CN111485033A - Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method - Google Patents
Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method Download PDFInfo
- Publication number
- CN111485033A CN111485033A CN201910075568.2A CN201910075568A CN111485033A CN 111485033 A CN111485033 A CN 111485033A CN 201910075568 A CN201910075568 A CN 201910075568A CN 111485033 A CN111485033 A CN 111485033A
- Authority
- CN
- China
- Prior art keywords
- primer
- rhdv
- detecting
- pcr
- mfia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology, relates to a biological detection technology, and particularly relates to a specific primer for detecting rabbit hemorrhagic disease virus and an MFIA xTAG detection method, wherein the specific primer for detecting RHDV is a specific primer designed according to a VP60 gene sequence of RHDV, and based on the property of the specific primer, the invention further optimizes and establishes a liquid phase chip detection method suitable for rapidly and accurately detecting RHDV50The sensitivity is 100 times of that of the traditional RT-PCR, the operation is simple and quick, and the method can greatly reduceThe cost is detected, and the RHDV is detected quickly and accurately.
Description
Technical Field
The invention belongs to the technical field of molecular biology, relates to a biological detection technology, and particularly relates to a specific primer for detecting rabbit hemorrhagic disease virus and an MFIA xTAG detection method.
Background
Rabbit hemorrhagic disease, also known as rabbit plague, rabbit viral hemorrhagic pneumonia, rabbit hemorrhagic pneumonia, or rabbit viral septicemia, is a virulent infectious disease of rabbits caused by rabbit viral hemorrhagic disease virus (RHDV), characterized by extremely strong infectivity, congestion and bleeding of parenchymal organs, and extremely high morbidity and mortality. Rabbit hemorrhagic disease only occurs between rabbits, and rabbits more than 3 months old are most susceptible and often have fulminant epidemic, which causes devastating loss to the rabbit breeding industry.
Members of the genus Leporis of the family Caliciviridae of the genus RHDV are related to the European hare syndrome virus, but are antigenically non-intersecting. The detection of RHDV virus infection is a key index for detecting rabbit hemorrhagic disease. However, RHDV has been difficult to culture in vitro, and thus there is no ideal method for diagnosing rabbit hemorrhagic disease. Currently, the conventional detection methods of RHDV include Hemagglutination (HA) and Hemagglutination Inhibition (HI) tests, indirect hemagglutination test (IHA), agar diffusion test (AGP), enzyme-labeled antibody technology, RT-PCR and the like. However, the methods generally have the problems of poor specificity, long time consumption, low sensitivity, easy occurrence of false positive and the like, so that pathogen diagnosis is always difficult, and the finding of a method for quickly and accurately diagnosing RHDV virus infection is particularly important.
The RT-PCR technology is a common technical means in the field of biotechnology at present, has the advantages of strong specificity and high sensitivity, but the result judgment needs to depend on electrophoresis determination, so that the time and the labor are wasted, and the reaction product is easy to generate pollution to cause false positive results. The fluorescent quantitative RT-PCR technology integrates multiple advantages of PCR, realizes quantitative detection of target molecules by directly detecting the change of fluorescent signals in the PCR reaction process, does not need electrophoresis detection in the detection result, is completely closed-tube operation in the whole process, reduces the pollution probability of the reaction, and also avoids the problem of false positive result easily caused by conventional PCR detection. Compared with the conventional RT-PCR technology, the fluorescent quantitative RT-PCR technology has obvious advantages in the aspects of detection sensitivity, specificity, detection speed and the like.
The fluorescence immunoassay (MFIA) technology is a microsphere (microbead) biological technology combining hydrodynamics, optics and digital signal processing, and can realize high-throughput multiplex detection of a single sample, the fluorescence immunoassay technology can complete detection of up to 500 indexes within 3 hours, and is a major progress of multiplex biological detection, the technical principle is that two red classification fluorescent dyes with different proportions are adopted to dye polystyrene microspheres with the diameter of 5.6 micrometers into different fluorescent colors, so as to obtain up to 100 fluorescence-coded microspheres, antibody molecules or gene probes aiming at different objects to be detected are combined onto specific coding microspheres in a covalent crosslinking mode, each coding microsphere corresponds to a corresponding detection item, the fluorescence-coded microspheres aiming at different objects to be detected are mixed, then a substance to be detected or an amplified fragment to be detected is added, the formed complex is combined with a labeled fluorescein to react, the single-column fluorescent microspheres are driven by flowing sheath fluid, red laser is used for judging the fluorescence coding of the microspheres, green laser is used for detecting the fluorescence intensity of report microspheres, so as to achieve the fluorescent intensity of the report molecules on the microspheres, the fluorescent intensity of the microspheres, the complex is combined with labeled fluorescein labeled microsphere, the labeled TAG, the fluorescent coding of the fluorescent molecules, the fluorescent marker.
Disclosure of Invention
Therefore, the technical problem to be solved by the invention is to provide a specific primer for detecting rabbit hemorrhagic disease virus;
the second technical problem to be solved by the invention is to provide a method for detecting rabbit hemorrhagic disease virus by using MFIA xTAG technology, which has the advantages of rapidness, accuracy, high sensitivity, good specificity and low cost, and can completely meet the requirement of rapidly detecting RHDV infection.
In order to solve the technical problem, the specific primer for detecting RHDV provided by the invention has the corresponding specific amplification segment located between the 212-th 585 locus of the RHDV VP60 gene, and the size of the specific amplification segment is 374 bp.
The sequence structure of the specific amplification fragment is specifically as follows:
5’-ACTTCTACTACAATGATGTTTTCACTTGGTCAGTCGCGGACGCACCCGGCAGCATTCTCTACACTGTCCAACACTCTCCACAGAACAACCCATTCACAGCTGTACTGAGCCAGATGTACGCTGGCTGGGCTGGTGGCATGCAGTTCCGCTTCATAGTTGCTGGATCAGGTGTGTTTGGTGGGCGACTGGTCGCGGCTGTGATACCACCAGGCATCGAGATTGGGCCAGGGTTGGAGGTCAGGCAATTTCCTCATGTTGTTATCGACGCCCGTTCACTCGAACCTGTTACCATCACCATGCCAGACTTGCGTCCCAACATGTACCATCCAACTGGTGACCCTGGCCTTGTCCCCACACTAGTCCTTAGTG TTTAC-3’。
further, the primers comprise an upstream primer F and a downstream primer R;
the 5' end of the upstream primer F contains a tag sequence, that is,
tag: 5'-CTTTCTTAATACATTACAACATAC-3', a spacer arm sequence is arranged between the tag sequence and the 5 ' end of the upstream primer;
the 5' end of the downstream primer R is marked by Biotin.
3. The specific primer for detecting RHDV according to claim 1 or 2, wherein said primer comprises:
an upstream primer F:
5’-CTTTCTTAATACATTACAACATAC-spacer-ACTTCTACTACAATgATg-3’；
a downstream primer R: 5 '-Biotin-gTAAACACTAAggACTAg-3'.
The invention also provides a nucleic acid detection method for detecting RHDV by using MFIA xTAG, which comprises the following steps:
(1) extracting virus RNA from a virus sample to be detected by using a conventional technology;
(2) using the extracted RNA as a template, and performing one-step RT-PCR amplification by using the primer;
(3) hybridizing the amplification product obtained in the step (2), the magnetic bead microspheres and SA-PE;
(4) after the hybridization reaction was completed, the hybridization reaction was analyzed by an L uminex 200 instrument.
In the step (3), the microspheres are magnetic beads coated with specific anti-tag sequences, and the anti-tag sequences can be correspondingly and complementarily paired with the tag sequences selected in the claim 1.
In the step (3), the hybridization reaction system is 100 mu L, and the hybridization reaction system contains 20 mu L of the magnetic beads, 75 mu L of SA-PE, and 5 mu L of amplification products.
In the step (3), the hybridization reaction procedure is reaction at 37 ℃ for 30 min.
In the step (1), the RT-PCR reaction system comprises:
2μL RT Buffer(5×)；
1.5μL PCR Buffer(10×)；
200. mu. mol/L dNTP mix;
3.5mmol/L MgCl2；
0.5 μ L rnase inhibitor;
the primer of claim 1, wherein each of the upstream and downstream primers is 10pmo L;
5U M-M L V reverse transcriptase;
1.5U
taq DNA polymerase;
5 μ L RNA template;
complement ddH2O to 25 μ L.
In the step (1), the amplification parameters of the RT-PCR reaction are as follows: treating at 42 deg.C for 30min, treating at 95 deg.C for 10min, treating at 95 deg.C for 15s, treating at 60 deg.C for 30s, treating at 72 deg.C for 15s, repeating for 32 cycles, and extending at 72 deg.C for 2 min.
Compared with the traditional detection method, the method adopts a method combining RT-PCR with liquid chip detection, has less detection sample dosage and minimum detected virus amount of 0.1L D50The sensitivity is 100 times of that of the traditional RT-PCR, the operation is simple and quick, the detection cost can be greatly reduced, and the RHDV can be quickly and accurately detected.
Drawings
In order that the present disclosure may be more readily and clearly understood, the following detailed description of the present disclosure is provided in connection with specific embodiments thereof and the accompanying drawings, in which,
FIG. 1 shows the electrophoresis result of rabbit hemorrhagic disease virus one-step RT-PCR detection; wherein, M-standard DNA molecular weight is 2000; 1-rabbit hemorrhagic disease virus; 2-pasteurella; 3-bordetella sp; 4-Escherichia coli; 5-staphylococcus; 6-Clostridium welchii; 7-rabbit liver;
FIG. 2 shows the specific results of the detection of rabbit hemorrhagic disease virus MFIA xTAG;
FIG. 3 shows the sensitivity of rabbit hemorrhagic disease virus one-step RT-PCR detection; wherein, M-standard DNA molecular weight is 2000; 1-105LD50；2-104LD50；3-103LD50；4-102LD50；5-10LD50；6-1LD50；
FIG. 4 shows the detection sensitivity of the rabbit hemorrhagic disease virus MFIA xTAG.
Detailed Description
1. Primer design
The specific primer for detecting RHDV described in this embodiment has a corresponding specific amplification fragment located between the 212 th and 585 th sites of the RHDDVVP 60 gene, the size is 374bp, and the sequence structure of the specific amplification fragment specifically is:
5’-ACTTCTACTACAATGATGTTTTCACTTGGTCAGTCGCGGACGCACCCGGCAGCATTCTCTACACTGTCCAACACTCTCCACAGAACAACCCATTCACAGCTGTACTGAGCCAGATGTACGCTGGCTGGGCTGGTGGCATGCAGTTCCGCTTCATAGTTGCTGGATCAGGTGTGTTTGGTGGGCGACTGGTCGCGGCTGTGATACCACCAGGCATCGAGATTGGGCCAGGGTTGGAGGTCAGGCAATTTCCTCATGTTGTTATCGACGCCCGTTCACTCGAACCTGTTACCATCACCATGCCAGACTTGCGTCCCAACATGTACCATCCAACTGGTGACCCTGGCCTTGTCCCCACACTAGTCCTTAGTG TTTAC-3’。
designing primers according to the sequence of the registered RHDV VP60 gene in GenBank, wherein the primers comprise an upstream primer F and a downstream primer R, and the 5' end of the upstream primer contains a Tag sequence, namely Tag: 5'-CTTTCTTAATACATTACAACATAC-3', a spacer arm sequence is arranged between the tag sequence and the 5 ' end of the upstream primer; the 5' end of the downstream primer is marked by Biotin.
The designed primer specifically comprises:
an upstream primer F: 5'
-CTTTCTTAATACATTACAACATAC–spacer-ACTTCTACTACAATgATg-3’；
A downstream primer R: 5 '-Biotin-gTAAACACTAAggACTAg-3'.
2. Nucleic acid extraction
Adding 100 μ L virus solution to be tested and 400 μ L Trizol (purchased from Gibco/BR L company) into a 1.5m L micro centrifugal tube, shaking, mixing uniformly, standing at room temperature for 5min, then adding 100 μ L chloroform, shaking, standing at room temperature for 5min, centrifuging at 12000g at 4 ℃ for 10min, taking the upper aqueous phase, placing in another centrifugal tube, adding equal volume of isopropanol, mixing uniformly, standing at room temperature for 10min, centrifuging at 12000g at 4 ℃ for 10min, discarding the supernatant, washing with 800 μ L75% ethanol, centrifuging at 7500g for 5min, carefully discarding the supernatant, drying, and then using 10 μ L ddH2And dissolving the O.
3. RT-PCR one-step amplification
Adopts a one-step RT-PCR reaction body2 mu L RT Buffer (5 ×), 1.5 mu L PCR Buffer (10 ×), 200 mu mol/L dNTP mixture, 3.5 mmol/L MgCl2, 0.5 mu L RNase inhibitor, 10pmo L of each of the upstream and downstream primers involved in step (1), 5U M-M L V reverse transcriptase, 1.5U of each of the upstream and downstream primers involved in step (1) are sequentially added to a 0.2ml reaction tube
TaqDNA polymerase, 5 μ L RNA template, complement ddH2O to 25 μ L at 42 ℃ 30min, 95 ℃ 10min, then 95 ℃ 15s, 60 ℃ 30s, 72 ℃ 15s for 32 cycles, and finally 72 ℃ extension for 2 min.
The RT-PCR reaction system described in this example was assembled using a conventional commercial kit, and the reverse transcriptase (M-M L V), RNase inhibitor and dNTP mix were purchased from Promega corporation.
Taq DNA polymerase was purchased from Invitrogen.
4. Treatment of hybridization reaction
Hybridizing the RT-PCR product with a magnetic bead working solution and a streptavidin phycoerythrin (SA-PE) working solution, and specifically comprising the following steps:
(1) preparing a magnetic bead microsphere working solution, namely preparing a magnetic bead microsphere which is purchased from L umiex, is coated with a specific anti-tag sequence and can be complementarily matched with the tag sequence in a designed primer, diluting 2500/mu L magnetic beads to 1 mu L by using 1.1 × Tmhybridization Buffer according to the specification, wherein the number of the magnetic beads is MTAG-A025;
(2) preparing SA-PE working solution, namely diluting 1mg/m L SA-PE to 10 mu g/mu L by using 1 × Tm hybridization Buffer;
(3) and (3) sample adding and hybridization, namely adding 20 mu L of magnetic bead microsphere working solution into each sample well and each background well, adding 5 mu L of PCR products into each sample well, adding 5 mu L of PCR negative reaction products into each background well, adding 75 mu L of SA-PE working solution, fully mixing, and incubating for 30min at 37 ℃ in a metal heater.
5. Determination of results
50 μ L of the above reaction solution after hybridization were read for MFI value with a L uminex 200 detector according to the instructions of L uminex 200 instrument.
6. Result judgment
Determination of the lowest detection threshold (cutoff value): liver samples from 5 healthy rabbits (each sample was replicated 3 times in parallel) were selected, and the MFI values were read and the mean and standard deviation calculated, respectively. The MIF value of the mean plus 3 times the standard deviation is set as the cutoff value. The cutoff value obtained in the test sample of this example is 956.5, see Table 1. The cutoff value of this example is therefore set to 1000. This experimental data can only be effectively analyzed if the MFI value of the test sample is above 1000.
Analyzing and judging the sample to be detected: 1) when the MFI value of the sample to be detected is more than 1000, the sample is judged to be a positive sample; 2) and when the MFI value of the sample to be detected is less than or equal to 1000, judging the sample to be negative, and performing repeated experiments or adopting other detection methods for further verification.
TABLE 1 MFI detection threshold
7. Specificity verification
Respectively extracting RNA from rabbit hemorrhagic disease virus, rabbit Pasteurella multocida, rabbit Bordetella, Escherichia coli, staphylococcus, Clostridium welchii and healthy rabbit liver samples as templates, performing RT-PCR, and detecting by gel electrophoresis and MFIA xTAG. As shown in FIGS. 1 and 2, only rabbit hemorrhagic disease virus was positive, and the others were negative, indicating that the specificity of the detection system was good.
8. Sensitivity verification
Two virus samples (strain1 and strain2) were selected and diluted by 10-fold dilution to 0.01L D50The detection is carried out by the MFIA xTAG method established above, and the detection limit of the RT-PCR electrophoresis is 10L D50MFIA xTAG detection limit of 0.1L D50The results are shown in FIG. 3 and FIG. 4, which are 100 times those of the conventional RT-PCR.
9. In-batch repeatability
3 RHDV virus strains are selected to be respectively subjected to batch-wise experiments, the results are shown in the following table 2, and the variation coefficient of the batch-wise experiments is below 2%.
TABLE 2 Rabbit hemorrhagic disease Virus MFIA xTAG detection in-batch reproducibility results
10. Batch to batch repeatability
5 2-month-old rabbits without immunization for Lepidemic vaccine were administered at 1000L D per rabbit50RHDV challenge was performed on the dose of (A) and (B) and the rabbit liver, spleen and caldol swab were collected and tested by MFIA xTAG test method, and the test results are shown in Table 3 below. The variation coefficient of the batch experiment is below 5%, which shows that the method has stable detection performance, reliable result and repeatability.
TABLE 3 clinical samples Rabbit hemorrhagic disease Virus MFIA xTAG detection batch-to-batch repeat results
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
Sequence listing
<110> poultry institute of academy of agricultural sciences of Shandong province
<120> primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method
<160>1
<170>PatentIn version 3.5
<210>1
<211>374
<212>DNA
<213>RHDV VP60
<400>1
acttctacta caatgatgtt ttcacttggt cagtcgcgga cgcacccggc agcattctct 60
acactgtcca acactctcca cagaacaacc cattcacagc tgtactgagc cagatgtacg 120
ctggctgggc tggtggcatg cagttccgct tcatagttgc tggatcaggt gtgtttggtg 180
ggcgactggt cgcggctgtg ataccaccag gcatcgagat tgggccaggg ttggaggtca 240
ggcaatttcc tcatgttgtt atcgacgccc gttcactcgaacctgttacc atcaccatgc 300
cagacttgcg tcccaacatg taccatccaa ctggtgaccc tggccttgtc cccacactag 360
tggttagtgt ttac 374
Claims (9)
1. A specific primer for detecting RHDV is characterized in that a specific amplification fragment corresponding to the primer is positioned between 212-585 th sites of RHDV VP60 gene, and the size is 374 bp.
2. The specific primers for detecting RHDV according to claim 1, wherein said primers comprise an upstream primer F and a downstream primer R;
the 5' end of the upstream primer F contains a tag sequence, that is,
tag: 5'-CTTTCTTAATACATTACAACATAC-3', a spacer arm sequence is arranged between the tag sequence and the 5 ' end of the upstream primer;
the 5' end of the downstream primer R is marked by Biotin.
3. The specific primer for detecting RHDV according to claim 1 or 2, wherein said primer comprises:
an upstream primer F:
5’-CTTTCTTAATACATTACAACATAC-spacer-ACTTCTACTACAATgATg-3’；
a downstream primer R: 5'-gTAAACACTAAggACTAg-3' are provided.
4. A nucleic acid detection method for detecting RHDV using MFIA xTAG, comprising the steps of:
(1) extracting virus RNA from a virus sample to be detected by using a conventional technology;
(2) performing one-step RT-PCR amplification by using the extracted RNA as a template and the specific primer of any one of claims 1 to 3;
(3) hybridizing the amplification product obtained in the step (2), the magnetic bead microspheres and SA-PE;
(4) after the hybridization reaction was completed, the hybridization reaction was analyzed by an L uminex 200 instrument.
5. The method for detecting RHDV using MFIA xTAG according to claim 4, wherein in said step (3), said microspheres are microspheres coated with specific anti-tag sequence, said anti-tag sequence can be complementary-paired with the tag sequence selected in claim 2 or 3, respectively.
6. The method of claim 5, wherein in step (3), said hybridization reaction system comprises a 100 μ L reaction system containing 20 μ L magnetic beads, 75 μ L SA-PE, and 5 μ L amplification product.
7. The method of claim 6, wherein in step (3), the hybridization reaction is performed at 37 ℃ for 30 min.
8. The method for detecting RHDV using MFIA xTAG according to any one of claims 4-7, wherein in said step (1), said RT-PCR reaction system:
2μL RT Buffer(5×)；
1.5μL PCR Buffer(10×)；
200. mu. mol/L dNTP mix;
3.5mmol/L MgCl2；
0.5 μ L rnase inhibitor;
the primer of claim 1, wherein each of the upstream and downstream primers is 10pmo L;
5U M-M L V reverse transcriptase;
1.5U
taq DNA polymerase;
5 μ L RNA template;
complement ddH2O to 25 μ L.
9. The method for detecting RHDV using MFIA xTAG according to any one of claims 4-8, wherein in said step (1), the amplification parameters of said RT-PCR reaction are: treating at 42 deg.C for 30min, treating at 95 deg.C for 10min, treating at 95 deg.C for 15s, treating at 60 deg.C for 30s, treating at 72 deg.C for 15s, repeating for 32 cycles, and extending at 72 deg.C for 2 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910075568.2A CN111485033A (en) | 2019-01-25 | 2019-01-25 | Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910075568.2A CN111485033A (en) | 2019-01-25 | 2019-01-25 | Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111485033A true CN111485033A (en) | 2020-08-04 |
Family
ID=71791418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910075568.2A Pending CN111485033A (en) | 2019-01-25 | 2019-01-25 | Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111485033A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154512A (en) * | 2011-03-15 | 2011-08-17 | 中国检验检疫科学研究院 | Fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for rabbit hemorrhagic disease virus |
| CN103146842A (en) * | 2011-03-15 | 2013-06-12 | 中国检验检疫科学研究院 | Rabbit hemorrhagic disease virus rt-pcr detection method |
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
| CN107326098A (en) * | 2017-06-20 | 2017-11-07 | 广东省实验动物监测所 | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus |
-
2019
- 2019-01-25 CN CN201910075568.2A patent/CN111485033A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154512A (en) * | 2011-03-15 | 2011-08-17 | 中国检验检疫科学研究院 | Fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for rabbit hemorrhagic disease virus |
| CN103146842A (en) * | 2011-03-15 | 2013-06-12 | 中国检验检疫科学研究院 | Rabbit hemorrhagic disease virus rt-pcr detection method |
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
| CN107326098A (en) * | 2017-06-20 | 2017-11-07 | 广东省实验动物监测所 | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus |
Non-Patent Citations (1)
| Title |
|---|
| 周智君等: "兔出血症病毒套式PCR检测方法的建立", 《湖南农业大学学报(自然科学版)》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101985665B (en) | Method for detecting various respiratory viruses and primers and probes thereof | |
| CN105624330B (en) | 12 boar common virus and bacterium Taqman-MGB PCR kit for fluorescence quantitative and method are detected simultaneously | |
| WO2021155728A1 (en) | Nucleic acid detection kit for novel coronavirus 2019-ncov | |
| CN112458210B (en) | Gene conserved sequence, primer probe combination, kit and application for detecting new coronavirus | |
| CN111733295B (en) | Primer group and kit for detecting novel coronavirus | |
| CN103911463B (en) | A kind of test kit and detection method detecting multiple mosquito matchmaker pathogenic agent | |
| CN109652516A (en) | A kind of structure and purposes of double chain oligonucleotide nucleic acid probe | |
| CN110358815B (en) | Method for simultaneously detecting multiple target nucleic acids and kit thereof | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN105002285A (en) | Liquid-stage chip constant-temperature detection method for tiny RNA | |
| CN110735006A (en) | African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit | |
| AU2020100696A4 (en) | LAMP-TaqMan ASSAY KIT FOR PIGEON NEWCASTLE DISEASE VIRUS | |
| CN111593139B (en) | RT-RAA primer, probe and kit for detecting classical swine fever virus and application | |
| CN112538550A (en) | RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application | |
| CN111910020A (en) | Primer, probe, kit and detection method for detecting Hantaan virus and Hancheng virus through dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) | |
| WO2019001187A1 (en) | Multi-liquid phase gene chip detection primer, kit and method for rapidly distinguishing five pathogens in mouse respiratory tracts | |
| CN106222298B (en) | LAMP detection kit, detection method and application of RNA virus | |
| CN105671207B (en) | Liquid-phase chip detection method for four pathogens of porcine viral diarrhea | |
| TWI797583B (en) | Kit and method for detecting sars-cov-2 | |
| CN109777861A (en) | The loop-mediated isothermal amplification method of mispairing tolerance and application | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN111235321A (en) | Dual TaqMan fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for Muscovy duck reovirus and novel duck reovirus | |
| CN111485033A (en) | Primer for detecting rabbit hemorrhagic disease virus and nucleic acid detection method | |
| CN110042175A (en) | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |