TWI797583B - Kit and method for detecting sars-cov-2 - Google Patents

Abstract

A kit for detecting SARS-CoV-2 includes a first primer set and a second primer set. The first primer set includes primers comprising nucleotide sequences of SEQ ID NOs: 25 to 28, or nucleotide sequences having at least 90% identity to SEQ ID NOs: 25 to 28. The second primer set includes primers comprising nucleotide sequences of SEQ ID NOs: 43 to 46, or nucleotide sequences having at least 90% identity to SEQ ID NOs: 43 to 46.

Description

Kit and method for detecting SARS-COV-2

This case is about the kit and method for detecting coronavirus, especially the kit and method for detecting SARS-COV-2.

Respiratory syndrome coronavirus disease 2019 (also known as COVID-19) broke out in late 2019. The virus that causes COVID-19, called Severe Acute Respiratory Syndrome Coronavirus 2, or SARS-CoV-2, has been under development by medical communities around the world in recent months Reliable and rapid diagnostic assay.

The main methods for detecting COVID-19 include molecular diagnostics, serological assays, and medical imaging (computed tomography). In January 2020, the Charité Institute of Virology in Berlin, Germany, designed the first effective molecular diagnostic assay for COVID-19. Since then, hundreds of molecular tests have been designed to detect SARS-CoV-2; most of these were amplified from SARS-CoV-2 using reverse transcription polymerase chain reaction (RT-PCR). Augmentation and detection of genetic material. Other methods include isothermal amplification, whole-genome sequencing, microarray or lab-on-a-chip technology, and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR).

The main problem of RT-PCR method is the long reaction time. Most of the COVID-19 detection kits based on RT-PCR or real-time RT-PCR (Real-Time RT-PCR, rRT-PCR) technology have a reaction time of more than 30 minutes. The rRT-PCR assay developed by the Hong Kong University (HKU) School of Public Health is one of the fastest assays, but still takes 28 minutes. In addition, in order to shorten the reaction time of RT-PCR determination, it is also necessary to be equipped with a high-performance thermal cycler.

There are also some coronavirus assays based on isothermal technology that can be used for COVID-19 detection, such as Eiken’s COVID-19 LAMP kit (non-real-time, reaction time about 30 minutes), and Ustar (Bioustar) The company's 2019-nCoV kit based on CPA technology. However, most of these detection kits still require a reaction time of about 30 minutes or longer for nucleic acid amplification and detection.

Therefore, there is still an urgent need to provide a rapid and accurate SARS-CoV-2 assay with potential for point-of-care (POC) applications for COVID-19 outbreak control and management .

The purpose of the embodiment of this case is to provide a kit and method for detecting SARS-COV-2.

In order to achieve the above purpose, one embodiment of the present case provides a kit for detecting SARS-COV-2, which includes a first primer set and a second primer set. The first primer set is selected from the group consisting of: (a) primers having the nucleotide sequence of SEQ ID NOs: 1 to 4, or having at least 90% identity with SEQ ID NOs: 1 to 4 The primer of nucleotide sequence; (b) have the primer of the nucleotide sequence of SEQ ID NOs: 7 to 10, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 7 to 10 (c) primers having the nucleotide sequence of SEQ ID NOs: 13 to 16, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 13 to 16; (d) having SEQ ID NOs: ID NOs: primers of the nucleotide sequence of 19 to 22, or primers with a nucleotide sequence of at least 90% identity with SEQ ID NOs: 19 to 22; and (e) having SEQ ID NOs: 25 to The primer of the nucleotide sequence of 28, or the primer that has the nucleotide sequence of at least 90% identity with SEQ ID NOs: 25 to 28. The second primer set is selected from the group consisting of: (f) primers having the nucleotide sequence of SEQ ID NOs: 31 to 34, or having at least 90% identity with SEQ ID NOs: 31 to 34 The primer of nucleotide sequence; (g) have the primer of the nucleotide sequence of SEQ ID NOs: 37 to 40, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 37 to 40 and (h) primers having the nucleotide sequence of SEQ ID NOs: 43 to 46, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 43 to 46.

In some embodiments, the primer set (a) further includes primers having the nucleotide sequences of SEQ ID NOs: 5 and 6, or having nucleotides with at least 90% identity with SEQ ID NOs: 5 and 6 sequence primers. In some embodiments, the primer set (b) further includes primers having the nucleotide sequences of SEQ ID NOs: 11 and 12, or having nucleotides with at least 90% identity with SEQ ID NOs: 11 and 12 sequence primers. In some embodiments, the primer set (c) further includes primers having the nucleotide sequences of SEQ ID NOs: 17 and 18, or nucleotides having at least 90% identity with SEQ ID NOs: 17 and 18 sequence primers. In some embodiments, the primer set (d) further includes primers having the nucleotide sequences of SEQ ID NOs: 23 and 24, or having nucleotides with at least 90% identity with SEQ ID NOs: 23 and 24 sequence primers. In some embodiments, the primer set (e) further includes primers having the nucleotide sequences of SEQ ID NOs: 29 and 30, or nucleotides having at least 90% identity with SEQ ID NOs: 29 and 30 sequence primers. In some embodiments, the primer set (f) further includes primers having the nucleotide sequences of SEQ ID NOs: 35 and 36, or nucleotides having at least 90% identity with SEQ ID NOs: 35 and 36 sequence primers. In some embodiments, the primer set (g) further includes primers having the nucleotide sequences of SEQ ID NOs: 41 and 42, or nucleotides having at least 90% identity with SEQ ID NOs: 41 and 42 sequence primers. In some embodiments, the primer set (h) further includes primers having the nucleotide sequences of SEQ ID NOs: 47 and 48, or nucleotides having at least 90% identity with SEQ ID NOs: 47 and 48 sequence primers.

To achieve the above purpose, another embodiment of the present case provides a method for detecting SARS-COV-2. The method includes the steps of: (a) contacting the biological sample with the aforementioned set; (b) performing nucleic acid amplification of SARS-COV-2 on the biological sample; and (c) detecting the presence of the amplified nucleic acid of SARS-COV-2 .

In one embodiment, the method further includes the step of extracting nucleic acid from the biological sample before step (a).

In one embodiment, in step (b), the nucleic acid amplification is performed by a reverse transcription loop-mediated isothermal amplification reaction.

When the word "a" is used in conjunction with the word "comprises/comprises" in the claims and/or specification, it may mean "one", but it is also used in conjunction with "one or more", "at least one", and "one or Greater than one" has the same meaning.

The term "or" in the claims means "and/or" unless it is expressly stated that the alternatives are exclusive or the alternatives are mutually exclusive, even if the disclosure supports the definition of the alternatives only and "and/or".

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that while the detailed description and specific examples indicate specific embodiments of the invention, these specific implementations are illustrative only since changes and modifications within the spirit and scope of the invention will be apparent from the detailed description. It will be obvious to those skilled in the art.

Some embodiments embodying the features and advantages of the present application will be described in detail in the description in the following paragraphs. It should be understood that the present case can have various changes in different aspects without departing from the scope of the present case, and the descriptions and drawings therein are used for illustration in nature rather than limiting the present case.

The embodiment of this case provides a kit for detecting SARS-COV-2, which can be obtained immediately from human upper and lower respiratory tract samples (such as nasopharyngeal and oropharyngeal swabs, sputum, lower respiratory tract aspirate, bronchoalveolar lavage fluid, etc.) The nucleic acid of SARS-CoV-2 was qualitatively detected in the extract. This kit can be used with thermal cycler or room temperature instrument to detect SARS-CoV-2 infection. This kit is intended to aid in the diagnosis of SARS-CoV-2 infection and for professional use.

In this example, reverse transcription loop-mediated isothermal amplification (reverse transcription loop-mediated isothermal amplification, RT-LAMP) technology was used to detect the presence of SARS-CoV-2 in human upper and lower respiratory tract samples.

In one embodiment, the kit provided herein includes ready-to-use control materials and reagents for sample detection. When SARS-CoV-2 is present in a sample, the targeted region of the viral genome is amplified, and the real-time fluorescent signal is detected as the number of amplicons produced increases. A fixed cut-off value for the test can be used to report test results.

In one embodiment, the kit provided in this case includes positive control and negative control reagents, which can be used as a part of routine quality control testing. The provided reagents help users to detect conditions such as reagent deterioration, unfavorable environmental or test conditions, or variation in personnel operation that may lead to test errors.

SARS-CoV-2 is an RNA virus. The embodiment of this case can qualitatively detect SARS-CoV-2 based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) technology. RT-LAMP uses reverse transcriptase to synthesize cDNA from viral RNA in the sample, and then uses DNA polymerase for isothermal amplification. Two target regions of SARS-CoV-2 RNA, including N gene and Orf1ab gene, were amplified by two sets of specially designed primer sets. Intercalating dyes bind to double-stranded amplicons to generate a real-time signal that can be detected by optical systems in real-time PCR or isothermal instruments. A signal of the response above the predetermined baseline before the cut-off time indicates that the tested sample is positive for SARS-CoV-2, whereas the absence of such a signal by the cut-off time indicates that the tested sample is negative for SARS-CoV-2 sample. In this example, a positive sample is only confirmed if both targets are detected.

Demonstration examples of the kit and method for detecting SARS-CoV-2 according to the embodiment of the present case will be described below. In particular, the kit includes ready-to-use control materials and reagents for sample testing. The panel includes two monoplex assays, including the N assay and the Orf1ab assay, both of which are designed to specifically detect SARS-CoV-2. The kit includes positive control (PC) and negative control (NC) reagents as part of routine quality control testing, wherein the positive control is an RNA template containing the target gene sequence, and the negative control is water. The provided reagents help users to detect conditions such as reagent deterioration, unfavorable environmental or test conditions, or variation in personnel operation that may lead to test errors.

Table 1 lists the target genes and primer sequences. In the N assay, there are five sets of primers, namely N_1, N_2, N_3, N_4, and N_5, each of which can detect the N gene of SARS-CoV-2. In the Orf1ab assay, there are three sets of primers, Orf1ab_2, Orf1ab_3, and Orf1ab_7, and each primer set can detect the Orf1ab gene of SARS-CoV-2. Each primer set includes six specially designed primers, named FIP, BIP, F3, B3, LF, and LB, where FIP and BIP are internal primers, F3 and B3 are external primers, and LF and LB are loop primers . As shown in Table 1, SEQ ID NOs: 1 to 30 are designed to detect the N gene of SARS-CoV-2, while SEQ ID NOs: 31 to 48 are designed to detect the Orf1ab gene of SARS-CoV-2. Table 1 Target Primer set Primer name Primer sequence SEQ ID NO . N N_1 N_FIP_1 TGTTTTGATCGCGCCCCACTGATTACGTTTGGTGGACCCTC 1 N_BIP_1 ATACTGCGTCTTGGTTCACCGCATTGGAACGCCTTGTCCTC 2 N_F3_1 TGGACCCCAAAAATCAGCG 3 N_B3_1 AGCCAATTTGGTCATCTGGA 4 N_LF_1 CTGGTTACTGCCAGTTGAATCT 5 N_LB_1 CAACATGGCAAGGAAGACCTTAA 6 N_2 N_FIP_2 CCACTGCGTTTCCATTCTGGTAAATGCACCCCGCATTACG 7 N_BIP_2 GGCGCGATCAAAACAACGTCGTGCCATGTTGAGTGAGAGC 8 N_F3_2 TGGACCCCAAAAATCAGCG 9 N_B3_2 GCCTTGTCCTCGAGGGAAT 10 N_LF_2 TGAATCTGAGGGTCCACCAAAA 11 N_LB_2 GCCCCAAGGTTTACCCAATAA 12 N_3 N_FIP_3 GCGTCAATATGCTTATTCAGCAAAAGACCTACACAGGTGCCAT 13 N_BIP_3 ATACAAAACATTCCCACCAACAGATTCTGTCTCTGCGGTAAG 14 N_F3_3 ATGGAAGTCACACCTTCG 15 N_B3_3 GGAAGAAGAGTCACAGTTTG 16 N_LF_3 GAAATTTGGATCTTTGTCATCCAATTTG 17 N_LB_3 AGAAGGCTGATGAAACTCAAGC 18 N_4 N_FIP_4 CAGCCTTCTTCTTTTTGTCCTTTTTCTGAATAAGCATATTGACGCA 19 N_BIP_4 CTTACCGCAGAGACAGAAGAAACATGTTGCAATTGTTTGGAGAA 20 N_F3_4 CCAAATTTTCAAAGATCAAGTCAT twenty one N_B3_4 TCAGCACTGCTCATGGAT twenty two N_LF_4 CTCTGTTGGTGGGAATGTTTTGTA twenty three N_LB_4 GCAAACTGTGACTCTTCTTTCCT twenty four N_5 N_FIP_5 CTTGAGTTTCATCAGCCTTCTTCTTCGCATACAAAACATTCCCA 25 N_BIP_4 CTTACCGCAGAGACAGAAGAAACATGTTGCAATTGTTTGGAGAA 26 N_F3_5 GTCATTTTGCTGAATAAGCATAT 27 N_B3_4 TCAGCACTGCTCATGGAT 28 N_LF_5 TGTCCTTTTTAGGCTCTGTTGG 29 N_LB_4 GCAAACTGTGACTCTTCTTTCCT 30 Orf1ab Orf1ab_2 nCoV_Orf1ab_FIP_2 TTTGTGGTAATAAACACCCAAAAATGGAGGTACTACTTTAGATTCGAAGACC 31 nCoV_Orf1ab_BIP_2 AAGTTGGATGGAAAGTGAGTTCAGAGTCCATAAGAAAAGGCTGAGAG 32 nCoV_Orf1ab_F3_2 TGAGAAGTCTAACATAATAAGAGGC 33 nCoV_Orf1ab_B3_2 GAAATTACCCTGTTTTCCTTCAAG 34 nCoV_Orf1ab_LF_2 AGTAGCGTTATTAACAATAAGTAGG 35 nCoV_Orf1ab_LB_2 TTTATTCTAGTGCGAATAATTGCA 36 Orf1ab_3 nCoV_Orf1ab_FIP_3 CCTGAGGGAGATCACGCACGGAAAACAGGGTAATTTCAAAAATC 37 nCoV_Orf1ab_BIP_3 TTCGGCTTTAGAACCATTGGTAGATCAAATAACTTCTATGTAAAGCAAGTAAA 38 nCoV_Orf1ab_F3_3 GCCTTTTCTTATGGACCTTGA 39 nCoV_Orf1ab_B3_3 CCAACCTGAAGAAGAATCACC 40 nCoV_Orf1ab_LF_3 AATAGGCGTGTGCTTAGAATATT 41 nCoV_Orf1ab_LB_3 ATAGGTATTAACATCACTAGGTTTCA 42 Orf1ab_7 nCoV_Orf1ab_FIP_7 TGAGTTGTTGACATGTTCAGCCCTTACTCCTACTTGGCGTG 43 nCoV_Orf1ab_BIP_7 ACCCATTGGTGCAGGTATATGCGTGTAGGCAATGATGGATTGA 44 nCoV_Orf1ab_F3_7 CAGAAGTCCCTGTTGCTATTC 45 nCoV_Orf1ab_B3_7 AGAGTAAGCAACTGAATTTTCTG 46 nCoV_Orf1ab_LF_7 CGTGTTTGAAAAACATTAGAACCT 47 nCoV_Orf1ab_LB_7 TTATCAGACTCAGACTAATTCTCCT 48

The primer sets listed in Table 1 were further tested to verify their ability to detect SARS-CoV-2. The reaction is set up as follows: the set includes primer mixture, reaction buffer, enzyme mixture, and staining agent; the primer mixture includes at least one group in the primer sets listed in Table 1, and each primer set includes internal primers (FIP and BIP), External primers (F3 and B3), and loop primers (LF and LB); reaction buffer contains 10X isothermal buffer, 1-2 mM dNTP, 8-12 mM MgSO ₄ , and 0.5-1.5 M Betaine; enzyme mix includes 8-16 units of DNA polymerase and 1-10 units of reverse transcriptase; the dye is a DNA intercalation dye. The RT-LAMP thermal cycle can be 65°C for 15 minutes and can be performed in any real-time PCR or isothermal instrument. For example, the primer test experiment in the embodiment of this case is carried out at 65°C on a Bio-Rad CFX96 real-time PCR instrument. As for the frequency of fluorescence reading, it can be adjusted on different platforms.

For the N assay, Figures 1 to 5 show the amplification curves for the detection of SARS-CoV-2 using primer sets N_1, N_2, N_3, N_4, and N_5. During these tests, fluorescent readings were taken every 60 seconds. The number of cycles on the x-axis represents the number of reads. Since the Bio-Rad CFX96 machine takes about 10 seconds per read, a cycle is about 70 seconds. In these embodiments, it can be seen from Fig. 1 to Fig. 5 that the primer sets N_1, N_2, N_3, N_4, and N_5 can successfully amplify the plasmid DNA containing the target N gene, and there is no template control (no template control , referred to as NTC) was not amplified. All reactions were performed in duplicate.

In these examples, primer set N_5 has a relatively better amplification curve than other primer sets in the N assay, so the limit of detection (LoD) and specificity of primer set N_5 were further tested. During these tests, fluorescent readings were taken every 20 seconds. Since the Bio-Rad CFX96 machine takes about 10 seconds per read, a cycle is about 30 seconds. The reaction was cut off at cycle 31, approximately approximately 15 minutes.

Fig. 6 shows the amplification curve of the plasmid DNA template of primer set N_5 and 16 copies. As can be seen from Figure 6, the limit of detection (LoD) of primer set N_5 for the plasmid DNA containing the N_5 target gene was 16 copies, 22 of the 23 repetitions were amplified within 15 minutes, and NTC was not amplified increase.

Figure 7 shows the specificity analysis of primer set N_5. In this analysis, plasmid DNA containing the N_5 target gene served as a positive control, while other non-target templates (DNA or RNA, see Table 2) isolated from representative strains were used for cross-reactivity testing. Table 2 lists respiratory-related pathogens from which off-target templates were isolated for specificity analysis. In this example, as can be seen from Figure 7, amplification occurred only when the correct template was used for this primer set, while all other non-target templates were not amplified. That is to say, primer set N_5 is specific to SARS-CoV-2 detection. Table 2 No. strain copy/µl nucleic acid 1 Streptococcus pneumoniae 1.56 × 10^7 dna 2 Influenza A H1N1 2 × 10^9 RNA 3 Influenza A Wuhan 7.3 × 10^8 RNA 4 Influenza A H1N1 PR8 6 × 10^8 RNA 5 Haemophilus influenzae 7.59 × 10^5 dna 6 Rhinovirus 1B 6-6.88 × 10^8 RNA 7 Parainfluenza type 2 1.6 × 10^9 RNA 8 Parainfluenza type 3 1.4 × 10^9 RNA 9 Adenovirus 1 5.1-10.2 × 10^7 dna 10 Adenovirus 3 2.35-4.71 × 10^7 dna 11 Adenovirus 4 7.7-15.3 × 10^7 dna 12 Adenovirus 29 1-2 × 10^8 dna 13 Adenovirus 31 3.08-6.16 × 10^7 dna 14 Adenovirus 40 1.44-2.88 × 10^8 dna 15 Cytomegalovirus 7.93 × 10^6 dna 16 Herpes simplex virus type 1 2.12 × 10^7 dna 17 Herpes simplex virus type 2 9.28 × 10^6 dna 18 Measles 2 × 10^9 RNA 19 Respiratory Syncytial Virus 6.4 × 10^8 RNA 20 Influenza B 6.1 × 10^8 RNA twenty one E. coli O157:H7 5.52 × 10^4 dna twenty two Staphylococcus aureus 2.46 × 10^4 dna twenty three Streptococcus pyrogenes 4.85 × 10^4 dna twenty four Enterococcus faecalis (type strain) 20478 1.6 × 10^5 dna 25 Streptococcus agalactiae 1.03 × 10^5 dna 26 229E 2 × 10^8 RNA 27 NL63 2 × 10^8 RNA 28 OC43 2 × 10^8 RNA

For the Orf1ab assay, Figures 8 to 10 show the amplification curves for the detection of SARS-CoV-2 using the primer sets Orf1ab_2, Orf1ab_3, and Orf1ab_7. During these tests, fluorescent readings were taken every 60 seconds. The number of cycles on the x-axis represents the number of reads. Since the Bio-Rad CFX96 machine takes about 10 seconds per read, a cycle is about 70 seconds. In these embodiments, it can be seen from FIG. 8 to FIG. 10 that the primer sets Orf1ab_2, Orf1ab_3, and Orf1ab_7 can all successfully amplify the plasmid DNA containing the target Orf1ab gene, and NTC is not amplified.

In these examples, the primer set Orf1ab_7 has a relatively better amplification curve than other primer sets in the Orf1ab assay, so the limit of detection (LoD) of the primer set Orf1ab_7 was further tested. In these tests, fluorescent readings are taken every 60 seconds, so a cycle is about 70 seconds. Figure 11 shows the amplification curve of the primer set Orf1ab_7 and 19 copies of the plasmid DNA template. As can be seen from Figure 11, the limit of detection (LoD) of the primer set Orf1ab_7 for the plasmid DNA containing the Orf1ab_7 target gene was 19 copies, 20 of the 20 repetitions were amplified within 15 minutes, and NTC was not amplified increase.

Likewise, the specificity of the primer set Orf1ab_7 was further tested. In these tests, fluorescent readings are taken every 20 seconds, so a cycle is about 30 seconds. The reaction was cut off at cycle 31, approximately approximately 15 minutes. Figure 12 shows the specificity analysis of the primer set Orf1ab_7. In this analysis, plasmid DNA containing the Orf1ab_7 target gene served as a positive control, while other non-target templates (DNA or RNA, see Table 2) isolated from representative strains were used for cross-reactivity testing. In this example, as can be seen from Figure 12, amplification occurred only when the correct template was used for this primer set, while all other non-target templates were not amplified. That is to say, the primer set Orf1ab_7 is specific to SARS-CoV-2 detection.

It can be clearly seen from the above examples that each primer set in the N assay and the Orf1ab assay can successfully amplify the plasmid DNA containing the target gene without NTC amplification. In other words, each primer set in the N assay and the Orf1ab assay can independently detect SARS-CoV-2. In addition, in one embodiment, each primer set is designed for LAMP reaction and includes six primers, namely FIP, BIP, F3, B3, LF, and LB. In this example, FIP, BIP, F3, and B3 are essential primers for the LAMP reaction, while LF and LB are optional primers for accelerating the reaction. Therefore, in this embodiment, when each primer set only includes four primers FIP, BIP, F3, and B3, it is also feasible.

In order to further ensure the accuracy of the detection, the kit for detecting SARS-CoV-2 in the embodiment of this case uses two single assays, namely N assay and Orf1ab assay. In the N assay, the primer set can be one of the N_1, N_2, N_3, N_4, and N_5 primer sets; and in the Orf1ab assay, the primer set can be one of the Orf1ab_2, Orf1ab_3, and Orf1ab_7 primer sets . In these assays, the cutoff time can be set at 15 minutes. A signal of the response above the predetermined baseline before the cut-off time indicates that the tested sample is positive for SARS-CoV-2, whereas the absence of such a signal by the cut-off time indicates that the tested sample is negative for SARS-CoV-2 sample. In this example, a positive sample is confirmed only when both targets are detected. Table 3 summarizes the analysis and interpretation of assay results. table 3 N Orf1ab PC NC Interpretation of results + + + – SARS-CoV-2 detected – + + – Suspected SARS-CoV-2 + – + – Suspected SARS-CoV-2 – – + – SARS-CoV-2 not detected any result any result – any result invalid result any result any result any result + invalid result

In addition, the primers in this case are not limited to primers having the same sequence as SEQ ID NOs: 1 to 48. It is worth noting that the sequence for hybridization does not require perfect complementarity to provide a stable hybrid. In many cases, when the ratio of base mismatches is less than 10%, a stable hybrid can still be formed. In addition, some strains of SARS-CoV-2 may also have genetic variations. Therefore, primers with sequences with at least 90% identity to SEQ ID NOs: 1 to 48 should have similar specificity to the original sequences, and thus can also be used for the detection of SARS-CoV-2.

Therefore, the embodiment of the present case provides a kit for detecting SARS-COV-2, which includes a first primer set and a second primer set. The first primer set is selected from the group consisting of: (a) primers having the nucleotide sequence of SEQ ID NOs: 1 to 4, or having at least 90% identity with SEQ ID NOs: 1 to 4 The primer of nucleotide sequence; (b) have the primer of the nucleotide sequence of SEQ ID NOs: 7 to 10, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 7 to 10 (c) primers having the nucleotide sequence of SEQ ID NOs: 13 to 16, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 13 to 16; (d) having SEQ ID NOs: ID NOs: primers of the nucleotide sequence of 19 to 22, or primers with a nucleotide sequence of at least 90% identity with SEQ ID NOs: 19 to 22; and (e) having SEQ ID NOs: 25 to The primer of the nucleotide sequence of 28, or the primer that has the nucleotide sequence of at least 90% identity with SEQ ID NOs: 25 to 28. The second primer set is selected from the group consisting of: (f) primers having the nucleotide sequence of SEQ ID NOs: 31 to 34, or having at least 90% identity with SEQ ID NOs: 31 to 34 The primer of nucleotide sequence; (g) have the primer of the nucleotide sequence of SEQ ID NOs: 37 to 40, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 37 to 40 and (h) primers having the nucleotide sequence of SEQ ID NOs: 43 to 46, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 43 to 46.

In some embodiments, each primer set may further include loop primers LF and LB to speed up the reaction. Therefore, in some embodiments, the primer set (a) further includes primers having the nucleotide sequences of SEQ ID NOs: 5 and 6, or having a core with at least 90% identity with SEQ ID NOs: 5 and 6 The primer of nucleotide sequence; Primer set (b) further comprises the primer that has the nucleotide sequence of SEQ ID NOs: 11 and 12, or has the nucleotide that has at least 90% identity with SEQ ID NOs: 11 and 12 sequence; primer set (c) further includes primers having the nucleotide sequences of SEQ ID NOs: 17 and 18, or having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 17 and 18 Primers; the primer set (d) further includes primers having the nucleotide sequences of SEQ ID NOs: 23 and 24, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 23 and 24; The primer set (e) further includes primers having the nucleotide sequences of SEQ ID NOs: 29 and 30, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 29 and 30; the primer set (f) further comprising primers with the nucleotide sequences of SEQ ID NOs: 35 and 36, or primers with at least 90% identical nucleotide sequences with SEQ ID NOs: 35 and 36; primer set (g ) further includes primers having the nucleotide sequences of SEQ ID NOs: 41 and 42, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 41 and 42; primer set (h) more Including primers having the nucleotide sequences of SEQ ID NOs: 47 and 48, or primers having nucleotide sequences at least 90% identical to SEQ ID NOs: 47 and 48.

The aforementioned primer set is designed to hybridize and amplify the target gene. Therefore, the embodiment of this case also provides a method for detecting SARS-COV-2. The method includes the steps of: (a) contacting the biological sample with the aforementioned set; (b) performing nucleic acid amplification of SARS-COV-2 on the biological sample; and (c) detecting the presence of the amplified nucleic acid of SARS-COV-2 .

In one embodiment, the method further includes the step of extracting nucleic acid from the biological sample before step (a).

In one embodiment, in step (b), the nucleic acid amplification is performed by a reverse transcription loop-mediated isothermal amplification reaction.

In one embodiment, primer set N_5 has a relatively better amplification curve than other primer sets in the N assay, and primer set Orf1ab_7 has a relatively better amplification curve than other primer sets in the Orf1ab assay, so the primer set N_5 and primer set Orf1ab_7 were selected to detect SARS-COV-2. Therefore, the embodiment of this case further provides a kit for detecting SARS-COV-2, which includes a first primer set and a second primer set. The first primer set comprises primers having a nucleotide sequence of SEQ ID NOs: 25 to 28, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 25 to 28, and the second primer Sets include primers having a nucleotide sequence of SEQ ID NOs: 43 to 46, or primers having a nucleotide sequence at least 90% identical to SEQ ID NOs: 43 to 46. Likewise, the first primer set may further include primers having the nucleotide sequences of SEQ ID NOs: 29 and 30, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 29 and 30 , and the second primer set may further include primers having the nucleotide sequences of SEQ ID NOs: 47 and 48, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 47 and 48. In addition, the embodiment of this case also provides a method for detecting SARS-COV-2 using the aforementioned kit.

Furthermore, each primer set in the N assay and the Orf1ab assay can independently detect SARS-CoV-2. Therefore, the embodiment of the present case further provides a kit for detecting SARS-COV-2, the kit includes at least one of a first primer set and a second primer set. The first primer set is selected from the group consisting of: (a) primers having the nucleotide sequence of SEQ ID NOs: 1 to 4, or having at least 90% identity with SEQ ID NOs: 1 to 4 The primer of nucleotide sequence; (b) have the primer of the nucleotide sequence of SEQ ID NOs: 7 to 10, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 7 to 10 (c) primers having the nucleotide sequence of SEQ ID NOs: 13 to 16, or primers having a nucleotide sequence of at least 90% identity with SEQ ID NOs: 13 to 16; (d) having SEQ ID NOs: ID NOs: primers of the nucleotide sequence of 19 to 22, or primers with a nucleotide sequence of at least 90% identity with SEQ ID NOs: 19 to 22; and (e) having SEQ ID NOs: 25 to The primer of the nucleotide sequence of 28, or the primer that has the nucleotide sequence of at least 90% identity with SEQ ID NOs: 25 to 28. The second primer set is selected from the group consisting of: (f) primers having the nucleotide sequence of SEQ ID NOs: 31 to 34, or having at least 90% identity with SEQ ID NOs: 31 to 34 The primer of nucleotide sequence; (g) have the primer of the nucleotide sequence of SEQ ID NOs: 37 to 40, or have the primer of the nucleotide sequence that has at least 90% identity with SEQ ID NOs: 37 to 40 and (h) primers having the nucleotide sequence of SEQ ID NOs: 43 to 46, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 43 to 46. Similarly, the embodiment of this case also provides a method for detecting SARS-COV-2 using the aforementioned kit.

This case has the following advantages. First of all, this case is based on a single-step real-time RT-LAMP reaction, so this case kit can be used in thermal cyclers or isothermal platforms with real-time fluorescence detection, so this case has wide applicability. In addition, due to the specific primer design of the LAMP reaction and the nature of the enzyme used in this case, the determination can be completed within 15 minutes, so this case has the advantage of reducing the reaction time. In addition, the two singleplex assays provide specific and sensitive detection. Thus, this case offers a possible solution as a point-of-care (POC) molecular diagnostic test for SARS-CoV-2.

In addition, multiple mutant strains of SARS-CoV-2 are circulating globally. Several new mutants appeared at the end of 2020, the most famous ones are the British B.1.1.7 line and the South African B.1.351 line, but they have no impact on the set of this case, because the target gene of the set of this case is not in the echinin region . What's more, LAMP is quite tolerant to mismatches in target genes, and this case set uses two single-plex assays (N assay and Orf1ab assay) to further ensure accuracy.

Even though the present invention has been described in detail by the above-mentioned embodiments, it can be modified in various ways by those skilled in the art, all of which are within the scope of the attached patent application.

none

Figures 1 to 5 show the amplification curves for detecting SARS-CoV-2 using primer sets N_1, N_2, N_3, N_4, and N_5. Fig. 6 shows the amplification curve of the plasmid DNA template of primer set N_5 and 16 copies. Figure 7 shows the specificity analysis of primer set N_5. Figures 8 to 10 show the amplification curves for detecting SARS-CoV-2 using primer sets Orf1ab_2, Orf1ab_3, and Orf1ab_7. Figure 11 shows the amplification curve of the primer set Orf1ab_7 and 19 copies of the plasmid DNA template. Figure 12 shows the specificity analysis of the primer set Orf1ab_7.

<110> Delta Electronics International (Singapore) Pte Ltd (DELTA ELECTRONICS INT'L (SINGAPORE) PTE LTD)

<120> Kit and method for detecting SARS-COV-2

<160> 48

<170> PatentIn version 3.5

<210> 1

<211> 41

<212>DNA

<213> Artificial sequence

<220>

<223> Synthetic Primers

<400> 1

<210> 2

<211> 41

<212>DNA

<213> Artificial sequence

<220>

<223> Synthetic Primers

<400> 2

<210> 3

<211> 18

<212>DNA

<213> Artificial sequence

<220>

<223> Synthetic Primers

<400> 3

<210> 4

<211> 20

<212>DNA

Claims (19)

A kit for detecting SARS-COV-2, comprising a first primer set and a second primer set, Wherein the first primer set is selected from the group consisting of: (a) primers having a nucleotide sequence of SEQ ID NOs: 1 to 4, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 1 to 4; (b) primers having the nucleotide sequence of SEQ ID NOs: 7 to 10, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 7 to 10; (c) primers having the nucleotide sequence of SEQ ID NOs: 13 to 16, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 13 to 16; (d) primers having a nucleotide sequence of SEQ ID NOs: 19 to 22, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 19 to 22; and (e) primers having a nucleotide sequence of SEQ ID NOs: 25 to 28, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 25 to 28; Wherein the second primer set is selected from the group consisting of: (f) primers having a nucleotide sequence of SEQ ID NOs: 31 to 34, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 31 to 34; (g) primers having a nucleotide sequence of SEQ ID NOs: 37 to 40, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 37 to 40; and (h) A primer having a nucleotide sequence of SEQ ID NOs: 43 to 46, or a primer having a nucleotide sequence at least 90% identical to SEQ ID NOs: 43 to 46. The set as claimed in item 1, wherein the primer set (a) further includes primers having the nucleotide sequences of SEQ ID NOs: 5 and 6, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 5 and 6 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (b) further includes primers having the nucleotide sequences of SEQ ID NOs: 11 and 12, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 11 and 12 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (c) further includes primers having the nucleotide sequences of SEQ ID NOs: 17 and 18, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 17 and 18 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (d) further includes primers having the nucleotide sequences of SEQ ID NOs: 23 and 24, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 23 and 24 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (e) further includes primers having the nucleotide sequences of SEQ ID NOs: 29 and 30, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 29 and 30 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (f) further includes primers having the nucleotide sequences of SEQ ID NOs: 35 and 36, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 35 and 36 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (g) further includes primers having the nucleotide sequences of SEQ ID NOs: 41 and 42, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 41 and 42 Primers for identical nucleotide sequences. The set as claimed in item 1, wherein the primer set (h) further includes primers having the nucleotide sequences of SEQ ID NOs: 47 and 48, or having at least 90% of the nucleotide sequences of SEQ ID NOs: 47 and 48 Primers for identical nucleotide sequences. A method for detecting SARS-COV-2, comprising steps: (a) contacting a biological sample with the kit as described in claim 1; (b) performing nucleic acid amplification of SARS-COV-2 on the biological sample; and (c) Detecting the presence of amplified nucleic acid from SARS-COV-2. The method according to claim 10, further comprising a step of extracting nucleic acid from the biological sample before the step (a). The method according to claim 10, wherein in the step (b), the nucleic acid amplification is performed by a reverse transcription loop-mediated isothermal amplification reaction. A kit for detecting SARS-COV-2, comprising a first primer set and a second primer set, wherein the first primer set includes primers with a nucleotide sequence of SEQ ID NOs: 25 to 28, or primers with Primers with a nucleotide sequence of at least 90% identity with SEQ ID NOs: 25 to 28, and the second primer set includes primers with a nucleotide sequence of SEQ ID NOs: 43 to 46, or primers with a nucleotide sequence with SEQ ID NOs: 43 to 46 ID NOs: 43 to 46 primers with at least 90% identical nucleotide sequences. The method according to claim 13, wherein the first primer set further comprises primers having the nucleotide sequences of SEQ ID NOs: 29 and 30, or has at least 90% identity with SEQ ID NOs: 29 and 30 The primers of the nucleotide sequence, and the second primer set further includes primers having the nucleotide sequences of SEQ ID NOs: 47 and 48, or having at least 90% identity with SEQ ID NOs: 47 and 48 Primers for nucleotide sequences. A method for detecting SARS-COV-2, comprising steps: (a) contacting a biological sample with the kit as described in claim 13; (b) performing nucleic acid amplification of SARS-COV-2 on the biological sample; and (c) Detecting the presence of amplified nucleic acid from SARS-COV-2. The method according to claim 15, further comprising a step of extracting nucleic acid from the biological sample before the step (a). The method according to claim 15, wherein in the step (b), the nucleic acid amplification is performed by a reverse transcription loop-mediated isothermal amplification reaction. A kit for detecting SARS-COV-2, including at least one of a first primer set and a second primer set, Wherein the first primer set is selected from the group consisting of: (a) primers having a nucleotide sequence of SEQ ID NOs: 1 to 4, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 1 to 4; (b) primers having the nucleotide sequence of SEQ ID NOs: 7 to 10, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 7 to 10; (c) primers having the nucleotide sequence of SEQ ID NOs: 13 to 16, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 13 to 16; (d) primers having a nucleotide sequence of SEQ ID NOs: 19 to 22, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 19 to 22; and (e) primers having a nucleotide sequence of SEQ ID NOs: 25 to 28, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 25 to 28; Wherein the second primer set is selected from the group consisting of: (f) primers having a nucleotide sequence of SEQ ID NOs: 31 to 34, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 31 to 34; (g) primers having a nucleotide sequence of SEQ ID NOs: 37 to 40, or primers having a nucleotide sequence of at least 90% identity to SEQ ID NOs: 37 to 40; and (h) A primer having a nucleotide sequence of SEQ ID NOs: 43 to 46, or a primer having a nucleotide sequence at least 90% identical to SEQ ID NOs: 43 to 46. A method for detecting SARS-COV-2, comprising steps: (a) contacting a biological sample with the kit described in claim 18; (b) perform nucleic acid amplification of SARS-COV-2 on the biological sample; and (c) Detecting the presence of amplified nucleic acid from SARS-COV-2.

Images