CN108977555A - A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype - Google Patents
A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype Download PDFInfo
- Publication number
- CN108977555A CN108977555A CN201810479077.XA CN201810479077A CN108977555A CN 108977555 A CN108977555 A CN 108977555A CN 201810479077 A CN201810479077 A CN 201810479077A CN 108977555 A CN108977555 A CN 108977555A
- Authority
- CN
- China
- Prior art keywords
- coli
- serotype
- fitc
- gold
- line
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides specific gene, detection method and the immuno-chromatographic test paper strip of a kind of fowl enteropathogenic E. Coli O78 serotype, and the specific gene segment APEC-O78-S of Escherichia coli O78 serotype of the present invention, sequence is as shown in SEQ ID NO:1.Specific gene segment of the present invention is 399bp；The present invention also provides the immune chromatography method of this genetic fragment of based on PCR and test strips and its application, the method for the invention and test strips can quicker, sensitive, easy, specifically detect fowl enteropathogenic E. Coli O78 serological type strain.
Description
Technical field
The invention belongs to molecular biology fields, and in particular to a kind of fowl enteropathogenic E. Coli O78 serotype it is special
Property gene, detection method and immuno-chromatographic test paper strip.
Background technique
Fowl enteropathogenic E. Coli (Avian pathogenic Escherichia coli, APEC) can cause chicken, fire
The multisystem mixed infection of chicken and other birds, such as pericarditis, perihepatitis, air bag are scorching, meningitis, in addition cause septicemia and
Acute death.Fowl enteropathogenic E. Coli can cause the meningitis of mammal by respiratory tract infection fowl, show that fowl is caused a disease
Property Escherichia coli are also the potential pathogens of Amphixenosis, cause potential threat to mankind's publilc health.
The serotype of fowl enteropathogenic E. Coli is numerous, the stronger serotype of the pathogenicity reported in the world mainly have O1,
O2 and O78, there are also O8, O145, O88, O20, O141 etc. for remaining serotype.Clinically the most common serotype is O78, right at present
The detection report of fowl enteropathogenic E. Coli O78 serological type strain is less, and time-consuming, and instrument and equipment is cumbersome, and sensitivity is low.
Therefore it realizes the quick detection to fowl enteropathogenic E. Coli O78 serotype, has to fowl enteropathogenic E. Coli clinical identification
Important meaning.
At present to the detection technique of Escherichia coli mainly include DNA probe technology, quantitative fluorescent PCR, biochip technology,
Enzyme linked immunosorbent assay analysis method (Enzyme Linked Immunosorbent Assay, ELISA) and fluorescence immunoassay
(Fluorescent Immunoassay, FIA) etc..Since these technologies need the operator of special instrument and equipment and profession
Member, it is more demanding to operating technology, it is time-consuming and laborious, it cannot be widely applied in the clinical diagnosis of common lab and base.It is poly-
The genetic test of polymerase chain reaction (PCR) is favored by people always, and PCR, which refers to, sets specific template DNA genetic fragment
The a bit of complementary oligonucleotide of meter, to simulate the natural reproduction process of DNA, specificity depends on the complementation of target sequence both ends
Oligonucleolide primers.By round pcr, whether can determine in a short period of time in measuring samples containing purpose product.But
The generally verifying of PCR product is all agarose gel electrophoresis, needs large-scale instrument, higher cost.
Summary of the invention
The purpose of the present invention is being directed to the deficiency and defect of existing detection fowl enteropathogenic E. Coli O78 serotype technology,
Shared specific gene, immune chromatography method and the examination of a kind of fowl enteropathogenic E. Coli O78 serotype of based on PCR are provided
Paper slip and its application, the method for the invention and test strips can quicker, sensitive, easy, specifically detect that fowl is caused a disease
Property Escherichia coli O78 serological type strain.The present invention can quickly detect the bacterial strain of fowl enteropathogenic E. Coli O78 serotype,
Have the characteristics that high sensitivity, reaction time are short, instrument and equipment is cheap, easy-to-use.
The specific gene segment that the method for the invention is shared for fowl enteropathogenic E. Coli O78 serological type strain is set
Primer is counted, carries out PCR amplification, and be used for quickly detecting using colloidal gold immuno-chromatography test paper strip method to amplified production.
Technical solution of the present invention:
The present invention provides a kind of fowl enteropathogenic E. Coli O78 serotype specific genes, sequence such as SEQ ID NO:4 institute
Show.The gene can be used for the specific detection of Escherichia coli O78 serotype.
The present invention also provides a kind of Escherichia coli O78 serotype specific genes segment APEC-O78-S, sequence such as SEQ
Shown in ID NO:1.Specific gene segment of the present invention is 399bp.The genetic fragment can be used for Escherichia coli O78 blood
The specific detection of clear type.
The present invention also provides the primers of specific amplification genetic fragment APEC-O78-S: SEQ ID NO:2/SEQ ID NO:
3。
It is pathogenic in detection fowl that the present invention also provides specific genes or specific gene segment APEC-O78-S or primer
Application in Escherichia coli O78 serotype.
It is including as follows the present invention also provides a kind of method of the detection fowl enteropathogenic E. Coli O78 serotype of based on PCR
Step:
1) genome for extracting strain to be tested, carries out for specific gene or genetic fragment APEC-O78-S design primer
PCR amplification, upstream primer and downstream primer used in PCR amplification are modified with FITC modification and digoxin respectively；
2) immunochromatography detection is carried out by the FITC monoclonal antibody of colloid gold label and digoxin monoclonal antibody.
PCR amplification in step 1) of the present invention specifically: the upstream primer and downstream modified respectively with FITC and digoxin are drawn
Object expands to obtain the DNA double chain product that both ends have FITC and digoxin, and the sequence of upstream primer and downstream primer is as follows:
Upstream primer sequence is 5'-CGGAAGATAATGAGTGGGT-3'(SEQ ID NO:2)；
Downstream primer sequence is 5'-GCAACATGGAGCTAATAAAA-3'(SEQ ID NO:3).
The upstream primer modified respectively with FITC and digoxin and downstream primer of the present invention can be to be repaired with FITC
The case where adoring upstream primer, digoxin modification downstream primer can also be that downstream primer, digoxin modification upstream are modified with FITC
The case where primer.
Further, the PCR amplification program are as follows:
Further, the PCR system: MgCl22.5 μ L, PCR Buffer, 2.5 μ L, 2.5mM dNTPs, 2 μ L, (purchase
From the raw work in Shanghai), the Taq archaeal dna polymerase (purchased from the raw work in Shanghai) of 0.5 unit, 2 μ L of DNA profiling takes upstream primer 1 respectively
1 μ L of μ L and downstream primer, adding aqua sterilisa to total volume is 25 μ L.
Further, it is magnetism that Escherichia coli O78 serological type strain genome method therefor is extracted in step 1) of the present invention
Nanoparticle (MNPs) extracts, and the DNA concentration extracted in this way is high, can be further improved the sensitivity of detection.
The present invention also provides a kind of sides of the detection fowl enteropathogenic E. Coli O78 serotype of more specifically based on PCR
Method will carry out PCR amplification, institute by extracted genomic DNA from fowl enteropathogenic E. Coli O78 serological type strain CVCC1553
The PCR product obtained carries out test strips detection.Specifically includes the following steps: the extraction of (1) genomic DNA；(2) with modification FITC's
The downstream primer of upstream primer and modification digoxin carries out PCR；(4) preparation of colloidal gold and the preparation of gold labeling antibody；(5) colloid
The preparation of gold test paper strip；(6) the test strips detection of target gene.
The present invention also provides a kind of immune chromatography test papers of the detection fowl enteropathogenic E. Coli O78 serotype of based on PCR
Item, the test strips include liner plate and the sample pad being successively connected on liner plate, gold-labelled pad, coated film and water absorption pad, the gold
FITC monoclonal antibody containing colloid gold label on mark pad, the coated film are equipped with the inspection printed with digoxin monoclonal antibody
Survey line T line and the control line C line printed with secondary antibody.
Further, liner plate of the present invention can be the hard plastic item or cardboard item not absorbed water.
Further, sample pad of the present invention is glass fibre cotton, nylon membrane, PVDF membrane or polyester
Film.
Further, coated film of the present invention is nitrocellulose filter (NC film), pure cellulose film or carboxylation fiber
Plain film.
Further, water absorption pad of the present invention is absorbent filter or filter paper for oil.
Further, the linear stealthy detection line that useful digoxin monoclonal antibody is printed on coated film of the present invention
T line, the linear stealthy control line C line printed with secondary antibody, two lines are arranged in parallel.Printing secondary antibody used in C line can be sheep
The common antibody such as anti-mouse secondary antibody.
Further, invention additionally discloses a kind of preparation method of gold-labelled pad, with trisodium citrate reducing agent by gold chloride
Colloidal gold (AuNPs) solution is made in reduction, then it is made to the FITC antibody-solutions of colloid gold label with FITC antibody coupling, then
The FITC antibody-solutions of the colloid gold label are added on glass fibre element film, the FITC for obtaining being coated with colloid gold label is anti-
The gold-labelled pad of body.
Further, the concentration of the FITC antibody-solutions of colloid gold label of the present invention is preferably 0.5-2mg/mL.It is low
In this concentration, the reduction of colloidal gold strip stability will lead to；Higher than this concentration, the sensitivity drop of colloidal gold strip will lead to
It is low.
Further, colloidal gold partial size is 20-40nm in the colloidal gold solution, and in this particle size range, colloidal gold is molten
The stability of liquid is preferable.
Further, the preparation method of the detection line T on the coated film and control line C, DigiTAb solution is sprayed
It is loaded in the T line of coated film, two corresponding anti-solution spray is loaded on the C line of coated film, the coating containing detection line T and control line C is formed
Film.
Further, the concentration of the DigiTAb solution is preferably 0.5-2mg/mL.Concentration is lower than this range, can lead
Colloidal gold strip stability is caused to reduce；Concentration is higher than this range, can reduce the sensitivity of colloidal gold strip.
Further, the concentration of the two corresponding anti-solution is preferred 0.5-2mg/mL.Concentration is lower than this range, will lead to colloid
Gold test paper strip stability reduces；Concentration is higher than this range, can reduce the sensitivity of colloidal gold strip.
The method of the invention is specifically based on PCR immuno-chromatographic test paper strip detection reaction principle:
The present invention first uses round pcr, is designed according to fowl enteropathogenic E. Coli O78 serotype specific genes a pair of special
Specific primer, upstream and downstream primer use FITC and digoxigenin labeled respectively.Both ends are obtained with FITC and digoxin through PCR amplification
DNA double chain product.
After PCR product is added dropwise in the sample pad in test strips, sample solution acts on swimming by chromatography along test strips,
Gold labeling antibody dry in gold-labelled pad is dissolved, if there are target gene in sample to be tested, gold labeling antibody first can be molten with sample
FITC in liquid in detectable substance reacts, then the DigiTAb in direct swimming to detection line and coated film reacts,
To which colloid gold particle is assembled, red lines are formed, then other unbonded gold labeling antibodies continue through chromatography and make
Occur second with the sheep anti mouse secondary antibody in swimming, with control line forward to be immunoreacted, be similarly formed red lines, is coated in this way
Two red lines are just had on film, indicate that sample is the positive.If target gene is not present in sample to be tested, prepare liquid can be first
Gold labeling antibody is dissolved, is then acted on along test strips by chromatography and is sent out in direct swimming to control line with sheep anti mouse secondary antibody together again
Raw immune response forms red lines.Control line is to examine whether gold-marking immunity chromatography method itself effectively sets, institute
No matter whether there is target gene to be measured in sample, control line should all develop the color.If control line does not develop the color, illustrate test paper
Item failure.
The present invention also provides the specific detection methods of above-mentioned test strips, by sample to be tested, such as the PCR product drop in the present invention
In in sample pad, after 10~20min, observation test strips show line situation to determine testing result；If only having C line on coated film
One red line shows, and indicates that testing result is feminine gender；If two red lines of C line and T line all show on coated film, detection is indicated
It as a result is the positive；If C line red line does not show on coated film, show that test strips have failed.
More specifically, the test strips detection of PCR product of the present invention: PCR product phosphate buffer (PB) is taken
Different multiples loading is diluted, prepare liquid will be acted on by chromatography to be flowed through from test strips, after reacting at room temperature 10~20min
Observe result.
Beneficial effects of the present invention are mainly:
(1) high sensitivity: round pcr is on the one hand used, the seldom target gene of quantity is increased with exponential, is obtained
A large amount of purpose product greatly improves sensitivity, while specificity has also reached 100%；On the other hand will with FITC and
The resulting PCR product of primer of digoxin modification detects in conjunction with test strips, and improves sensitivity, and detection of the invention is sensitive
Degree can reach 1 × 104CFU/mL。
(2) specificity is good: the specificity of primer determines the specificity of target product during PCR amplification；PCR is produced simultaneously
Object is the specific recognition of antigen-antibody, specificity with higher in conjunction with test strips.
(3) cheap: preparing tool using PCR instrument and simple test strips can be completed experiment, easy to operate, as a result
It is easy to observe while improves detection efficiency.
(4) be suitable for on-site test: clinically the most common fowl enteropathogenic E. Coli serotype is O78, is examined at present to it
The report of survey is seldom, and the report for being used for field quick detection is less, so having to the detection of this fowl enteropathogenic E. Coli
Important meaning.
Detailed description of the invention
Fig. 1 is the schematic diagram of colloidal gold strip；
Fig. 2 is the test strips result figure of the PCR product of various concentration bacterium solution；
Fig. 3 is the specific outcome figure of colloidal gold strip.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.
The confirmation of 1 fowl enteropathogenic E. Coli O78 serotype specific genes segment APEC-O78-S of embodiment
Fowl enteropathogenic E. Coli O78 serological type strain CVCC1553 is subjected to genome sequencing, and by CVCC1553
Another plant of fowl enteropathogenic E. Coli O78 serological type strain Escherichia coli APEC O78 announced with NCBI
(GenBank:CP004009.1) other more than 200 plants of Escherichia coli full-length genome sequences that whole genome sequence and NCBI has been announced
Column compare, and filter out a fowl enteropathogenic E. Coli O78 serotype specific genes, sequence are as follows:
ATGTGTTTTTTTATTTTGTTCGATGGTAAGGGGTATAAAGTTGATTCTATCGGTGAGCTTGTGAAATACTTTAGACA
GGCCACTAGGATTGATCAAATAAATTTTACTATTGAAACTTATCAAAGTCGACAGTCTAACAGGATGAATGGATCTT
GGATGGAGCTACGAATTGATGAGAGGAATTCAAATAGCAGCACAATGATTGTAGCATCGGAAGATAATGAGTGGGTT
GACTCGTTATGGATTACGATTCAGGATTTACTTAACAAGTGCAAAAATAAATTTAGATTTTTTAGAACAGCTTGGAC
TATGTTAAGTATCCAGATTTCAGGTGTGACAGTTGGCTTTTTGCTTAGCTTATGGACAGCCTCAAAACTGGCGCCAA
AACTATCAATCGATGGTGCATTTGCTTTATCATTTATTTGTATCTTTATTTTGTTTTCGAACTTATGGAGCTTTGCT
ATTCCATTAATAATTAAGCTTATCGACTTTTTGTTTCCTAGTGTTAAGTTTGTTATTAATGGTAAAAATTACTTTCA
CTGGAGTGTCCAGGCTATAATTGGAGCGATTGCCAGTGCGGTTATATTGTATTTTATTAGCTCCATGTTGCTTTTTG
CATTAGAAATGTTAAATAGCATCATTAAGAAATAG (SEQ ID NO:4).(drawn upstream according to this section of gene design primer
Object sequence is 5'-CGGAAGATAATGAGTGGGT-3'(SEQ ID NO:2)；Downstream primer sequence is 5'-
GCAACATGGAGCTAATAAAA-3'(SEQ ID NO:3), the genetic fragment APEC-O78-S size of specific amplification is
399bp。
Pcr template includes following bacterial strain (bacterial strain is purchased from Chinese veterinary microorganism culture presevation administrative center):
Fowl enteropathogenic E. Coli O78 serological type strain: CVCC1553, CVCC1418, CVCC1556, CVCC1490,
CVCC1564,CVCC1569；
Fowl enteropathogenic E. Coli O1 serological type strain: CVCC249；
Fowl enteropathogenic E. Coli O2 serological type strain: CVCC244, CVCC251；
Fowl enteropathogenic E. Coli O8 serological type strain: CVCC1551；
Fowl enteropathogenic E. Coli O157 serological type strain: CVCC248；
Escherichia coli O149 serological type strain: CVCC1500；
Escherichia coli O141 serological type strain: CVCC1498；
Salmonella: CVCC79201, CVCC79207, CVCC79500；
Staphylococcus aureus: CVCC2253, CVCC546；
DNA is extracted to above-mentioned bacterial strains, carries out PCR detection, PCR reaction system are as follows: MgCl22.5 μ L, PCR Buffer
2.5 μ L, 2.5mM dNTPs, 2 μ L, the Taq archaeal dna polymerase of 0.5 unit, 2 μ L of DNA profiling, 1 μ L of upstream primer, downstream is drawn
1 μ L of object, adding aqua sterilisa to total volume is 25 μ L.
PCR amplification program are as follows:
Agarose gel electrophoresis results show, fowl enteropathogenic E. Coli O78 serological type strain (CVCC1553,
CVCC1418, CVCC1556, CVCC1490, CVCC1564, CVCC1569) on there is positive band, other bacterial strain amplifications
It is feminine gender.Therefore determine that APEC-O78-S is the specific gene segment of fowl enteropathogenic E. Coli O78 serotype.
The preparation of embodiment 2, PCR product to be checked
1, magnetic nano-particle (MNPs) extracts genomic DNA
Take the bacterium solution of 1mL fowl enteropathogenic E. Coli O78 serotype reference culture CVCC1553 in EP pipe, 8500 × g,
5min centrifugation, removes supernatant, is added 1mL lysate, 70 DEG C of incubations 10min lytic cells, adds 20mg/mL, 20 μ LMNPs with
Adsorption-buffering liquid NaCl/PEG makes the final concentration of 2mol/L of NaCl, mixes 10min, and Magnetic Isolation removes supernatant；Add elution
The ethyl alcohol of liquid 70% cleans, and precipitating is finally dissolved in TE buffer, 65 DEG C of incubation 10min, supernatant is DNA solution, in -20 DEG C
It saves backup.
2, PCR is carried out with the downstream primer of the upstream primer of modification FITC and modification digoxin
PCR amplification is carried out using the primer of modified, then pcr amplification product is used for the detection of immuno-chromatographic test paper strip；
The PCR amplification FITC upstream primer modified and the downstream primer of digoxin modification expand to obtain both ends with FITC
With the DNA double chain product of digoxin, the sequence of upstream primer and downstream primer is as follows:
Upstream primer sequence is 5'-CGGAAGATAATGAGTGGGT-3'(SEQ ID NO:2)；
Downstream primer sequence is 5'-GCAACATGGAGCTAATAAAA-3'(SEQ ID NO:3).
PCR method expands its specific targets band, size 399bp.
PCR amplification program are as follows:
PCR system: MgCl22.5 μ L, PCR Buffer, 2.5 μ L, 2.5mM dNTPs, 2 μ L, (purchased from the raw work in Shanghai),
The Taq archaeal dna polymerase (purchased from the raw work in Shanghai) of 0.5 unit, 2 μ L of DNA profiling takes 1 μ L of upstream primer and downstream primer respectively
1 μ L, adding aqua sterilisa to total volume is 25 μ L.
Embodiment 3, detect fowl enteropathogenic E. Coli O78 serological type strain colloidal gold strip preparation
1, the preparation of colloidal gold and the preparation of gold labeling antibody
Gold chloride reduction is made colloidal gold (AuNPs) solution of 20nm-40nm with trisodium citrate reducing agent, then by its
Gold labeling antibody is made with FITC antibody coupling.Coupling process are as follows: take 1mL AuNPs, be added 0.1mol/L potassium carbonate adjust pH to
Alkalinity adds 1mg/mL 2-10 μ L FITC antibody incubation 1h, and BSA or gelatin etc. is added and closes 30min, and supernatant is removed in centrifugation,
Precipitating, which is redissolved, to be dried for standby in 100 μ L re-suspension liquids, then with each 4-6 μ L drop in 37 DEG C in gold-labelled pad.
2, the preparation of colloidal gold immuno-chromatography test paper strip
It prepares the NC film of sheep anti mouse secondary antibody and DigiTAb: the DigiTAb spray of 1mg/mL being loaded in NC with spray film instrument
The secondary antibody spray of the T line and 1mg/mL of film is loaded on the C line of NC film, and 37 DEG C of oven drying 10min are spare.By sample after to be dried
Product pad, gold-labelled pad, NC film and water absorption pad are successively adhered on liner plate by one end, as shown in Figure 1 to get to for immune detection
The colloidal gold chromatographic test strip of fowl enteropathogenic E. Coli O78 serotype gene.
3, the colloidal gold strip detection method of CVCC1553 gene
Drop is in sample pad after taking PCR product PB buffer to dilute 100 times, and after about 10~20min, observation test strips are aobvious
Line situation determines testing result.If only having one red line of C line on NC film to show, indicate that testing result is feminine gender, explanation
Fowl enteropathogenic E. Coli O78 serotype CVCC1553 target gene is not contained in sample to be tested；If on NC film C line and
Two red lines of T line all show, and indicate that testing result is the positive, illustrate to contain fowl enteropathogenic E. Coli O78 in sample to be tested
Serotype CVCC1553 target gene；If C line red line does not show on NC film, show that test strips have failed.When in sample
When product of the various concentration bacterium solution after PCR amplification being added dropwise on pad, different degrees of red lines are shown on T line, and be in
Reveal certain trend.As a result see Fig. 2, most low energy detects 104CFU/mL bacterium solution.
The specific test of embodiment 4, colloidal gold strip
Bacterium solution to be measured is subjected to DNA extraction, will be added dropwise after 100 times of PCR product dilutions after PCR and prepared in above-described embodiment 3
In the sample pad of good colloidal gold strip, result is determined in 10~20 minutes.
Above-mentioned bacterium solution to be measured is respectively fowl enteropathogenic E. Coli O78 serological type strain CVCC1553, the pathogenic large intestine of fowl
Bacillus O1 serological type strain CVCC249, fowl enteropathogenic E. Coli O2 serological type strain CVCC251, fowl enteropathogenic E. Coli
O8 serological type strain CVCC1551, fowl enteropathogenic E. Coli O157 serological type strain CVCC248, O141 serotype Escherichia coli
CVCC1498, O149 serotype Escherichia coli CVCC1500, salmonella CVCC79201, staphylococcus aureus CVCC2253.
Judged according to the colour developing situation of T line and C line: T line and C line develop the color, and are determined as fowl enteropathogenic E. Coli
O78 serotype is positive；C line colour developing T line does not develop the color, and is determined as that fowl enteropathogenic E. Coli O78 serotype is negative；C line does not develop the color,
No matter whether T line develops the color, and is judged to detecting failure.
As a result as shown in figure 3, top is C line, lower section is T line, and the sample to be tested bacterial strain being successively added dropwise from left to right is
CVCC1553、CVCC249、CVCC251、CVCC1551、CVCC248、CVCC1498、CVCC1500、CVCC79201、
CVCC2253.The result shows that other bacterial strains are equal other than fowl enteropathogenic E. Coli O78 serological type strain CVCC1553 is positive
For feminine gender, show that method specificity of the invention is good.
Sequence table
<110>Agricultural University Of Nanjing
<120>a kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 399
<212> DNA
<213>Escherichia coli O78 serotype (Avian Pathogenic Escherichia coli Serotype O78)
<400> 1
cggaagataa tgagtgggtt gactcgttat ggattacgat tcaggattta cttaacaagt 60
gcaaaaataa atttagattt tttagaacag cttggactat gttaagtatc cagatttcag 120
gtgtgacagt tggctttttg cttagcttat ggacagcctc aaaactggcg ccaaaactat 180
caatcgatgg tgcatttgct ttatcattta tttgtatctt tattttgttt tcgaacttat 240
ggagctttgc tattccatta ataattaagc ttatcgactt tttgtttcct agtgttaagt 300
ttgttattaa tggtaaaaat tactttcact ggagtgtcca ggctataatt ggagcgattg 360
ccagtgcggt tatattgtat tttattagct ccatgttgc 399
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cggaagataa tgagtgggt 19
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gcaacatgga gctaataaaa 20
<210> 4
<211> 651
<212> DNA
<213>Escherichia coli O78 serotype (Avian Pathogenic Escherichia coli Serotype O78)
<400> 4
atgtgttttt ttattttgtt cgatggtaag gggtataaag ttgattctat cggtgagctt 60
gtgaaatact ttagacaggc cactaggatt gatcaaataa attttactat tgaaacttat 120
caaagtcgac agtctaacag gatgaatgga tcttggatgg agctacgaat tgatgagagg 180
aattcaaata gcagcacaat gattgtagca tcggaagata atgagtgggt tgactcgtta 240
tggattacga ttcaggattt acttaacaag tgcaaaaata aatttagatt ttttagaaca 300
gcttggacta tgttaagtat ccagatttca ggtgtgacag ttggcttttt gcttagctta 360
tggacagcct caaaactggc gccaaaacta tcaatcgatg gtgcatttgc tttatcattt 420
atttgtatct ttattttgtt ttcgaactta tggagctttg ctattccatt aataattaag 480
cttatcgact ttttgtttcc tagtgttaag tttgttatta atggtaaaaa ttactttcac 540
tggagtgtcc aggctataat tggagcgatt gccagtgcgg ttatattgta ttttattagc 600
tccatgttgc tttttgcatt agaaatgtta aatagcatca ttaagaaata g 651
Claims (10)
1. a kind of fowl enteropathogenic E. Coli O78 serotype specific genes or specific gene segment APEC-O78-S, wherein
Specific gene sequences are as shown in SEQ ID NO:4, specific gene segment APEC-O78-S sequence such as SEQ ID NO:1 institute
Show.
2. expanding the primer of specific gene segment APEC-O78-S described in claim 1: SEQ ID NO:2/SEQ ID NO:
3。
3. specific gene described in claim 1 or specific gene segment APEC-O78-S or as claimed in claim 2 draw
Application of the object in detection fowl enteropathogenic E. Coli O78 serotype.
4. a kind of method of the detection fowl enteropathogenic E. Coli O78 serotype of based on PCR, it is characterised in that including walking as follows
It is rapid:
1) genome for extracting strain to be tested carries out PCR for specific gene or genetic fragment APEC-O78-S design primer
It expands, upstream primer used in PCR amplification and downstream primer are modified with FITC modification and digoxin respectively；
2) immunochromatography detection is carried out by the FITC monoclonal antibody of colloid gold label and digoxin monoclonal antibody.
5. according to the method described in claim 4, it is characterized in that PCR amplification in step 1) specifically: use FITC and digoxin
The upstream primer and downstream primer modified respectively expand to obtain the DNA double chain product that both ends have FITC and digoxin, and upstream is drawn
Object sequence is as shown in SEQ ID NO:2, and downstream primer sequence is as shown in SEQ ID NO:3.
6. according to the method described in claim 4, it is characterized in that extracting Escherichia coli O78 serological type strain gene in step 1)
Group method therefor is magnetic nano-particle extraction.
7. a kind of immuno-chromatographic test paper strip of the detection fowl enteropathogenic E. Coli O78 serotype of based on PCR, it is characterised in that packet
Sample pad, gold-labelled pad, coated film and the water absorption pad for including liner plate and being successively connected on liner plate, mark containing colloidal gold in the gold-labelled pad
The FITC monoclonal antibody of note, the coated film are equipped with the detection line T line printed with digoxin monoclonal antibody and use secondary antibody
The control line C line of printing.
8. test strips according to claim 7, it is characterised in that the liner plate is the hard plastic item not absorbed water or hard
Paper slip；The sample pad is glass fibre cotton, nylon membrane, PVDF membrane or polyester film；The coated film is nitre
Acid cellulose film, pure cellulose film or carboxylated cellulose film；The water absorption pad is absorbent filter or filter paper for oil.
9. test strips according to claim 7, it is characterised in that the gold-labelled pad the preparation method comprises the following steps: using trisodium citrate
Colloidal gold solution is made in gold chloride reduction by reducing agent, then it is made to the FITC antibody of colloid gold label with FITC antibody coupling
Solution, then the FITC antibody-solutions of the colloid gold label are added on glass fibre element film, it obtains being coated with colloid gold label
FITC antibody gold-labelled pad；The concentration of the FITC antibody-solutions of the colloid gold label is preferably 0.5-2mg/mL；The glue
Colloidal gold partial size is preferably 20-40nm in body gold solution.
10. test strips according to claim 7, it is characterised in that the system of detection line T and control line C on the coated film
The spray of DigiTAb solution is loaded in the T line of coated film by Preparation Method, two corresponding anti-solution spray is loaded on the C line of coated film, formation contains
There are the coated film of detection line T and control line C；The concentration of the DigiTAb solution is preferably 0.5-2mg/mL；The secondary antibody
The concentration of solution is preferably 0.5-2mg/mL.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810228298 | 2018-03-20 | ||
| CN201810228298X | 2018-03-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108977555A true CN108977555A (en) | 2018-12-11 |
| CN108977555B CN108977555B (en) | 2019-07-02 |
Family
ID=64542044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810479077.XA Active CN108977555B (en) | 2018-03-20 | 2018-05-18 | A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108977555B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734990A (en) * | 2019-11-08 | 2020-01-31 | 南京农业大学 | Detection reagent, kit and application thereof |
| CN110927386A (en) * | 2019-11-05 | 2020-03-27 | 北京科跃中楷生物技术有限公司 | C-reactive protein colloidal gold detection reagent card and preparation method thereof |
| CN112646900A (en) * | 2020-12-18 | 2021-04-13 | 北京华瑞康源生物科技发展有限公司 | Group B streptococcus nucleic acid colloidal gold immunochromatographic assay detection primer and kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1390949A (en) * | 2002-06-25 | 2003-01-15 | 上海晶泰生物技术有限公司 | Reagent kit for detecting different microbes with colloidal gold by one step |
| CN103305627A (en) * | 2013-07-16 | 2013-09-18 | 中国农业科学院上海兽医研究所 | Escherichia coli O1, O2, O18 and O78 serotype detection kit and detection method thereof |
| CN103773849A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Preparation and applications of nucleic acid lateral flow test strip kit for detecting EHEC O157 |
| CN104946782A (en) * | 2015-07-20 | 2015-09-30 | 青岛康伦生物科技有限公司 | Dual Tem-PCR quick detection method for salmonella and escherichia coli O78 |
-
2018
- 2018-05-18 CN CN201810479077.XA patent/CN108977555B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1390949A (en) * | 2002-06-25 | 2003-01-15 | 上海晶泰生物技术有限公司 | Reagent kit for detecting different microbes with colloidal gold by one step |
| CN103305627A (en) * | 2013-07-16 | 2013-09-18 | 中国农业科学院上海兽医研究所 | Escherichia coli O1, O2, O18 and O78 serotype detection kit and detection method thereof |
| CN103773849A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Preparation and applications of nucleic acid lateral flow test strip kit for detecting EHEC O157 |
| CN104946782A (en) * | 2015-07-20 | 2015-09-30 | 青岛康伦生物科技有限公司 | Dual Tem-PCR quick detection method for salmonella and escherichia coli O78 |
Non-Patent Citations (2)
| Title |
|---|
| DERAKHSHANDEH A等: "Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran", 《LETT APPL MICROBIOL》 * |
| 王静等: "用PCR-ICT方法检测肠出血性大肠杆菌O157", 《卫生研究》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110927386A (en) * | 2019-11-05 | 2020-03-27 | 北京科跃中楷生物技术有限公司 | C-reactive protein colloidal gold detection reagent card and preparation method thereof |
| CN110927386B (en) * | 2019-11-05 | 2022-12-13 | 北京科跃中楷生物技术有限公司 | C-reactive protein colloidal gold detection reagent card and preparation method thereof |
| CN110734990A (en) * | 2019-11-08 | 2020-01-31 | 南京农业大学 | Detection reagent, kit and application thereof |
| CN112646900A (en) * | 2020-12-18 | 2021-04-13 | 北京华瑞康源生物科技发展有限公司 | Group B streptococcus nucleic acid colloidal gold immunochromatographic assay detection primer and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108977555B (en) | 2019-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Martins et al. | Biosensors for on-farm diagnosis of mastitis | |
| CN108977555B (en) | A kind of specific gene, detection method and the immuno-chromatographic test paper strip of fowl enteropathogenic E. Coli O78 serotype | |
| CN106636387B (en) | Kit, test paper and detection method for rapid detection of salmonella nucleic acid | |
| Du et al. | Application of biosensors to detection of epidemic diseases in animals | |
| CN107340389B (en) | Method based on nucleic acid chromatography biosensor technique detection salmonella | |
| CN102483412B (en) | Direct fluorescene immunoassay for viral antigens | |
| Li et al. | Rapid detection of Brucella spp. and elimination of carryover using multiple cross displacement amplification coupled with nanoparticles-based lateral flow biosensor | |
| CN103667251B (en) | A kind of method of high throughput testing food-borne pathogens | |
| CN107419007A (en) | Method based on nucleic acid chromatography biosensor technique detection staphylococcus aureus | |
| CN107385019A (en) | Method based on biosensor technique detection Listeria Monocytogenes | |
| CN107338291A (en) | Method based on nucleic acid chromatography biosensor technique detection Escherichia coli O 157 | |
| Wang et al. | A strip of lateral flow gene assay using gold nanoparticles for point-of-care diagnosis of African swine fever virus in limited environment | |
| CN107340390A (en) | Method based on nucleic acid chromatography biosensor technique detection C.perfringens | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| Wang et al. | Development of a CRISPR/Cas9-integrated lateral flow strip for rapid and accurate detection of Salmonella | |
| CN114517236A (en) | PCR primer, kit and detection method for detecting klebsiella pneumoniae | |
| CN109112186A (en) | The methods intersected amplification and combine nano biological sensor detection Leptospira more | |
| CN107759674A (en) | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| CN107312873A (en) | A kind of multiple liquid phase genetic chip detection primer, kit and method of 5 kinds of Respiratory Tract of Mice cause of diseases of quick differentiation | |
| Huo et al. | A novel lateral flow assay for rapid and sensitive nucleic acid detection of Avibacterium paragallinarum | |
| CN108663513A (en) | A method of reducing Sidestream chromatography test paper detection limit | |
| CN103060447B (en) | Triple real-time fluorescent PCR testing primers of four kinds of bacterium, probe, detection kit and detection method | |
| Carter et al. | Rapid, multiplexed characterization of Shiga toxin-producing Escherichia coli (STEC) isolates using suspension array technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |