CN106319091A - Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus) - Google Patents
Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus) Download PDFInfo
- Publication number
- CN106319091A CN106319091A CN201610773297.4A CN201610773297A CN106319091A CN 106319091 A CN106319091 A CN 106319091A CN 201610773297 A CN201610773297 A CN 201610773297A CN 106319091 A CN106319091 A CN 106319091A
- Authority
- CN
- China
- Prior art keywords
- primer
- fluorescence
- seq
- canine
- beads
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus). The operation is simple, a target amplified fragment is obtained through a PCR (polymerase chain reaction), then an amplification product, fluorescence coded microspheres and streptavidin-phycoerythrin are hybridized, the MFI (mean fluorescence intensity) value is read through a detector, and different types of pathogens are distinguished. The method can be used for detecting and distinguishing the CDV, CPV and RV simultaneously, has the advantages of high specificity, high sensitivity, good repeatability and the like and can realize simultaneous detection of various different target molecules in the same sample. The method is good in flexibility, and the type of detected pathogens can be increased or decreased on the basis as required.
Description
Technical field
The invention belongs to support the Pathogen test field of dog industry, be specifically related to a kind of detection canine distemper virus, Canine Parvovirus and
The multi-fluorescence immune analysis method of rabies virus.
Background technology
Canine distemper virus (Canine distemper virus, CDV), Canine Parvovirus (Canine parvovirus,
CPV), rabies virus (Rabies virus, RV) be canine viral outbreaks of infectious diseases and popular several important pathogen bodies, this
Three kinds of virus is single or after mixed infection, clinical fatality rate is up to 50% ~ 100%, and provisions dog industry causes serious economic loss.CDV
Infect the hundstaupe caused and mainly have breathing pattern, digestion type, nervous system type and mixed type 4 kinds, exempting from of infection animal general can be caused
Epidemic disease suppresses, and case fatality rate is high.The symptom that single CPV infection body causes is relatively light, works in coordination with mixed infection with other viruses, antibacterial,
The clinical symptoms caused clearly, mainly causes dog acute hemorrhagic gastroenteritis and pup acute myocarditis.RV is that people beast is total to
Suffering from the rabic pathogen of infectious disease, it infects harm central nervous system, and case fatality rate is almost 100%, there is no so far effectively
Medicine, be the acute infectious disease that mankind's case fatality rate is the highest up to now.
At present the methods for clinical diagnosis of CDV, CPV, RV is mainly taked serological method, as quick in ELISA, gold colloidal
Test strip etc., but non-specific cross-reaction and affect the accuracy of diagnostic result, and the sensitivity of the method is not
Enough height.Along with the development of molecular biology, establish the detection methods such as PCR/ multiplex PCR, quantitative fluorescent PCR the most both at home and abroad.
The advantage that though round pcr has high specificity, sensitivity is high, result judges to need electrophoresis, wastes time and energy, and product
Easily produce and pollute and cause false positive.Fluorescent quantitative PCR technique has merged the multiple advantage of PCR, has higher sensitivity
With specificity and substantially reduce the detection time.Set up double or triple fluorescent quantitative PCR method is more complicated, except to examination
Agent, primer have outside particular/special requirement, also require that instrument has multiple sense channel simultaneously, considerably increase experiment difficulty, and the most not
Can meet that sample is more but sample size less detection demand.At present, there is not yet application Multiple immunizations fluorescence analysis method pair
Canine distemper virus, Canine Parvovirus, rabies virus carry out the relevant report detected.
Summary of the invention
It is an object of the invention to provide the multiple glimmering of a kind of quick differentiation canine distemper virus, Canine Parvovirus and rabies virus
Light immunoassay primer.
Another object of the present invention is to provide a kind of quick differentiation canine distemper virus, Canine Parvovirus and rabies virus many
Weight fluorescence immunoassay kit.
It is still another object of the present invention to provide a kind of quick differentiation canine distemper virus, Canine Parvovirus and rabies virus many
Weight fluorescence immune analysis method.
The technical solution used in the present invention is:
A kind of multi-fluorescence immunoassay primer of quick differentiation canine distemper virus, Canine Parvovirus and rabies virus, described primer
Nucleotide sequence is as follows:
Primer CDV1:AACAGATGGGTGAAACAGCA(SEQ ID NO:1),
Primer CDV2:GCATAACTCCAGAGCAATGGGTAG(SEQ ID NO:2)；
Primer CPV1:CAAGATAAAAGACGTGGTGTAACTC(SEQ ID NO:3),
Primer CPV2:TTGTGTAGACGCCTCAAAAGAATAA(SEQ ID NO:4)；
Primer RV1:CAGGACTGGTATCATTTACTGGGTT (SEQ ID NO:5),
Primer RV2:GAAGTGGATGAAATAAGAGTGAGG (SEQ ID NO:6).
Further, 5 ' ends of a described primer CDV1 and CDV2 wherein primer are biotinylated；
5 ' ends of a described primer CPV1 and CPV2 wherein primer are biotinylated；
5 ' ends of a described primer RV1 and RV2 wherein primer are biotinylated.
Further, the primer not being biotinylated in described primer CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2
5 ' end connections have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in anti-tag complementary pairing.
Further, the tag that described primer CDV1 and CDV2, these 3 groups of primer centerings of CPV1 and CPV2, RV1 and RV2 connect
Sequence is selected from the tag sequence shown in SEQ ID NO:7 ~ 9, and the tag sequence that these 3 groups of primer centerings connect is different.
A kind of quick differentiation canine distemper virus, Canine Parvovirus and the multi-fluorescence immunoassay kits of rabies virus, should
Containing any of the above-described described primer in test kit.
Further, possibly together with SA-PE complex, 3 kinds of different iridescent of coding in this test kit
Fluorescence-encoded micro-beads.
Further, possibly together with the anti-tag sequence matched with tag complementary in primer in described fluorescence-encoded micro-beads
Row, the anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding is different.
A kind of quick differentiation canine distemper virus, Canine Parvovirus and the multi-fluorescence immune analysis method of rabies virus, including
Following steps:
1) from sample, viral nucleic acid is extracted；
2) with the viral nucleic acid that extracts as template, PCR amplification is carried out with any of the above-described described primer；
3) upper step amplified production, 3 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization；
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its cause of disease；
Said method is used for diagnosis and the treatment of non-diseases.
Further, step 2) in PCR amplification reaction system be:
5×One-step RT-PCR buffer 5µL
dNTP 1µL
Primer mixed liquor 4 L
Enzyme 1 L
Template 2 L
ddH2O 12µL
Total 25µL；
Further, step 2) in PCR amplification response procedures be: 50 DEG C of reverse transcription 30min；95 DEG C of denaturations 15min；95℃
Degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C extend 20s；Circulate 35 times；72 DEG C extend 10min eventually.
Further, reaction system and the program of hybridization described in step 3) is:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L；Hatch 30min for 45 DEG C.
The invention has the beneficial effects as follows:
1) present invention achieves and detect canine distemper virus, Canine Parvovirus and rabies virus simultaneously, the present invention passes through RT-
PCR obtains target amplification fragment, then amplified production, fluorescence-encoded micro-beads and SA-PE (SAPE) is carried out
Hybridization, when then reading MFI value by detector, offers an explanation different types of cause of disease.
2) canine distemper virus, Canine Parvovirus and rabies virus can accurately be detected by the inventive method simultaneously, and
High specificity, highly sensitive, reproducible.Compared with traditional detection method, the inventive method achieves in same sample
Multiple different molecules of interest detects simultaneously, and sample consumption is few, simple to operate, quick, can be substantially reduced testing cost.This
Bright can guarantee that identical renaturation temperature and hybridization efficiency, and be prevented effectively from crisscrossing between the microsphere of different testing sample labelling.
Accompanying drawing explanation
Fig. 1 is canine distemper virus, Canine Parvovirus and the electrophoretogram of 3 kinds of cause of diseases PCR of rabies virus；1:DM2000 DNA
marker；2:CDV；3:CPV；4:RV；5:NTC(PCR blank)；6: the triple PCR that CDV+CPV+RV is carried out；
Fig. 2 is the multi-fluorescence immune analysis method test experience knot of canine distemper virus, Canine Parvovirus and 3 kinds of cause of diseases of rabies virus
Fruit figure；
Fig. 3 is the multi-fluorescence immune analysis method detection specificity of canine distemper virus, Canine Parvovirus and 3 kinds of cause of diseases of rabies virus
Experimental result picture；" Rabies " in figure is RV；
Fig. 4 is the multi-fluorescence immune analysis method detection sensitivity of canine distemper virus, Canine Parvovirus and 3 kinds of cause of diseases of rabies virus
Experimental result picture；
Fig. 5 is that the multi-fluorescence immune analysis method Clinical detection of canine distemper virus, Canine Parvovirus and 3 kinds of cause of diseases of rabies virus is real
Testing result figure, NTC represents that negative control, PC represent positive control.
Detailed description of the invention
A kind of multi-fluorescence immunoassay primer of quick differentiation canine distemper virus, Canine Parvovirus and rabies virus, described
Primer nucleotide sequences is as follows:
Primer CDV1:AACAGATGGGTGAAACAGCA(SEQ ID NO:1),
Primer CDV2:GCATAACTCCAGAGCAATGGGTAG(SEQ ID NO:2)；
Primer CPV1:CAAGATAAAAGACGTGGTGTAACTC(SEQ ID NO:3),
Primer CPV2:TTGTGTAGACGCCTCAAAAGAATAA(SEQ ID NO:4)；
Primer RV1:CAGGACTGGTATCATTTACTGGGTT (SEQ ID NO:5),
Primer RV2:GAAGTGGATGAAATAAGAGTGAGG (SEQ ID NO:6).
Preferably, 5 ' ends of a described primer CDV1 and CDV2 wherein primer are biotinylated；
5 ' ends of a described primer CPV1 and CPV2 wherein primer are biotinylated；
5 ' ends of a described primer RV1 and RV2 wherein primer are biotinylated.
Preferably, the 5 ' of the primer not being biotinylated in described primer CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2
End connection have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in anti-tag complementary pairing.
Preferably, the tag sequence that described primer CDV1 and CDV2, these 3 groups of primer centerings of CPV1 and CPV2, RV1 and RV2 connect
Column selection is from the tag sequence shown in SEQ ID NO:7 ~ 9, and the tag sequence that these 3 groups of primer centerings connect is different.
A kind of quick differentiation canine distemper virus, Canine Parvovirus and the multi-fluorescence immunoassay kits of rabies virus, should
Containing any of the above-described described primer in test kit.
Preferably, possibly together with SA-PE complex, 3 kinds of different iridescent of coding in this test kit
Fluorescence-encoded micro-beads.
Preferably, possibly together with the anti-tag sequence matched with tag complementary in primer in described fluorescence-encoded micro-beads,
The anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding is different.
A kind of quick differentiation canine distemper virus, Canine Parvovirus and the multi-fluorescence immune analysis method of rabies virus, including
Following steps:
1) from sample, viral nucleic acid is extracted；
2) with the viral nucleic acid that extracts as template, PCR amplification is carried out with any of the above-described described primer；
3) upper step amplified production, 3 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization；
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its cause of disease；
Said method is used for diagnosis and the treatment of non-diseases.
Preferably, step 2) in PCR amplification reaction system be:
5×One-step RT-PCR buffer 5µL
dNTP 1µL
Primer mixed liquor 4 L
Enzyme 1 L
Template 2 L
ddH2O 12µL
Total 25µL；
Preferably, step 2) in PCR amplification response procedures be: 50 DEG C of reverse transcription 30min；95 DEG C of denaturations 15min；95 DEG C of changes
Property 30s, 60 DEG C annealing 30s, 72 DEG C extend 20s；Circulate 35 times；72 DEG C extend 10min eventually.
Preferably, reaction system and the program of hybridization described in step 3) is:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L；Hatch 30min for 45 DEG C.
Preferably, in step 3) in the fluorescence-encoded micro-beads of 3 kinds of different iridescent of coding possibly together with tag sequence in primer
The anti-tag sequence of complementary pairing, the anti-tag sequence contained in 3 kinds of fluorescence-encoded micro-beads is different.
Below in conjunction with specific embodiment, the present invention is further illustrated, but is not limited thereto.
Embodiment 1 primer
After designed a large amount of primers are screened, find that primer is to CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2
Best to the effect of multi-fluorescence immune detection canine distemper virus, Canine Parvovirus and rabies virus, its base sequence is as follows.
Primer CDV1:AACAGATGGGTGAAACAGCA(SEQ ID NO:1),
Primer CDV2:GCATAACTCCAGAGCAATGGGTAG(SEQ ID NO:2)；
Primer CPV1:CAAGATAAAAGACGTGGTGTAACTC(SEQ ID NO:3),
Primer CPV2:TTGTGTAGACGCCTCAAAAGAATAA(SEQ ID NO:4)；
Primer RV1:CAGGACTGGTATCATTTACTGGGTT (SEQ ID NO:5),
Primer RV2:GAAGTGGATGAAATAAGAGTGAGG (SEQ ID NO:6).
The present invention uses the method for multi-fluorescence immunoassay to carry out a point canine distemper virus, Canine Parvovirus and rabies virus
Distinguish, therefore make above-mentioned primer further to modify, operate requirement accordingly to meet.Wherein primer CDV1, CPV1 and RV
5 ' end connections have tag sequence, and the tag sequence connected is respectively as follows:
The tag sequence of primer CDV1 is: ATCTCAATTACAATAACACACAAA(SEQ ID NO:7)；
The tag sequence of primer CPV1 is: CAAACAAACATTCAAATATCAATC(SEQ ID NO:8)；
The tag sequence of primer RV1 is: TACTACTTCTATAACTCACTTAAA (SEQ ID NO:9).
It addition, the 5 ' ends of primer CDV2, CPV2 and RV2 have been also added with biotin labeling.
Embodiment 2: quickly distinguish the multi-fluorescence immunoassay kits of CDV, CPV and RV
Test kit includes following components:
(1) primer for multi-fluorescence immunoassay designed by embodiment 1；
The fluorescence-encoded micro-beads including anti-tag sequence of (2) 3 kinds of different iridescent of coding, described anti-tag sequence energy
Correspondingly match with the tag complementary in multi-fluorescence immunoassay primer；3 kinds of microspheres are purchased from luminex company, wherein
The fluorescence-encoded micro-beads number that CDV, CPV are the most corresponding with RV is MTAG-A067, MTAG-022 and MTAG-034.
(3) SA-PE complex.
The fluorescence-encoded micro-beads including anti-tag sequence of (2) 3 kinds of different iridescent of coding, described anti-tag sequence
Row can correspondingly match with the tag complementary on multi-fluorescence immunoassay primer sets forward primer；Three kinds of microspheres are purchased from
Luminex company, fluorescence-encoded micro-beads number respectively the most corresponding for concrete CDV, CPV and RV be MTAG-A067, MTAG-022 and
MTAG-034。
(3) SA-PE complex.
The foundation of the multi-fluorescence immune analysis method detection method of embodiment 3 CDV, CPV and RV
(1) structure of CDV, CPV and RV plasmid
Automatically extract instrument with the nucleic acid of sky root and extract the nucleic acid of CDV, CPV and RV respectively, respectively with primer to CDV1 and CDV2,
CPV1 and CPV2, RV1 and RV2 carry out PCR amplification, amplified production carries out agarose gel electrophoresis detection respectively and to cut glue pure
Change, cDNA after purification is respectively connecting in pMD-19T carrier, product will be connected and convert to DH5a competent cell, and select
Monoclonal, carries out bacterium colony PCR qualification, the bacterium colony being accredited as positive bacteria is carried out plasmid extraction, send order-checking.
(2) plasmid PCR amplification
Respectively CDV, CPV and RV are carried out substance, triple PCR amplification with the primer described in embodiment 1.
The preparation of forward primer mixed liquor: CDV1, CPV1 and RV1 are mixed with mol ratio 1:1:1:1 ratio；Downstream
The preparation of primer mixed liquor: CDV2, CPV2 and RV2 are mixed with mol ratio 1:1:1:1 ratio.Utilize CDV, CPV and R tri-
Plant the specific template of cause of disease, and the triple hybrid template of CDV, CPV and RV, the specific regions of above-mentioned three kinds of cause of diseases is carried out
Amplification.The preparation of the most triple templates: three kinds of plasmids are mixed with the ratio with volume ratio 1:1:1:1.
Pcr amplification reaction system is as follows:
5×One-step RT-PCR buffer 5μl
Enzyme 1μl
dNTP 1μl
Forward primer mixed liquor 2 μ l (final concentration of 0.2 μM of each primer)
Final concentration of 0.2 μM of each primer of downstream primer mixed liquor 2 μ l()
Template 2 μ l (< 500ng)
ddH2O 12μl
Total 25μl。
The response procedures of amplification is: 50 DEG C of reverse transcription 30min；95 DEG C of denaturations 15min；95 DEG C of degeneration 30s, 60 DEG C of annealing
30s, 72 DEG C extend 20s, circulate 35 times；72 DEG C extend 10min eventually.
Electrophoresis detection result: above-mentioned PCR primer is carried out agarose gel electrophoresis analysis, its electrophoretogram is as shown in Figure 1.1:
DM2000 DNA marker；2:CDV；3:CPV；4:RV；5:NTC(PCR blank)；6: three that CDV+CPV+RV is carried out
Weight PCR.From figure 1 it appears that the amplified production size that the amplified production size of CDV is about 151bp, CPV is about 163bp,
The amplified production size of RV is about 155bp, owing to the amplified production size of these three cause of disease is close, so triple PCR amplification is produced
The electrophoretic band of thing cannot be differentiated.
(3) by the PCR primer of gained and fluorescence-encoded micro-beads working solution, Streptavidin phycoerythrin (SAPE) working solution
Hybridization, comprises the following steps:
Be coated with 3 kinds of microspheres of special anti-tag sequence respectively, wherein anti-tag sequence can correspondingly with CDV, CPV and
Tag complementary pairing on tri-kinds of cause of disease primers of RV.Three kinds of microspheres are purchased from luminex company, concrete CDV, CPV and RV
The most corresponding fluorescence-encoded micro-beads number is MTAG-A067, MTAG-022 and MTAG-034.
The preparation of fluorescence-encoded micro-beads working solution: by 2500/μ l fluorescence-encoded micro-beads with 1.1 × Tm
Hybrdization Buffer is diluted to 1 μ l and about contains 125/kind fluorescence-encoded micro-beads.
Prepared by SAPE working solution: 1mg/ml SAPE 1 × Tm Hybrdization Buffer is diluted to 10 μ g/ μ l.
Abundant resuspended fluorescence-encoded micro-beads working solution, each sample well and background hole add microsphere working solution 20 μ l, sample
Hole adds 5 μ l PCR primer, background hole adds 5 μ l NTC products, adds the SAPE working solution of 75 μ l, fully mix,
30min is hatched for 45 DEG C in metal heater.
According to the explanation of detector Luminex 200 instrument, the 100 above-mentioned reactant liquors of μ l after hybridization are detected, result
As shown in Figure 2, although the amplified production of triple templates cannot be differentiated with electrophoresis, but read with detector Luminex 200 instrument
During MFI value, can substantially offer an explanation different types of cause of disease.
Result criterion (result criterion also can be adjusted by note: this criterion is only for reference) is as follows:
The determination of lowest detection threshold value (cutoff value): choose 10 parts of healthy dogs tissue samples (each sample parallel is repeated 3 times),
Read MFI value respectively and calculate its meansigma methods and standard deviation.The MIF value adding 3 times of standard deviations with meansigma methods sets it as cutoff
Value.The present invention obtained cutoff value is 182.5, therefore the cutoff value of the present invention is set to 200.Only detect sample
When MFI value is higher than 200, this experimental data just can effectively be analyzed.
The analysis of sample to be tested judges: 1) as the MFI value ＞ 200 of sample to be tested, it is judged that for positive sample；2) test sample is treated
During this MFI value≤200, it is judged that for feminine gender, need to carry out repeating test or take other detection methods to verify further.
The multi-fluorescence immunoassay detection specificity experiments of embodiment 4 CDV, CPV and RV
Respectively with canine distemper virus (CDV), Canine Parvovirus (CPV), rabies virus (RV), hepatitis infectiosa canis virus (CAV), dog parainfluenza virus
Poison (CPiV), canine coronavirus (CCV) carry out multi-fluorescence immunoassay detection as template.Experimental result is as it is shown on figure 3, only
Having canine distemper virus, Canine Parvovirus, rabies virus is the positive, and other are feminine gender, illustrate that this detection system specificity is good.
Embodiment 5:CDV, the multi-fluorescence immunoassay detection sensitivity experiment of CPV and RV
The plasmid of preparation is carried out quantitatively, use 10 times of dilution methods to carry out gradient dilution, be diluted to 101Copies/ μ l, with above-mentioned
The multi-fluorescence immune analysis method set up detects.The multi-fluorescence immunoassay detection sensitivity of CDV, CPV and RV is real
Testing result as shown in Figure 4, test result indicate that, the limit of identification of CDV, CDV and RV is respectively 102copies/μl、
102Copies/ μ l and 103copies/μl。
Embodiment 6: the detection of sample
By clinical samples such as the swab of collected dog, feces, urine, salivas, automatically extract instrument extracting nucleic acid conduct with nucleic acid
Reaction template, and use the One-Step RT PCR kit of Qiagen to expand.Use that above-mentioned CDV, CPV and RV's is multiple
Fluorescence immunoassay detection method detects, amplified production and fluorescence-encoded micro-beads and SAPE hybridization, examines at Luminex 200
Survey and on instrument, read data.Concrete steps are with reference to embodiment 3, and experimental result is as shown in Figure 5.
Showing through regular-PCR test experience result, sample 1,3,5,7,8,10 is feminine gender；2,4,9 is CDV positive sample
Product；4,6,9 is CPV positive.Wherein, sample 4,9 is CDV, CPV mixed infection sample.By sequencing analysis, as a result one
Cause.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment
Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify,
All should be the substitute mode of equivalence, within being included in protection scope of the present invention.
<110>Experimental Animals Supervising Station, Guangdong Prov.
<120>a kind of quick differentiation canine distemper virus, Canine Parvovirus and the multi-fluorescence immune analysis method of rabies virus and
Test kit
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
aacagatggg tgaaacagca 20
<210> 2
<211> 24
<212> DNA
<213>artificial sequence
<400> 2
gcataactcc agagcaatgg gtag 24
<210> 3
<211> 25
<212> DNA
<213>artificial sequence
<400> 3
caagataaaa gacgtggtgt aactc 25
<210> 4
<211> 25
<212> DNA
<213>artificial sequence
<400> 4
ttgtgtagac gcctcaaaag aataa 25
<210> 5
<211> 25
<212> DNA
<213>artificial sequence
<400> 5
caggactggt atcatttact gggtt 25
<210> 6
<211> 24
<212> DNA
<213>artificial sequence
<400> 6
gaagtggatg aaataagagt gagg 24
<210> 7
<211> 24
<212> DNA
<213>artificial sequence
<400> 7
atctcaatta caataacaca caaa 24
<210> 8
<211> 24
<212> DNA
<213>artificial sequence
<400> 8
caaacaaaca ttcaaatatc aatc 24
<210> 9
<211> 24
<212> DNA
<213>artificial sequence
<400> 9
tactacttct ataactcact taaa 24
Claims (10)
1. a multi-fluorescence immunoassay primer for quick differentiation canine distemper virus, Canine Parvovirus and rabies virus, described in draw
Thing nucleotide sequence is as follows:
Primer CDV1:AACAGATGGGTGAAACAGCA(SEQ ID NO:1),
Primer CDV2:GCATAACTCCAGAGCAATGGGTAG(SEQ ID NO:2)；
Primer CPV1:CAAGATAAAAGACGTGGTGTAACTC(SEQ ID NO:3),
Primer CPV2:TTGTGTAGACGCCTCAAAAGAATAA(SEQ ID NO:4)；
Primer RV1:CAGGACTGGTATCATTTACTGGGTT (SEQ ID NO:5),
Primer RV2:GAAGTGGATGAAATAAGAGTGAGG (SEQ ID NO:6).
Primer the most according to claim 1, it is characterised in that:
5 ' ends of a described primer CDV1 and CDV2 wherein primer are biotinylated；
5 ' ends of a described primer CPV1 and CPV2 wherein primer are biotinylated；
5 ' ends of a described primer RV1 and RV2 wherein primer are biotinylated.
3. require the primer described in 1 according to profit, it is characterised in that described primer CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2
In be not biotinylated primer 5 ' end connections have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in
Anti-tag complementary matches.
4. according to the primer described in claim 1 or 3, it is characterised in that described primer CDV1 and CDV2, CPV1 and CPV2, RV1
The tag sequence connected with these 3 groups of primer centerings of RV2 is selected from the tag sequence shown in SEQ ID NO:7 ~ 9, and these 3 groups of primer centerings
The tag sequence connected is different.
5. a multi-fluorescence immunoassay kits for quick differentiation canine distemper virus, Canine Parvovirus and rabies virus, it is special
Levy and be, containing the arbitrary described primer of claim 1 ~ 4 in this test kit.
Test kit the most according to claim 5, it is characterised in that possibly together with Streptavidin-algae red eggs in this test kit
White complex, the fluorescence-encoded micro-beads of 3 kinds of different iridescent of coding.
Test kit the most according to claim 5, it is characterised in that in described fluorescence-encoded micro-beads possibly together with in primer
The anti-tag sequence of tag complementary pairing, the anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding
Arrange different.
8. a multi-fluorescence immune analysis method for quick differentiation canine distemper virus, Canine Parvovirus and rabies virus, its feature
It is, comprises the steps:
1) from sample, viral nucleic acid is extracted；
2) with the viral nucleic acid that extracts as template, PCR amplification is carried out with the arbitrary described primer of claim 1 ~ 4；
3) upper step amplified production, 3 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization；
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its cause of disease；
Said method is used for diagnosis and the treatment of non-diseases.
Method the most according to claim 8, it is characterised in that: step 2) in PCR amplification reaction system be:
5×One-step RT-PCR buffer 5µL
dNTP 1µL
Primer mixed liquor 4 L
Enzyme 1 L
Template 2 L
ddH2O 12µL
Total 25µL；
Step 2) in PCR amplification response procedures be: 50 DEG C of reverse transcription 30min；95 DEG C of denaturations 15min；95 DEG C of degeneration 30s,
60 DEG C of annealing 30s, 72 DEG C extend 20s；Circulate 35 times；72 DEG C extend 10min eventually.
Method the most according to claim 8, it is characterised in that: described in step 3) hybridization reaction system and program be:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L；Hatch 30min for 45 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610773297.4A CN106319091B (en) | 2016-08-30 | 2016-08-30 | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610773297.4A CN106319091B (en) | 2016-08-30 | 2016-08-30 | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106319091A true CN106319091A (en) | 2017-01-11 |
| CN106319091B CN106319091B (en) | 2018-05-25 |
Family
ID=57789497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610773297.4A Active CN106319091B (en) | 2016-08-30 | 2016-08-30 | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106319091B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326098A (en) * | 2017-06-20 | 2017-11-07 | 广东省实验动物监测所 | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus |
| CN116144791A (en) * | 2022-12-15 | 2023-05-23 | 浙江大学 | Kit for rapidly distinguishing 3 parasite pathogens and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862421A (en) * | 2014-07-11 | 2015-08-26 | 中华人民共和国济南出入境检验检疫局 | Complete set of products for identifying rabies, canine distemper, infectious hepatitis, canine parvovirus diseases, typhus billosus nostras and toxoplasmosis pathogeny |
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
-
2016
- 2016-08-30 CN CN201610773297.4A patent/CN106319091B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862421A (en) * | 2014-07-11 | 2015-08-26 | 中华人民共和国济南出入境检验检疫局 | Complete set of products for identifying rabies, canine distemper, infectious hepatitis, canine parvovirus diseases, typhus billosus nostras and toxoplasmosis pathogeny |
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326098A (en) * | 2017-06-20 | 2017-11-07 | 广东省实验动物监测所 | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus |
| WO2018233448A1 (en) * | 2017-06-20 | 2018-12-27 | 广东省实验动物监测所 | Multiplex fluoroimmunoassay method for rapidly distinguishing rabbit hemorrhagic disease virus, sendai virus and lapine rotavirus, and reagent |
| CN107326098B (en) * | 2017-06-20 | 2020-06-16 | 广东省实验动物监测所 | Multiplex fluorescence immunoassay method and reagent for rapidly distinguishing rabbit plague virus, sendai virus and rabbit rotavirus |
| CN116144791A (en) * | 2022-12-15 | 2023-05-23 | 浙江大学 | Kit for rapidly distinguishing 3 parasite pathogens and application thereof |
| CN116144791B (en) * | 2022-12-15 | 2023-11-14 | 浙江大学 | Kit for rapidly distinguishing 3 parasite pathogens and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106319091B (en) | 2018-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105154589B (en) | A kind of multi-fluorescence immunoassay method of quick differentiation PEDV, TGEV, PoRV | |
| CN102634586B (en) | Decoding and sequencing method by real-time synthesis of two nucleotides into deoxyribonucleic acid (DNA) | |
| CN108913812B (en) | Multiple liquid-phase chip detection method for porcine viral diarrhea pathogen and construction thereof | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| CN104419713A (en) | Loop-mediated isothermal amplification based human respiratory syncytial virus detection kit | |
| CN107574262A (en) | A kind of fluorescence RT RAA primers, probe and detection method for being used to detect A (H 1 N 1) virus | |
| CN106222256A (en) | A kind of Multiple immunizations fluorescence analysis method detecting chicken virus mycoplasma and chicken Mycoplasma synoviae | |
| CN107326098B (en) | Multiplex fluorescence immunoassay method and reagent for rapidly distinguishing rabbit plague virus, sendai virus and rabbit rotavirus | |
| CN106011313B (en) | A kind of the multi-fluorescence immunoassay method and reagent of quick differentiation ILTV, IBV, MG and MS | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses | |
| CN106191319A (en) | A kind of multi-fluorescence immune analysis method of 6 kinds of fowl respiratory pathogenses of quick differentiation | |
| CN117867166A (en) | Primer group for detecting Dabieshan virus based on RPA-CRISPR/Cas12a and application thereof | |
| CN111647685A (en) | Primer group, probe group and kit for detecting COVID-19 virus and application thereof | |
| CN106636474A (en) | Primer group, kit and method for detecting six mouse viruses by multiple immunity fluorescence | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN106544447B (en) | A kind of Multiple immunizations fluorescence analysis primer, kit and method for detecting chicken Marek's disease virus and chicken infectious anemia virus | |
| CN106086241B (en) | A kind of primer, kit and the method for the multi-fluorescence immunoassay of 4 kinds of fowl respiratory pathogens of quick differentiation | |
| CN102618627B (en) | Internal reference detection system and kit for isothermal nucleic acid amplification reaction | |
| CN112553379B (en) | Method and kit for detecting respiratory infectious disease virus based on liquid chip | |
| CN110878380B (en) | Primer composition, kit and method for detecting vesicular stomatitis virus Indiana type and new Jersey type | |
| CN106191312B (en) | A kind of quick multi-fluorescence immunoassay method and reagent for distinguishing AIV, NDV, MG and MS | |
| CN106755600A (en) | A kind of PCR kit for fluorescence quantitative for detecting Zaire type Ebola virus | |
| CN105256076A (en) | Method and kit for identifying and detecting eight gene subtypes of hepatitis B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |