WO2018233448A1 - Multiplex fluoroimmunoassay method for rapidly distinguishing rabbit hemorrhagic disease virus, sendai virus and lapine rotavirus, and reagent - Google Patents

Abstract

Disclosed are a multiplex fluoroimmunoassay method for rapidly distinguishing the rabbit hemorrhagic disease virus, Sendai virus and lapine rotavirus, and a reagent. The fluoroimmunoassay method comprises: obtaining a target amplification fragment by means of PCR; then hybridizing an amplification product, fluorescence coded microspheres and streptavidin-phycoerythrin; reading the MFI value through a detector; and distinguishing different types of viruses.

Description

Multiple fluorescent immunoassay method and reagent for rapidly distinguishing rabbit prion, Sendai virus and rabbit rotavirus Technical field

The invention belongs to the field of virus detection, and particularly relates to a multiplex fluorescent immunoassay method and reagent for rapidly distinguishing rabbit prion (RHV), Sendai virus (SV) and rabbit rotavirus (LRV).

Background technique

Rabbit prion, also known as rabbit hemorrhagic disease virus (RHV), can cause severe infectious diseases characterized by respiratory system hemorrhage, parenchymal organ edema, congestion and bleeding. The disease spreads rapidly, and the disease is acute and morbid. The rate and mortality rate are extremely high, and it is classified as a Class B animal infectious disease by the World Organisation for Animal Health. It is classified as a second-class animal disease by the Veterinary Bureau of the Ministry of Agriculture of China. Rabbit rotavirus (LRV) is a member of the reoviridae rotavirus genus, which is the main cause of acute viral gastroenteritis in rabbits. It is considered to be only a mild pathogen, but it is associated with other viruses. Bacterial and parasitic mixed infection is easy to cause fulminant enteritis, and epidemiological investigation found that it has a high infection rate in the rabbit population, which is an important threat to the healthy development of China's rabbit industry and hinder the standardization process of experimental animals in China. Pathogen. Sendai virus (SV) belongs to the paramyxoviridae respiratory virus, which is the main cause of rodent system diseases, mainly caused by airborne and direct contact, high relative humidity and slower air circulation. It promotes its infection and is difficult to remove from infected populations. It is one of the most difficult diseases in experimental rodents.

RHV, SV and LRV are the most important pathogens for the outbreak of viral infections in rabbits. These three viruses are mandatory items required by the national standard. At present, a variety of detection and diagnosis methods have been established at home and abroad, such as electron microscopy, HA and HI experiments, agarose diffusion test, fluorescent antibody technology and ELISA, etc. These detection methods are easy to operate and are suitable for common pathogen antibody detection, but have Higher false positives and false negatives with limited accuracy and sensitivity.

With the rapid development of molecular biology, multiplex PCR has been widely used in the differential diagnosis of mixed infection of animal viruses. The principle is to design multiple pairs of primers capable of simultaneously amplifying a specific fragment size of the pathogen to be tested, in the PCR reaction system. Multiple pairs of primers can be added to differentially diagnose multiple pathogens. Multiplex RT-PCR is widely used in the mixed sense of animal viruses because of its sensitivity, specificity and ease of operation, but the results require electrophoresis, which is time consuming and laborious, and the reaction products are prone to contamination and lead to false positives, while multiplex PCR is By the size of the fragments to distinguish, generally to triple and above, the size of the fragments is large, the amplification efficiency of each virus is not the same, resulting in biased results.

Summary of the invention

The object of the present invention is a multiplex immunoassay method and reagent for rapidly distinguishing RHV, SV, and LRV.

The technical solution adopted by the present invention is:

A primer for a rapid multiplex immunofluorescence assay for RHV, SV and LRV, the nucleotide sequence of which is shown below:

RHV primer R1: 5'-CTCTCCACAAAATAACCCATTCACA-3' (SEQ ID NO: 1);

RHV primer R2: 5'-CCAACCCTGGTCCAATCTCG-3' (SEQ ID NO: 2);

SV primer S1: 5'-TGACAACAAACGGAGTAAACGC-3' (SEQ ID NO: 3);

SV primer S2: 5'-ACCATAGGTCCAAACAGCCATTC-3' (SEQ ID NO: 4);

LRV primer L1: 5'-ATGGTTCGCTTGTGTCTTAGTTG-3' (SEQ ID NO: 5);

LRV primer L2: 5'-ATGCGTTGGGTGTAGTTCCTGTA-3' (SEQ ID NO: 6).

Preferably, the 5' ends of primers R1, S1 and L1 are also linked by a spacer sequence to a tag sequence.

Preferably, the tag sequences at the 5' end of primers R1, S1 and L1 are respectively:

The tag sequence of primer R1 is: 5'-CTTAAACTCTACTTACTTCTAATT-3' (SEQ ID NO: 7);

The tag sequence of primer S1 is: 5'-CTAAACATACAAATACACATTTCA-3' (SEQ ID NO: 8);

The tag sequence of primer L1 was: 5'-TACTACTTCTATAACTCACTTAAA-3' (SEQ ID NO: 9).

Preferably, the 5' end of primers R2, S2 and L2 is added with a biotin label.

A reagent for rapidly distinguishing multiplex fluorescence immunoassays of RHV, SV and LRV, which comprises the primer of any of the above.

Preferably, the reagent further comprises a streptavidin-phycoerythrin complex and three fluorescent coded microspheres encoding different fluorescent colors.

Preferably, the fluorescent coded microspheres further comprise an anti-tag sequence complementary to the tag sequence in the primer.

A method for rapidly distinguishing multiple fluorescent immunoassays of RHV, SV and LRV, comprising the following steps:

Extracting viral RNA from the sample to be tested, and using the primers according to any one of claims 1 to 4 for RT-PCR amplification using RNA as a template;

Amplifying the product, three fluorescently encoded microspheres encoding different fluorescent colors, and streptavidin-phycoerythrin;

After the end of the hybridization, the hybridization product is analyzed to determine the type of the virus;

The above methods are used for the diagnosis and treatment of non-diseases.

Preferably, the reaction system for RT-PCR amplification is:

The reaction procedure of RT-PCR amplification was: reverse transcription at 50 ° C for 30 min; pre-denaturation at 94 ° C for 15 min; denaturation at 94 ° C for 30 s, annealing at 60 ° C for 30 s, extension at 72 ° C for 20 s; 30 cycles; and 72 ° C for 10 min.

Preferably, the reaction system and procedure of the hybridization are:

The beneficial effects of the invention are:

The method of the invention can simultaneously detect rabbit prion, Sendai virus and rotavirus, obtain target amplified fragment by PCR, and then amplify product, fluorescent coded microsphere and streptavidin-phycoerythrin (SA- PE) Different types of pathogens are identified when hybridization is performed and then the MFI value is read by the detector.

The method of the invention can accurately detect rabbit prion, Sendai virus and rotavirus at the same time, and has strong specificity, high sensitivity and good repeatability. Compared with the conventional detection method, the method of the invention realizes simultaneous detection of a plurality of different target molecules in the same sample, the sample amount is small, the operation is simple and fast, and the detection cost can be greatly reduced. The TAG technology of the invention can ensure the same renaturation temperature and hybridization efficiency, and effectively avoid cross-hybridization between microspheres labeled with different detectors.

The primer of the present invention has good amplifying and specificity for rabbit prion (RHV), Sendai virus (SV) and rotavirus (LRV), except that it can be combined with RHV, SV and LRV. It does not bind to other common rabbit viruses and bacterial nucleic acids, and has high specificity and high accuracy.

DRAWINGS

Figure 1 is an electrophoresis diagram of PCR of three viral plasmids of rabbit prion, Sendai virus and rabbit rotavirus;

2 is a graph showing the results of detection of multiplex fluorescing immunoassay methods for rabbit prion, Sendai virus and rabbit rotavirus;

3 is a graph showing the results of detection sensitivity of a multiplex immunofluorescence assay for rabbit prion, Sendai virus and rabbit rotavirus;

Figure 4 is a graph showing the results of detection of specificity by multiplex immunofluorescence assay of rabbit prion, Sendai virus and rabbit rotavirus;

Fig. 5 is a graph showing the results of multiplex immunofluorescence assay for three virus samples of rabbit prion, Sendai virus and rabbit rotavirus.

Detailed ways

The present invention will be further described below in conjunction with specific embodiments, but is not limited thereto.

Example 1 Primer for multiplex immunofluorescence assay for rapid discrimination between rabbit prion, Sendai virus and rabbit rotavirus

After screening a large number of primers designed, primer pairs R1 and R2, S1 and S2, L1 and L2 were found to simultaneously detect rabbit prion (RHV), Sendai virus (SV) and rabbit rotavirus (LRV). The effect is best, and the nucleotide sequence is as follows:

RHV primer R1: CTCTCCACAAAATAACCCATTCACA (SEQ ID NO: 1);

RHV primer R2: CCAACCCTGGTCCAATCTCG (SEQ ID NO: 2);

SV primer S1: TGACAACAAACGGAGTAAACGC (SEQ ID NO: 3);

SV primer S2: ACCATAGGTCCAAACAGCCATTC (SEQ ID NO: 4);

LRV primer L1: ATGGTTCGCTTGTGTCTTAGTTG (SEQ ID NO: 5);

LRV primer L2: ATGCGTTGGGTGTAGTTCCTGTA (SEQ ID NO: 6).

The invention adopts the method of multiple fluorescence immunoassay to distinguish three kinds of RHV, SV and LRV pathogens, so the above primers are further modified to meet the corresponding operational requirements. Wherein the 5' ends of the primers R1, S1 and L1 are linked by a spacer arm, respectively:

The tag sequence of the primer R1 is: CTTAAACTCTACTTACTTCTAATT (SEQ ID NO: 7);

The tag sequence of primer S1 is: CTAAACATACAAATACACATTTCA (SEQ ID NO: 8);

The tag sequence of primer L1 is: TACTACTTCTATAACTCACTTAAA (SEQ ID NO: 9).

In addition, biotin labels were added to the 5' ends of primers R2, S2 and L2.

Example 2 Reagent for multiplex immunofluorescence assay for rapidly distinguishing rabbit prion, Sendai virus and rabbit rotavirus

The reagent includes the following components:

(1) a primer designed for multiplex fluorescence immunoassay designed in Example 1;

(2) three kinds of fluorescent coded microspheres containing anti-tag sequences encoding different fluorescent colors, and the anti-tag sequences can be complementarily matched with the tag sequences in the multiplex fluorescent immunoassay primers; From luminex, the corresponding fluorescent coded microspheres of RHV, SV and LRV are MTAG-A056, MTAG-A062 and MTAG-029;

(3) Streptavidin-phycoerythrin complex.

Example 3 Establishment of a multiplex immunoassay method for detection of rabbit prion, Sendai virus and rabbit rotavirus

1. Construction of rabbit prion, Sendai virus and rabbit rotavirus plasmid

The RNAs of RHV, SV and LRV viruses were extracted with the MiniBEST Viral RNA/DNA Extraction Kit Ver.4.0, and reverse transcribed into cDNA. PCR amplification was performed using the above primer pairs R1 and R2, S1 and S2, L1 and L2, respectively. The amplification products were separately subjected to agarose gel electrophoresis detection and gelatinization purification. The purified cDNA was ligated into the pMD-19T vector using the TaKaRa kit, and the ligated product was transformed into DH5a competent cells, and the monoclonal antibody was selected for colony PCR identification, and the colonies identified as positive bacteria were subjected to plasmid extraction. Send sequencing.

2. Plasmid PCR amplification

Single, double, and triple PCR amplifications were performed using the primer pairs described in Example 1 for R1 and R2, S1 and S2, L1 and L2.

Preparation of the upstream primer mixture: R1, S1 and L1 were mixed at a ratio of 1:1:1; preparation of the downstream primer mixture: R2, S2 and L2 were mixed at a ratio of 1:1:1. The specific regions of the three pathogens of RHV, SV, and LRV, and the two-template and triple template were used to amplify the atopic regions of the above three viruses. The preparation of the two-fold template: mixing the two plasmids in a ratio of 1:1, preparation of the triple template: mixing the three plasmids at a ratio of 1:1:1.

The PCR amplification reaction system is as follows:

The amplification reaction procedure is:

Pre-denaturation at 94 ° C for 5 min;

Denaturation at 94 ° C for 30 s, annealing at 60 ° C for 30 s, extension at 72 ° C for 30 s; cycle 35 times;

The final extension was 72 min at 72 °C.

The PCR product was analyzed by agarose gel electrophoresis, and its electrophoresis pattern is shown in Fig. 1. In the figure, M: 100 bp DNA ladder marker, 1: RHV, 2: SV, 3: LRV, 4: RHV + SV, 5: RHV + LRV, 6: SV + LRV, 7: RHV + SV + LRV, 8: PCR blank.

As can be seen from Fig. 1, the amplification product size of RHV is about 161 bp, the amplification product size of SV is about 148 bp, and the amplification product size of LRV is about 261 bp. Since the amplification products of RHV and SV are similar in size, The electrophoresis bands of multiplex PCR amplification products are difficult to distinguish clearly.

3. Hybridizing the obtained PCR product with a fluorescent coded microsphere working solution or a streptavidin phycoerythrin (SAPE) working solution, comprising the following steps:

Three microspheres with specific anti-tag sequences were coated, respectively, wherein the anti-tag sequences were able to complement the pairing of the tag sequences on the three viral primers RHV, SV and LRV, respectively. All three microspheres were purchased from Luminex, and the corresponding fluorescent coded microspheres of RHV, SV and LRV were MTAG-A056, MTAG-A062 and MTAG-029, respectively.

Preparation of Fluorescent-Coded Microsphere Working Fluid: 2500/μl of fluorescently encoded microspheres were diluted to 1 μl with approximately 1.1 fluorescent/encoded microspheres using a 1.1×Tm Hybrdization Buffer.

SAPE working solution preparation: 1 mg/ml SAPE was diluted to 10 μg/μl with 1×Tm Hybrdization Buffer.

Fully resuspend the fluorescent coded microsphere working solution, add 20 μl of fluorescent coded microsphere working solution to each sample well and background well, add 5 μl PCR product to the sample well, add 5 μl PCR blank product to the background well, and add 75 μl of SAPE working solution. Mix well and incubate in a metal heater at 45 ° C for 30 min.

According to the description of the detector Luminex 200 instrument, 100 μl of the above reaction solution after hybridization was detected, and the result is shown in Fig. 2. In the figure, "RHV+SV+LRV" indicates the triple PCR result; "RHV", "SV", "LRV" "Single-plex PCR for RHV, SV, and LRV respectively, NTC is a no-template control (ie, negative control); although the amplification product of the multiple template cannot be resolved by electrophoresis, when the MFI value is read by the Luminex 200 instrument, Different types of viruses are clearly distinguished.

The result judgment standard (Note: The judgment standard is for reference only, and the result judgment standard can also be adjusted) as follows:

Determination of the minimum detection threshold (cutoff value): 10 healthy rabbit feces or tissue samples were selected (each sample was repeated 3 times in parallel), and the MFI values were read and the mean and standard deviation were calculated. It is set to the cutoff value by the MIF value of the average plus 3 times the standard deviation. The cutoff value obtained by the present invention is 414.5, so the cutoff value of the present invention is set to 500. The experimental data can only be analyzed effectively if the MFI value of the test sample is higher than 500.

The analysis and judgment of the sample to be tested: 1) When the MFI value of the sample to be tested is >500, it is judged as a positive sample; 2) When the MFI value of the sample to be tested is ≤500, it is judged to be negative, and repeated experiments or other detection methods are required. Further verification.

Example 4: Multiplex fluorescent immunoassay for detection of sensitivity of RHV, SV, LRV

The prepared plasmid was assayed for concentration, diluted with a 10-fold dilution method, diluted to 0.01 fg/μl, and detected by the multiplex fluorescence immunoassay method of the present invention.

The specific method comprises the following steps: extracting the recombinant plasmid and using the above primers for RT-PCR amplification as a template; and hybridizing the amplification product, three fluorescent coded microspheres encoding different fluorescent colors and streptavidin-phycoerythrin After the end of the hybridization, the hybridization product is analyzed to determine the type of virus.

The reaction system for RT-PCR amplification is:

The reaction procedure of RT-PCR amplification was: reverse transcription at 50 ° C for 30 min; pre-denaturation at 94 ° C for 15 min; denaturation at 94 ° C for 30 s, annealing at 60 ° C for 30 s, extension at 72 ° C for 20 s; 30 cycles; and 72 ° C for 10 min.

The obtained PCR product is hybridized with a fluorescent coded microsphere working solution, streptavidin phycoerythrin (SAPE) working solution, and the reaction system and procedure of the hybridization are:

The reaction was carried out at 45 ° C for 30 min.

The results of multiplex immunofluorescence assay for RHV, SV, and LRV are shown in Figure 3. The experimental results show that the sensitivity of RHV, SV, and LRV is high, and the detection limits are 1fg/PCR and 10fg/PCR, respectively.

Example 5: Multiplex fluorescent immunoassay for RHV, SV, LRV detection specificity experiment

The multiplex immunofluorescence assay was carried out using rabbit prion, Sendai virus, rabbit rotavirus, Pasteurella (Pas.) and Escherichia coli (E. coli) as templates, respectively, in the same manner as in Example 4. The experimental results are shown in Fig. 4. Only RHV, SV, and LRV were positive, and both Pasteurella (Pas.) and E. coli (E coli) were negative, indicating that the detection system was specific.

Example 6: Multiplex fluorescent immunoassay for RHV, SV, LRV to detect repetitive experiments

The three viruses were tested in batch and batch, and the results are shown in Table 1.

Table 1 Multiplex fluorescent immunoassay for RHV, SV, LRV to detect reproducible results

It can be seen from the results in Table 1 that the coefficient of variation of the intra-assay experiment is below 2%, and the coefficient of variation of the inter-assay experiment is below 3%, indicating that the detection performance of the method is stable, the result is reliable, and reproducible.

Example 7: Detection of samples

The collected rabbit feces or tissue samples were extracted with the kit MiniBEST Viral RNA/DNA Extraction Kit Ver. 4.0, and then reverse transcribed to obtain cDNA. Using cDNA as a template, the above-mentioned RHV, SV, LRV multiplex fluorescence immunoassay detection method was used for detection, and the results are shown in FIG. 5 .

The results in Figure 5 show that samples 7, 9, and 10 are all negative, 1, 3, 4, 6, and 8 are SV-positive; 2, 4, 5, and 6 are LRV-positive samples. Among them, samples 4 and 6 were mixed infection samples of SV and LRV. By sequencing analysis, the results were consistent.

The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and combinations thereof may be made without departing from the spirit and scope of the invention. Simplifications should all be equivalent replacements and are included in the scope of the present invention.

Claims (10)

1. A primer for a rapid multiplex immunofluorescence assay for RHV, SV and LRV, the nucleotide sequence of which is shown below:

   RHV primer R1: 5'-CTCTCCACAAAATAACCCATTCACA-3';

   RHV primer R2: 5'-CCAACCCTGGTCCAATCTCG-3';

   SV primer S1: 5'-TGACAACAAACGGAGTAAACGC-3';

   SV primer S2: 5'-ACCATAGGTCCAAACAGCCATTC-3';

   LRV primer L1: 5'-ATGGTTCGCTTGTGTCTTAGTTG-3';

   LRV primer L2: 5'-ATGCGTTGGGTGTAGTTCCTGTA-3'.
2. The primer according to claim 1, wherein the 5' end of the primers R1, S1 and L1 is further linked with a tag sequence via a spacer arm.
3. The primer according to claim 1 or 2, wherein the tag sequences at the 5' end of the primers R1, S1 and L1 are respectively:

   The tag sequence of primer R1 is: 5'-CTTAAACTCTACTTACTTCTAATT-3';

   The tag sequence of primer S1 is: 5'-CTAAACATACAAATACACATTTCA-3';

   The tag sequence of primer L1 is: 5'-TACTACTTCTATAACTCACTTAAA-3'.
4. The primer according to claim 1, wherein the 5' end of the primers R2, S2 and L2 is added with a biotin label.
5. An agent for rapidly distinguishing multiplex fluorescence immunoassays of RHV, SV and LRV, characterized in that the reagent comprises the primer according to any one of claims 1 to 4.
6. The reagent according to claim 5, further comprising a streptavidin-phycoerythrin complex and three fluorescently encoded microspheres encoding different fluorescent colors.
7. The reagent according to claim 5, wherein the fluorescently encoded microspheres further comprise an anti-tag sequence complementary to the tag sequence in the primer.
8. A method for rapidly distinguishing multiplex fluorescence immunoassays of RHV, SV and LRV, comprising the steps of:

   Extracting viral RNA from the sample to be tested, and using the primers according to any one of claims 1 to 4 for RT-PCR amplification using RNA as a template;

   Amplifying the product, three fluorescently encoded microspheres encoding different fluorescent colors, and streptavidin-phycoerythrin;

   After the end of the hybridization, the hybridization product is analyzed to determine the type of virus.
9. The method according to claim 8, wherein the reaction system for RT-PCR amplification is:

   

   The reaction procedure of RT-PCR amplification was: reverse transcription at 50 ° C for 30 min; pre-denaturation at 94 ° C for 15 min; denaturation at 94 ° C for 30 s, annealing at 60 ° C for 30 s, extension at 72 ° C for 20 s; 30 cycles; and 72 ° C for 10 min.
10. The method of claim 8 wherein said hybridization reaction system and procedure are:

    

    The reaction was carried out at 45 ° C for 30 min.

Images