of 254bp can be amplified by under proper amplification conditions, and when a detected nucleic acid template does not exist, a product is not amplified by a specific nucleic acid fragment;
the sequence (SEQ ID NO: 3) of an upstream primer nuc-FITC-F (namely the third primer) used for detecting staphylococcus aureus is 5'-CGATTGATGGTGATACGGTT-3', the 5 'end of the upstream primer is marked by a nucleic acid marker such as Fluorescein Isothiocyanate (FITC) and the like, the sequence (SEQ ID NO: 4) of a downstream primer nuc-DIG-R (namely the fourth primer) is 5'-CTCTTTTTTCGCTTGTGCTT-3', the 5' end of the downstream primer is marked by a nucleic acid marker such as Digoxin (DIG) and the like, and a DNA fragment with the length of 356bp of segment can be amplified under proper amplification conditions;
the sequence (SEQ ID NO: 5) of an upstream primer sdy-FITC-F (namely a fifth primer) adopted for detecting the streptococcus dysgalactiae is 5'-TAAAGGTGC AACTGCATCACTA-3', the 5 'end of the upstream primer is marked by a nucleic acid marker such as Fluorescein Isothiocyanate (FITC) and the like, the sequence (SEQ ID NO: 6) of a downstream primer sdy-DIG-R (namely a sixth primer) is 5'-AGTCACATGGTGGATTTTCCA-3', the 5' end of the downstream primer is marked by a nucleic acid marker such as Digoxin (DIG) and the like, and a DNA fragment with the length of segments of 282bp can be amplified under proper amplification conditions;
the sequence (SEQ ID NO: 7) of an upstream primer cfb-F (namely a seventh primer) adopted for detecting the streptococcus agalactiae is 5'-TAATAATCAAGCCCAGC-3', the 5 'end of the upstream primer cfb-F is marked by a nucleic acid marker such as Fluorescein Isothiocyanate (FITC) and the like, the sequence (SEQ ID NO: 8) of a downstream primer cfb-R (namely an eighth primer) is 5'-CCTTTTGTTCTAATGCC-3', the 5' end of the downstream primer cfb-R is marked by a nucleic acid marker such as Digoxin (DIG) and the like, and a DNA fragment with the length of 388bp of segments can be amplified under proper amplification conditions;
2) crosslinking the general antibody (i.e. the antibody such as anti-digoxin antibody) of markers (such as the aforementioned nucleic acid markers, named marker 1) with the colloidal gold particles to form coated antibodies on the surfaces of the colloidal particles;
3) fixing antibodies or ligands (namely second antibodies, such as FITC antibodies) of another markers (such as the aforementioned nucleic acid markers, named marker 2) on a membrane (such as a nitrocellulose membrane) on the test strip in a line shape to form a detection zone (line);
4) when a specific amplification product to be detected exists, two of the three labeling substances are simultaneously carried in the amplification product due to the action of the upstream primer and the downstream primer to form a marker 1-amplification product-marker 2 complex, wherein the marker 1 is the nucleic acid marker, and the marker 2 is the second nucleic acid marker;
5) combining the marker 1-amplification product-marker 2 formed in the step 4) with the antibody of the marker 1 coated on the surface of the colloidal gold particle to form an anti-marker 1 antibody-marker 1-amplification product-marker 2 colored particle complex;
6) allowing the colored particle compound obtained in the step 5) to flow upwards along the fiber in the solution through a capillary phenomenon to a line coated with the antibody or ligand of the marker 2, depositing the compound due to the combination with the antibody (ligand) of the marker 2, staying on the detection line to form a macroscopic colored line, and judging the colored line to be positive;
7) when the specific amplification product is not present, the above-mentioned steps 4) to 6) do not occur, and a marker 1-amplification product-marker 2 complex cannot be formed, and an antibody (ligand) deposited on the marker 2 on the detection line cannot be formed, and a visible band is not formed, and the result is judged to be negative.
According to the method for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae and streptococcus agalactiae, the specificity of the amplification product is ensured by the screened specific primers, and meanwhile, modifiers at two ends of the primers are specifically combined with the antigen and antibody on the test strip, so that the accuracy of the detection result is dually ensured; the detection method avoids complex operation links of gel electrophoresis after nucleic acid amplification, and is integrated with a test strip detection technology to ensure that the detection method is safer, simpler, quicker, more convenient and cheaper.
The method for detecting escherichia coli, staphylococcus aureus, streptococcus dysgalactiae and streptococcus agalactiae provided by the invention is used for amplifying a gene segment with a proper length by using a marked specific primer, so that the high specificity of detection can be ensured, and the accuracy of a detection result is improved; the visual characteristic of immune colloidal gold (test paper) is kept, and the method has the advantages of rapidness, convenience, maturity, low price and the like.
The technical solution, its implementation, principles, etc. will be further explained with reference to the drawings and the embodiments.
Example 1
And testing the influence of different colloidal gold particle sizes on the color development effect of the test strip.
1 materials and methods
1.1 materials
Colloidal gold solutions of varying particle sizes from 10nm to 50nm were prepared from the examples of the invention.
1.2 the appearance changes of gold nanoparticles with different particle sizes caused by different addition amounts of citric acid are shown in the following table:
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
1) Taking 1ml of colloidal gold solution with different particle sizes (shown in figure 2 a);
2) adding 10ul of 1M potassium carbonate solution into 1ml of colloidal gold solution to adjust the pH value of the solution, and uniformly mixing; adding 4ul FITC antibody, mixing uniformly at four degrees, and incubating for 1 h; adding sealing liquid, and incubating at room temperature for 30 min; centrifuging at 7000r/min for 3min to remove unbound protein, centrifuging the supernatant again, centrifuging at 9400r/min for 20min, and collecting the supernatant; adding 80ul of the complex solution, and aging for 2h at 4 ℃; taking out, dripping 6ul of the solution on the gold label pad, and drying at 25 ℃; assembling the dried gold label pad on the test strip;
3) culturing the preserved Escherichia coli to logarithmic phase, taking bacterial liquid for nucleic acid amplification, and performing PCR amplification by using the PCR reaction system (1.3); diluting the PCR amplification product with different gradients; and (4) respectively dripping the test paper strips prepared from the colloidal gold solutions with different particle sizes, and observing the results.
2 results
Appearance results and ultraviolet spectrophotometer scanning results of the colloidal gold solutions with different particle sizes are shown in fig. 2a and 2b, and the colloidal gold solution prepared by the embodiment of the invention has stable properties and uniform particle size distribution and meets the requirements of experiments; the results of the nucleic acid immunochromatographic test strip with different particle sizes and gradient dilution are shown in fig. 2c, the larger the particle size of the gold particles is, the more aggregation and precipitation are likely to occur, so that the colloidal gold solution larger than 35nm is likely to aggregate in the treatment process, a stably dispersed solvent cannot be obtained, and the method is not suitable for preparing the test strip for use, and in the color development result shown in fig. 2c, the test strip corresponding to 10nm is the best in judgment of color development effect such as the release degree from the gold standard pad, background definition, color development intensity, color development uniformity and the like.
Example 2
Testing the specificity identification of the Escherichia coli in different food-borne pathogenic bacteria.
1 materials and methods
1.1 materials
The various zoonotic strains referred to in this example are shown in Table 1.
TABLE 1 Experimental strains
Table 1 Bacterial strains for detection
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Recovering and culturing different strains, counting the number of bacterial colonies by using a plate, extracting bacterial DNA, carrying out PCR amplification on escherichia coli, staphylococcus aureus, streptococcus agalactiae, streptococcus dysgalactiae, enterococcus faecalis, staphylococcus epidermidis, saccharomycetes, salmonella , bacillus cereus, listeria monocytogenes and pure water by using the PCR reaction system (1.3), and verifying the specificity among the different strains by using gel electrophoresis and nucleic acid immunochromatographic test strips respectively.
1) Uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto a test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development;
2) another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The specific identification electrophoresis result of different strains of escherichia coli is shown in figure 3a, the specific identification nucleic acid immunochromatographic test strip identification result of different strains of escherichia coli is shown in figure 3b, and the results show that: the detection method after PCR amplification established by the invention has better specificity to escherichia coli, does not generate obvious test strip positive reaction among different strains, has good identification degree, can be observed by naked eyes without other experimental instruments, can be conveniently used by primary workers, and is more beneficial to detecting the escherichia coli.
Example 3
And (3) testing the sensitivity of the nucleic acid immunochromatographic test strip for detecting escherichia coli.
1 materials and methods
1.1 materials
Escherichia coli was isolated, identified and preserved by the animal medical college of Nanjing university of agriculture of the invention.
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Resuscitating and culturing Escherichia coli, diluting the bacteria solution, and counting with plate (the number of colonies 1-9 in FIG. 4a and FIG. 4b is 2 × 10)8cfu/ml、2×107cfu/ml、2×106cfu/ml、2×105cfu/ml、2×104cfu/ml、2×103cfu/ml、2×102cfu/ml、2×101cfu/ml, 2 cfu/ml; meanwhile, bacterial DNA is extracted to be used as a PCR template, and the sensitivity of the Escherichia coli is verified by gel electrophoresis and a nucleic acid immunochromatography test strip respectively after the PCR amplification is carried out on the Escherichia coli by using the PCR reaction system (1.3).
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The results of the escherichia coli detection sensitivity identification electrophoresis are shown in fig. 4a, the results of the escherichia coli detection sensitivity identification nucleic acid immunochromatographic test strip identification are shown in fig. 4b, and the results show that: the nucleic acid immunochromatographic test strip detection method for detecting escherichia coli, which is established by the invention, has high detection sensitivity, and the lowest detection limit can be 2 multiplied by 102cfu/mL, 10-fold higher than the detection sensitivity of nucleic acid gel electrophoresis.
Example 1-the sequence of Ecoil-FITC-F (i.e., the th primer sequence) ATCAACCGAGATTCCCCCAGT and the sequence of Ecoil-DIG-R (i.e., the second primer sequence) in example 3 was TCACTATCGGTCAGTCAGGAG.
Example 4
And testing the influence of different colloidal gold particle sizes on the color development effect of the test strip.
1 materials and methods
1.1 materials
Colloidal gold solutions of varying particle sizes ranging from 10nm to 50nm were prepared from the examples of the invention.
1.2 the appearance changes of gold nanoparticles with different particle sizes caused by different addition amounts of citric acid are shown in the following table:
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
1) Taking 1ml of colloidal gold solution with different particle sizes (shown in figure 5 a);
2) adding 10ul of 1M potassium carbonate solution into 1ml of colloidal gold solution to adjust the pH value of the solution, and uniformly mixing; adding 4ul FITC antibody, mixing uniformly at four degrees, and incubating for 1 h; adding sealing liquid, and incubating at room temperature for 30 min; centrifuging at 7000r/min for 3min to remove unbound protein, centrifuging the supernatant again, centrifuging at 9400r/min for 20min, and removing the supernatant; adding 80ul of compound solution, and standing for aging at 4 ℃ for 2 h; taking out, dripping 6ul of the solution on the gold label pad, and drying at 25 ℃; and assembling the dried gold label pad on the test strip.
3) Reviving the preserved staphylococcus aureus, culturing to logarithmic phase, taking bacterial liquid for nucleic acid amplification, and performing PCR amplification by using the PCR reaction system (1.3); diluting the PCR amplification product with different gradients; and (4) respectively dripping the test paper strips prepared from the colloidal gold solutions with different particle sizes, and observing the results.
2 results
The apparent results of the colloidal gold solutions with different particle sizes and the scanning results of the ultraviolet spectrophotometer are shown in fig. 5a and 5b, and the colloidal gold solution prepared by the embodiment of the invention has stable properties and uniform particle size distribution and meets the requirements of experiments; the results of the nucleic acid immunochromatographic test strip with different particle sizes and gradient dilution are shown in fig. 5c, the larger the particle size of the gold particles is, the more aggregation and precipitation are likely to occur, so that the colloidal gold solution larger than 35nm is likely to aggregate in the treatment process, a stably dispersed solvent cannot be obtained, and the test strip is not suitable for preparing the test strip for use, and in the color development result shown in fig. 5c, the test strip corresponding to 10nm is the best in judgment of color development effect such as the release degree from the gold standard pad, background definition, color development intensity, color development uniformity and the like.
Example 5
Testing the specificity identification of the staphylococcus aureus in different food-borne pathogenic bacteria.
1 materials and methods
1.1 materials
The various zoonosis strains involved in the examples of the invention are shown in Table 2.
TABLE 2 Experimental strains
Table 2 Bacterial strains for detection
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Recovering and culturing different strains, counting the number of bacterial colonies by using a plate, extracting bacterial DNA, carrying out PCR amplification on staphylococcus aureus, escherichia coli, streptococcus agalactiae, streptococcus dysgalactiae, enterococcus faecalis, staphylococcus epidermidis, saccharomycetes, salmonella , bacillus cereus, listeria monocytogenes and pure water by using the PCR reaction system (1.3), and verifying the specificity among the different strains by using gel electrophoresis and nucleic acid immunochromatographic test strips respectively.
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The specific identification electrophoresis result of staphylococcus aureus among different strains is shown in figure 6a, the specific identification nucleic acid immunochromatographic test strip identification result of staphylococcus aureus among different strains is shown in figure 6b, and the results show that: the detection method after PCR amplification established by the invention has better specificity to staphylococcus aureus, does not generate obvious test strip positive reaction among different strains, has good identification degree, can be observed by naked eyes without other experimental instruments, can be conveniently used by primary workers, and is more beneficial to detecting staphylococcus aureus.
Example 6
And (3) testing the sensitivity of the nucleic acid immunochromatographic test strip for detecting staphylococcus aureus.
1 materials and methods
1.1 materials
The various zoonosis strains involved in the examples of the invention are shown in Table 3.
TABLE 3 test strains
Table 3 Bacterial strains for detection
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Resuscitating and culturing Staphylococcus aureus, diluting the bacterial liquid, and counting with flat plate, wherein the colony count corresponding to 1-9 in FIGS. 6a and 6b is 4 × 108cfu/ml、4×107cfu/ml、4×106cfu/ml、4×105cfu/ml、4×104cfu/ml、4×103cfu/ml 、4×102cfu/ml、4×101cfu/ml, 4 cfu/ml; meanwhile, bacterial DNA is extracted as a PCR template, and the sensitivity of staphylococcus aureus is verified by gel electrophoresis and a nucleic acid immunochromatography test strip respectively after the PCR amplification is carried out on the staphylococcus aureus by using the PCR reaction system (1.3).
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The result of the electrophoresis for detecting the sensitivity of the staphylococcus aureus is shown in fig. 7a, the result of the nucleic acid immunochromatographic test strip for detecting the sensitivity of the staphylococcus aureus is shown in fig. 7b, and the results show that: it can be seen that the nucleic acid immunoassay for detecting staphylococcus aureus established by the inventionThe detection method of the immunochromatographic test strip has high detection sensitivity, and the lowest detection limit can be 4 multiplied by 102cfu/mL, 10-fold higher than the detection sensitivity of nucleic acid gel electrophoresis.
The nuc-FITC-F sequence (i.e., the third primer sequence) in examples 4-6 is: CGATTGATGGTGATACGGTT, respectively; the nuc-DIG-R sequence (i.e., the fourth primer sequence) is: CTCTTTTTTCGCTTGTGCTT are provided.
Example 7
And testing the influence of different colloidal gold particle sizes on the color development effect of the test strip.
1 materials and methods
1.1 materials
Colloidal gold solutions of varying particle sizes ranging from 10nm to 50nm were prepared from the examples of the invention.
1.2 the appearance changes of gold nanoparticles with different particle sizes caused by different addition amounts of citric acid are shown in the following table:
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
1) Taking 1ml of colloidal gold solution with different particle sizes (as shown in figure 8 a);
2) adding 10ul of 1M potassium carbonate solution into 1ml of colloidal gold solution to adjust the pH value of the solution, and uniformly mixing; adding 4ul FITC antibody, mixing uniformly at four degrees, and incubating for 1 h; adding sealing liquid, and incubating at room temperature for 30 min; centrifuging at 7000r/min for 3min to remove unbound protein, centrifuging the supernatant again, centrifuging at 9400r/min for 20min, and removing the supernatant; adding 80ul of compound solution, and standing for aging at 4 ℃ for 2 h; taking out, dripping 6ul of the solution on the gold label pad, and drying at 25 ℃; and assembling the dried gold label pad on the test strip.
3) Recovering the preserved streptococcus dysgalactiae, culturing to logarithmic phase, taking bacteria liquid for nucleic acid amplification, and performing PCR amplification by using the PCR reaction system (1.3); diluting the PCR amplification product with different gradients; and (4) respectively dripping the test paper strips prepared from the colloidal gold solutions with different particle sizes, and observing the results.
2 results
The apparent results of the colloidal gold solutions with different particle sizes and the scanning results of the ultraviolet spectrophotometer are shown in fig. 8a and 8b, and the colloidal gold solution prepared by the embodiment of the invention has stable properties and uniform particle size distribution and meets the requirements of experiments; the results of the nucleic acid immunochromatographic test strip with different particle sizes and gradient dilution are shown in fig. 8c, and the larger the particle size of the gold particles is, the more aggregation and precipitation are likely to occur, so that the colloidal gold solution larger than 35nm is likely to aggregate in the treatment process, and a stably dispersed solvent cannot be obtained, so that the colloidal gold solution is not suitable for preparing the test strip for use, and in the color development result shown in fig. 8c, the test strip corresponding to 10nm is the best in judgment of color development effect such as the release degree from the gold standard pad, background definition, color development intensity, color development uniformity and the.
Example 8
Testing the specificity identification of the streptococcus dysgalactiae in different food-borne pathogenic bacteria pollution.
1 materials and methods
1.1 materials
The various zoonosis strains involved in the examples of the invention are shown in Table 4.
TABLE 4 test strains
Table 4 Bacterial strains for detection
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Recovering and culturing different strains, counting the number of bacterial colonies by using a plate, extracting bacterial DNA, carrying out PCR amplification on streptococcus dysgalactiae, staphylococcus aureus, escherichia coli, streptococcus dysgalactiae, enterococcus faecalis, staphylococcus epidermidis, saccharomycetes, salmonella , bacillus cereus, listeria monocytogenes and pure water by using the PCR reaction system (1.3), and verifying the specificity among the different strains by using gel electrophoresis and nucleic acid immunochromatographic test strips respectively.
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The specific identification electrophoresis result of the streptococcus dysgalactiae among different strains is shown in fig. 9a, the specific identification nucleic acid immunochromatographic test strip identification result of the streptococcus dysgalactiae among different strains is shown in fig. 9b, and the results show that: the detection method after PCR amplification established by the invention has better specificity to the streptococcus dysgalactiae, does not generate obvious test strip positive reaction among different strains, has good identification degree, can be observed by naked eyes without other experimental instruments, can be convenient for primary workers to use, and is more beneficial to detecting the streptococcus dysgalactiae.
Example 9
And (3) testing the sensitivity of the nucleic acid immunochromatographic test strip for detecting the streptococcus dysgalactiae.
1 materials and methods
1.1 materials
Streptococcus dysgalactiae was isolated, characterized and preserved by the animal medical college of Nanjing university of agriculture of the invention.
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Resuscitating and culturing Streptococcus dysgalactiae, diluting the bacteria solution, and counting with plate, wherein the colony count corresponding to 1-9 in FIGS. 9a and 9b is 1.6 × 108cfu/ml、1.6×107cfu/ml、1.6×106cfu/ml、1.6×105cfu/ml、1.6×104cfu/ml、1.6× 103cfu/ml、1.6×102cfu/ml、1.6×101cfu/ml, 2 cfu/ml; meanwhile, bacterial DNA is extracted as a PCR template, and the sensitivity of the streptococcus dysgalactiae is verified by respectively using gel electrophoresis and a nucleic acid immunochromatographic test strip after the PCR amplification is carried out on the streptococcus dysgalactiae by using the PCR reaction system (1.3).
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
Detection sensitivity identification method for streptococcus dysgalactiaeThe swimming results are shown in FIG. 10a, the identification results of the nucleic acid immunochromatographic test strip for identifying the detection sensitivity of Streptococcus dysgalactiae are shown in FIG. 10b, and the results show that: the nucleic acid immunochromatographic test strip for detecting streptococcus dysgalactiae established by the invention has high detection sensitivity, and the lowest detection limit can be 1.6 multiplied by 103cfu/mL, 10-fold higher than the detection sensitivity of nucleic acid gel electrophoresis.
Example 7-the sequence of sdy-FITC-F (i.e., the fifth primer sequence) in example 9 was: TAAAGGTGCAACTGCATACTA, respectively; sdy-DIG-R sequence (i.e., the sixth primer sequence) is: AGTCACATGGTGGATTTTCCA are provided.
Example 10
And testing the influence of different colloidal gold particle sizes on the color development effect of the test strip.
1 materials and methods
1.1 materials
Colloidal gold solutions of varying particle sizes ranging from 10nm to 50nm were prepared from the examples of the invention.
1.2 the appearance changes of gold nanoparticles with different particle sizes caused by different addition amounts of citric acid are shown in the following table:
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
1) Taking 1ml of colloidal gold solution with different particle sizes (shown in figure 11 a);
2) adding 10ul of 1M potassium carbonate solution into 1ml of colloidal gold solution to adjust the pH value of the solution, and uniformly mixing; adding 4ul FITC antibody, mixing uniformly at four degrees, and incubating for 1 h; adding sealing liquid, and incubating at room temperature for 30 min; centrifuging at 7000r/min for 3min to remove unbound protein, centrifuging the supernatant again, centrifuging at 9400r/min for 20min, and removing the supernatant; adding 80ul of compound solution, and standing for aging at 4 ℃ for 2 h; taking out, dripping 6ul of the solution on the gold label pad, and drying at 25 ℃; and assembling the dried gold label pad on the test strip.
3) Recovering the preserved streptococcus agalactiae, culturing to logarithmic phase, taking bacteria liquid for nucleic acid amplification, and performing PCR amplification by using the PCR reaction system (1.3); diluting the PCR amplification product with different gradients; and (4) respectively dripping the test paper strips prepared from the colloidal gold solutions with different particle sizes, and observing the results.
2 results
The apparent results of the colloidal gold solutions with different particle sizes and the scanning results of the ultraviolet spectrophotometer are shown in fig. 11a and 11b, and the colloidal gold solution prepared by the embodiment of the invention has stable properties and uniform particle size distribution and meets the requirements of experiments; the results of the nucleic acid immunochromatographic test strip with different particle sizes and gradient dilution are shown in fig. 11c, and the larger the particle size of the gold particles is, the more aggregation and precipitation are likely to occur, so that the colloidal gold solution larger than 35nm is likely to aggregate in the treatment process, and a stably dispersed solvent cannot be obtained, and the colloidal gold solution is not suitable for preparing the test strip for use, and in the color development results shown in fig. 11c, the test strip corresponding to 10nm has the best judgment color development effect on the release degree from the gold standard pad, background definition, color development intensity, color development uniformity and the like.
Example 11
Testing the specificity identification of the streptococcus agalactiae in different food-borne pathogenic bacteria.
1 materials and methods
1.1 materials
The various zoonosis strains involved in the examples of the invention are shown in Table 5.
TABLE 5 test strains
Table 5 Bacterial strains for detection
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Recovering and culturing different strains, counting the number of bacterial colonies by using a plate, extracting bacterial DNA, carrying out PCR amplification on streptococcus agalactiae, staphylococcus aureus, escherichia coli, streptococcus dysgalactiae, enterococcus faecalis, staphylococcus epidermidis, saccharomycetes, salmonella , bacillus cereus, listeria monocytogenes and pure water by using the PCR reaction system (1.3), and verifying the specificity among the different strains by using gel electrophoresis and nucleic acid immunochromatographic test strips respectively.
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The specific identification electrophoresis result of the streptococcus agalactiae among different strains is shown in figure 12a, the specific identification nucleic acid immunochromatographic test strip identification result of the streptococcus agalactiae among different strains is shown in figure 12b, and the results show that: the detection method after PCR amplification established by the invention has better specificity to the streptococcus agalactiae, has no obvious test strip positive reaction among different strains, has good identification degree, can be observed by naked eyes without other experimental instruments, can be conveniently used by primary workers, and is more beneficial to detecting the streptococcus agalactiae.
Example 12
And (3) testing the sensitivity of the nucleic acid immunochromatographic test strip for detecting the streptococcus agalactiae.
1 materials and methods
1.1 materials
Streptococcus agalactiae was isolated, characterized and preserved by the animal medical college of Nanjing university of agriculture according to the examples of the invention.
1.2 primer design
1.3 PCR amplification System:
reaction conditions are as follows:
1.4 methods of operation
Resuscitating and culturing the streptococcus agalactiae, taking a bacterium solution for gradient dilution, counting by adopting a flat plate, simultaneously extracting bacterial DNA as a PCR template, carrying out PCR amplification on the streptococcus agalactiae by using the PCR reaction system (1.3), and then respectively verifying the sensitivity by using gel electrophoresis and a nucleic acid immunochromatographic test strip.
1) And (3) uniformly mixing 4 mu L of PCR product with 196ul of developing solution, dripping 60ul of PCR product onto the test strip, and shooting a test strip color development result by using a smart phone or a camera after five minutes of color development.
2) Another 5. mu.L of PCR product was electrophoresed in 1.5% agarose gel containing ethidium bromide under the following conditions: 1 XTAE buffer solution, voltage 125V, electrophoresis time 25min, and observing the gel result after running out of electrophoresis by using a nucleic acid gel imager, shooting and storing.
2 results
The detection sensitivity and identification electrophoresis result of the streptococcus agalactiae is shown in fig. 13a, the detection sensitivity and identification nucleic acid immunochromatographic test strip is shown in fig. 13b, and the results show that: the nucleic acid immunochromatographic test strip for detecting streptococcus agalactiae established by the invention has high detection sensitivity, can reach the lowest detection limit of 2 x 102cfu/mL, and has 10 times higher detection sensitivity than nucleic acid gel electrophoresis.
The sequence of cfb-FITC-F (i.e., the seventh primer sequence) in examples 10-12 is: TAATAATCAAGCCCAGC, respectively; the cfb-DIG-R sequence (i.e., the eighth primer sequence) is: CCTTTTGTTCTAATGCC are provided.
It should be understood that the above-mentioned embodiments are merely illustrative of the technical concepts and features of the present invention, which are intended to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and therefore, the protection scope of the present invention is not limited thereby. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.
Sequence listing
<110> Nanjing university of agriculture
<120> detection reagent, kit and application thereof
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>1
atcaaccgag attcccccag t 21
<210>2
<211>21
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>2
tcactatcgg tcagtcagga g 21
<210>3
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>3
cgattgatgg tgatacggtt 20
<210>4
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>4
ctcttttttc gcttgtgctt 20
<210>5
<211>22
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>5
taaaggtgca actgcatcac ta 22
<210>6
<211>21
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>6
agtcacatgg tggattttcc a 21
<210>7
<211>17
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>7
taataatcaa gcccagc 17
<210>8
<211>17
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>8
ccttttgttc taatgcc 17
Claims (10)
1, detection reagents, characterized by comprising a combination of any or more of the following four primer pairs, said four primer pairs comprising:
the th primer pair comprises a th primer and a second primer with sequences shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively;
a second primer pair comprising primers having the sequences shown in SEQ ID NO: 3. SEQ ID NO: 4, a third primer and a fourth primer;
a third primer pair comprising primers with sequences as shown in SEQ ID NO: 5. SEQ ID NO: 6, a fifth primer and a sixth primer;
a fourth primer pair comprising primers with sequences as shown in SEQ ID NO: 7. SEQ ID NO: 8, and a seventh primer and an eighth primer shown in the figure.
2. The detection reagent according to claim 1, wherein the 5' -end of at least primers of at least primer pairs further comprises nucleic acid markers, each of which comprises of FITC, FAM, HEX, TET, TAMRA, ROX, VIC, NED, Alexa Flourr, biotin, digoxin, cy3 and cy 5.
3. The detection reagent according to claim 2, wherein the nucleic acid label is provided at the 5' -end of each of the two primers contained in the primer pair.
4. The detection reagent of in any of claims 1-3, further comprising a PCR routine component.
The kit of , comprising the detection reagent of of claims 1-4 and a nucleic acid immunochromatographic strip, wherein the nucleic acid immunochromatographic strip comprises a bottom plate, a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water absorption pad, and the nitrocellulose membrane is provided with a detection band and a quality control band.
6. The kit according to claim 5, wherein a complex formed by th antibody and colored particles is attached to the gold label pad, a second antibody is arranged on the detection band, and a third antibody is arranged on the quality control band, wherein the th antibody is an antibody of the nucleic acid marker, the second antibody is an antibody or a ligand of the acid marker, and the third antibody is an antibody capable of binding with an antibody derived from a specified species.
7. The kit of claim 6, wherein: the third antibody is goat anti-mouse polyclonal antibody, and the colored particles are spherical red colloidal gold particles marked by fluorescein isothiocyanate antibodies.
8. Use of the detection reagent according to in any of claims 1-4 or the kit according to in any of claims 5-7 for the preparation of a product for detecting a pathogenic bacterium.
A product for use in a method of detecting a pathogenic bacteria, wherein the product comprises a kit as claimed in any of claims 5 to 7 at , and wherein the method of detection comprises:
amplifying the nucleic acid extracted from the sample to be tested by a PCR amplification reaction using at least primer pairs among the four primer pairs,
dripping the amplified product onto the nucleic acid immunochromatographic test paper of the kit, and observing whether a colored band is formed on the detection band and the finger control band; if colored bands visible to naked eyes are formed on the detection band and the quality control band, the detection band and the quality control band are judged to be positive; if no colored band is formed on the detection band and a macroscopic colored band is formed on the quality control band, judging the detection band to be negative; and if no colored band is formed on the quality control band, judging that the band is invalid.
10. The product of claim 9, wherein the pathogenic bacteria comprise or more of Escherichia coli, Staphylococcus aureus, Streptococcus dysgalactiae and Streptococcus agalactiae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911086292.4A CN110734990A (en) | 2019-11-08 | 2019-11-08 | Detection reagent, kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911086292.4A CN110734990A (en) | 2019-11-08 | 2019-11-08 | Detection reagent, kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110734990A true CN110734990A (en) | 2020-01-31 |
Family
ID=69272542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911086292.4A Pending CN110734990A (en) | 2019-11-08 | 2019-11-08 | Detection reagent, kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110734990A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025733A (en) * | 2021-03-15 | 2021-06-25 | 北京华瑞康源生物科技发展有限公司 | Novel group B streptococcus nucleic acid PCR-colloidal gold immunochromatographic assay detection kit |
| CN113846174A (en) * | 2021-09-15 | 2021-12-28 | 北京源景泰科生物科技有限公司 | Kit and detection method for detecting clostridium difficile |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900306A (en) * | 2005-07-21 | 2007-01-24 | 崔玉东 | Multiple PCR detection reagent kit for pathogenic bacterium and its detecting method |
| CN102851390A (en) * | 2012-10-17 | 2013-01-02 | 西北农林科技大学 | Preparation method of milk goat mastitis pathogen multi-PCR (polymerase chain reaction) detection kit |
| CN103773849A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Preparation and applications of nucleic acid lateral flow test strip kit for detecting EHEC O157 |
| CN108977555A (en) * | 2018-03-20 | 2018-12-11 | 南京农业大学 | A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype |
| US10253376B2 (en) * | 2013-10-16 | 2019-04-09 | Wisconsin Alumni Research Foundation | DNA-based detection and identification of eight mastitis pathogens |
-
2019
- 2019-11-08 CN CN201911086292.4A patent/CN110734990A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900306A (en) * | 2005-07-21 | 2007-01-24 | 崔玉东 | Multiple PCR detection reagent kit for pathogenic bacterium and its detecting method |
| CN102851390A (en) * | 2012-10-17 | 2013-01-02 | 西北农林科技大学 | Preparation method of milk goat mastitis pathogen multi-PCR (polymerase chain reaction) detection kit |
| US10253376B2 (en) * | 2013-10-16 | 2019-04-09 | Wisconsin Alumni Research Foundation | DNA-based detection and identification of eight mastitis pathogens |
| CN103773849A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Preparation and applications of nucleic acid lateral flow test strip kit for detecting EHEC O157 |
| CN108977555A (en) * | 2018-03-20 | 2018-12-11 | 南京农业大学 | A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype |
Non-Patent Citations (3)
| Title |
|---|
| B CRESSIER等: "Assessment of an extraction protocol to detect the major mastitis-causing pathogens in bovine milk", 《RANDOMIZED CONTROLLED TRIAL》 * |
| 曾荣荣等: "双重PCR检测奶牛隐性乳房炎大肠杆菌与无乳链球菌方法的建立及应用", 《畜牧与兽医》 * |
| 阮智杨等: "奶牛乳房炎病原菌的分离鉴定及药物敏感试验", 《畜牧与兽医》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025733A (en) * | 2021-03-15 | 2021-06-25 | 北京华瑞康源生物科技发展有限公司 | Novel group B streptococcus nucleic acid PCR-colloidal gold immunochromatographic assay detection kit |
| CN113846174A (en) * | 2021-09-15 | 2021-12-28 | 北京源景泰科生物科技有限公司 | Kit and detection method for detecting clostridium difficile |
| CN113846174B (en) * | 2021-09-15 | 2024-06-11 | 北京源景泰科生物科技有限公司 | Kit and detection method for detecting clostridium difficile |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sajid et al. | Designs, formats and applications of lateral flow assay: A literature review | |
| Jiang et al. | Recombinase polymerase amplification-lateral flow (RPA-LF) assay combined with immunomagnetic separation for rapid visual detection of Vibrio parahaemolyticus in raw oysters | |
| CN106636387B (en) | Kit, test paper and detection method for rapid detection of salmonella nucleic acid | |
| JP5948056B2 (en) | Lateral flow nucleic acid detector | |
| CN111505275B (en) | Cas9 nucleic acid isothermal amplification-based immunochromatography multiple gene detection method | |
| JPH10508741A (en) | Amplification method for increasing sensitivity of nucleic acid-probe target hybrid detection | |
| CN105301237A (en) | Method for detecting nucleic acid by colloidal gold chromatography technology and reagent kit | |
| US20100279322A1 (en) | Direct detection of intracellular fluorescently tagged cells in solution | |
| CN109136408A (en) | Detection reagent, kit and its application of African swine fever virus | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN110218818B (en) | Dengue virus gene fragment SERS detection kit and preparation method thereof | |
| CN105018590A (en) | Detection kit capable of simultaneous detection of protein ligand and genes and application thereof | |
| Zeng et al. | Current and emerging technologies for rapid detection of pathogens | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| CN113406329A (en) | Universal aptamer colloidal gold lateral chromatography test paper for detecting small molecular substances | |
| CN110734990A (en) | Detection reagent, kit and application thereof | |
| CN113444773B (en) | Method and kit for detecting tick pathogen nucleic acid based on liquid chip | |
| Li et al. | Review in isothermal amplification technology in food microbiological detection | |
| Alsohaimi | Analytical detection methods for diagnosis of COVID-19: developed methods and their performance | |
| CN111521827A (en) | Immunofluorescence test strip for rapidly determining titer of monoclonal antibody based on antigen tracing | |
| CN108546779A (en) | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN114807397A (en) | Method for detecting salmonella and drug-resistant bacteria by non-amplification time-resolved fluorescence lateral chromatography detection | |
| CN103740803A (en) | Food borne pathogenic organism nucleic acid lateral flow test strip detection kit and application thereof | |
| CN112698036A (en) | Immune test paper strip for rapidly determining cross reaction of bacterial monoclonal antibody and determination method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200131 |