CN105002285A - Liquid-stage chip constant-temperature detection method for tiny RNA - Google Patents

Liquid-stage chip constant-temperature detection method for tiny RNA Download PDF

Info

Publication number
CN105002285A
CN105002285A CN201510460236.8A CN201510460236A CN105002285A CN 105002285 A CN105002285 A CN 105002285A CN 201510460236 A CN201510460236 A CN 201510460236A CN 105002285 A CN105002285 A CN 105002285A
Authority
CN
China
Prior art keywords
primer
target molecule
molecule
downstream primer
upstream primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510460236.8A
Other languages
Chinese (zh)
Inventor
黄庆
府伟灵
黄君富
夏涵
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Military Medical University TMMU
First Affiliated Hospital of TMMU
Original Assignee
First Affiliated Hospital of TMMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of TMMU filed Critical First Affiliated Hospital of TMMU
Priority to CN201510460236.8A priority Critical patent/CN105002285A/en
Publication of CN105002285A publication Critical patent/CN105002285A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Abstract

The invention discloses a liquid-stage chip constant-temperature index amplification and detection method for tiny RNA target molecules. By fixing upstream and/or downstream primers to the surfaces of encoding microspheres and marking the two sides of notch agent recognition sequences of the primers fixed to the surfaces of the encoding microspheres with fluorescence report molecules which have the fluorescence resonance energy transfer effect and cancellation molecules, finally the high-throughput detection of various target molecules is achieved through target molecule specificity detectable fluorescence signals on the surfaces of the encoding microspheres. The design difficulty of miRNA inherent attributes on the amplification detection method for the target molecules is lowered, a liquid-state constant-temperature index amplification and detection system based on oligonucleotides primers is provided, and the method for achieving constant-temperature index amplification and absolute quantification under the constant-temperature condition can be achieved.

Description

The liquid chip Constant Temperature Detection method of Microrna
Technical field
The invention belongs to life science and biological technical field, is a kind of liquid chip Constant Temperature Detection method that mode quantitative and qualitative analysis by liquid chip constant temperature exponential amplification detects multiple Microrna (microRNA, miRNA).
Background technology
Compare with nucleic acid molecule such as genomic dna, mRNA and long segment non-coding RNAs (lncRNA), Microrna (microRNA, miRNA) molecule has its singularity, as: nucleic acid molecule fragment minimum (≤22nt), GC content distribution extensively (5 ~ 95%), cause melting temperature (Tm) (melting temperature, Tm) difference large, be difficult to the amplimer and the detection probes that design coupling; The ratio extremely low (≤0.01%) of shared total serum IgE, needs highly sensitive detection method; Family molecule difference little (can only have single base difference) is high to the requirement of detection specificity; The expression level very different of different miRNA (can reach 4 orders of magnitude; As: tens copy/cell to 5 × 10 5copy/cell), require to detect linear wide ranges, can effectively identify low abundance miRNA simultaneously; Target sequence is present in pri-miRNA and pre-miRNA simultaneously; Lack poly (A) tail being similar to mRNA, make it be difficult to carry out reverse transcription detection by routine techniques means.The above-mentioned feature of miRNA proposes the specific demand near harshness to its nucleic acid molecule detection technique and method.Such as, minimum molecule fragment makes Standard PCR PRIMER DESIGN STRATEGY implement, and the base resolution capability of single base difference to primer or probe requires high, and the greatest differences of GC content causes primer and probe to be difficult to be oriented in homogeneous annealing temperature.
Since Late Cambrian miRNA in 1993, the detection method of miRNA from Northern Blot probe hybridization method gradually to high-flux sequence method (as: Solexa method and SoLiD method etc.), chip hybridization methods, fluorescence in situ hybridization (fluorescence in situ hybridization, ISH), real-time fluorescence reverse transcription quantitative PCR method (real-time reverse transcription quantitative PCR, RT-qPCR), the development of constant-temperature amplification detection technique.Due to the above-mentioned particular feature of miRNA target molecule, existing often kind of detection technique and method characteristic different, have his own strong points, but also have obvious shortcoming, thus make often kind of method have its optimal environment for use.
For the microarray technology based on chip hybridization methods the most frequently used at present, high-flux sequence method and RT-qPCR.The detection flux of high-flux sequence and microarray is large, and high-flux sequence also can be used for finding new miRNA, but the quantification accuracy of these two kinds of methods is poor, expensive, is generally applied to the primary dcreening operation research of miRNA.In addition, the preparation of high throughput sequencing technologies library is complicated, and the huge and complicated literature data analysis reaching megabyte (terabytes, TB) needs special computer resource and relevant bioinformatics tools and means, therefore, often provided by the company of specialty.Because the fragment of miRNA is little, and Tm value difference is greatly different, microarray technology can not carry out the hybridization efficiency of balanced different probe simply by the length increasing and reduce probe, therefore, often need by some special technique means, such as use lock nucleic acid probe (locked nucleic acid, LNA).The RT-qPCR technology being representative with stem ring primer RT-qPCR, poly (T) joint RT-qPCR is the method verifying that genomic level miRNA express spectra result of study is the most frequently used and the most classical, but this technology all needs reverse transcription step, experimental data normalization method by many factors restriction affects greatly on detected result tolerance range, " thermally denature-renaturation-extension " thermal cycle conditions needs highly purified miRNA, in addition, amplification efficiency is subject to impact and the restriction of many factors, easily occurs non-specific amplification; The amplified reaction time is long, general needs several hours; Be limited to thermokinetics feature, accurately cannot detect the differential expression of less than 2 times.
Desirable miRNA detection method should have following characteristics: highly sensitive, can reach and detect a small amount of or micro-parent material; Specificity is good, can identify the miRNA only having single base difference; Easy and simple to handle, without the need to reagent and the equipment of costliness; Versatility is high, can be applied to multiple field such as tissue and cell in-situ detection, high throughput testing, accurate quantification detection of miRNA.But as mentioned above, be limited to the particular attribute of miRNA target molecule and the inherent limitation of prior art, the existing detection technique of miRNA often can only meet above-mentioned portion requirements.If a kind of techniques and methods that can meet the demand better newly can be developed, on the one hand, can be more widely used, such as, adopt a kind of techniques and methods just can realize the application in multiple field, thus effectively expand the depth of investigation and the range of non-coding RNA (non-coding RNA, ncRNA).
Isothermal amplification technology is the substantially constant nucleic acid amplification technologies of temperature.Relative to the alternating temperature amplification technique taking PCR as representative, isothermal amplification technology has following main advantage: temperature of reaction is single, low to the requirement degree of equipment; There is not temperature variation, amplification efficiency and amplified nucleic acid fragment length are all better than Standard PCR technology; Reaction times is short, at 1 hour, even can realize effective amplification of target molecule in several minutes, and sensitivity is suitable with round pcr with specificity, even better.Above-mentioned technical superiority makes isothermal amplification technology be widely applied in the every field of life science, and, be particularly suitable for the detection of miRNA.
At present, develop multiple nucleic acids isothermal amplification technology, wherein, representative technology mainly comprises: strand displacement amplification (strand displacement amplification, SDA), ring mediation nucleic acid isothermal amplification technology (loop-mediated isothermal amplification, LAMP), rolling circle amplification (rolling circle amplification, RCA), depend on amplification (the nucleic acidsequence-based amplification of nucleotide sequence, NASBA), depend on isothermal amplification technique (the helicase-dependent isothermal DNAamplification of helicase, HAD), transcript mediated amplification (transcription-mediated amplification, TMA), single primer isothermal duplication (single primerisothermal amplification, SPIA), signal mediate rna amplification technique (signal mediatedamplification of RNAtechnology, SMART), constant temperature exponential amplification (exponentialamplification reaction, EXPAR).But, due to the singularity of miRNA target molecule, only have part constant temperature technology to be suitable for the detection of miRNA, such as SDA, RCA and EXPAR.But be limited to the technical limitation of existing constant temperature technology, existing miRNA Constant Temperature Detection technology often can only detect single miRNA target molecule, cannot realize detection that is multiple or high-throughput miRNA.
No matter be alternating temperature or isothermal amplification technology, archaeal dna polymerase is all indispensable enzymes of its reaction system.Generally speaking, archaeal dna polymerase has one or more biological functions following usually: 5' → 3' amplification active (amplification activities), 5' → 3' exonuclease activity (exonuclease activities), 3' → 5' exonuclease activity, strand-displacement activity (strand displacement activities).
No matter be alternating temperature or isothermal amplification technology, in primer extension process, when its 3'-extending end arrives at downstream DNA chain, namely there is another double-stranded DNA formed with template molecule complementary pairing (double strand DNA in its 3'-extending end, dsDNA), during region, if archaeal dna polymerase neither possesses 5' → 3' 5 prime excision enzyme activity, also strand-displacement activity is not possessed, so, the 3'-end extension of primer is then subject to the prevention of downstream DNA chain and cannot continues to extend.But, when archaeal dna polymerase has 5' → 3' 5 prime excision enzyme activity (as: Taq archaeal dna polymerase), downstream DNA chain can be hydrolyzed into mononucleotide according to 5' → 3' direction by this activity, thus the extension of primer is continued, as the hydrolysis probes technology in real-time fluorescence PCR; Or when archaeal dna polymerase has strand-displacement activity (as: Bst archaeal dna polymerase), this activity can make the extension of primer be continued, meanwhile, downstream DNA chain is peeled off from dsDNA region, makes the single stranded nucleic acid molecule that downstream DNA chain becomes free.The above-mentioned strand-displacement activity of archaeal dna polymerase is widely used in multiple constant-temperature amplification system, as SDA, LAMP, RCA etc.
There is strand-displacement activity, lack the strand replacement reaction that the archaeal dna polymerase of 5' → 3' 5 prime excision enzyme activity is widely used in relying on double chain acid molecule breach.So-called double chain acid molecule breach refers to that a chain of double chain acid molecule keeps integrity, the phosphodiester bond rupture between certain two contiguous nucleotides of another chain, thus forms a breach.The nucleic acid molecule end of these breach both sides is that 3'-terminal hydroxy group (3'-hydroxy group, 3'-OH) and 5'-hold phosphate group (5'-phosphate group, 5'-PO4) respectively.Under the effect that above-mentioned archaeal dna polymerase exists, have nucleic acid molecule extension from indentation, there 3'-OH of 3'-OH, meanwhile, the old chain in downstream is peeled off by its nascent nucleic acid strand extending synthesis, makes downstream old chain be transformed into free single stranded nucleic acid molecule.
Breach restriction endonuclease (nicking endonuclease), is also breach enzyme (nicking enzyme), is the class specific type enzyme in II type restriction enzyme (restriction endonuclease).Have been found that more than 280 plant breach enzyme at present, commercial nearly more than 20 plant, and its thermostability is to reaching 65 DEG C or higher.This fermentoid only cuts a chain in double chain acid molecule, causes a double chain acid molecule breach, and the nucleic acid molecule end of these breach both sides is 3'-OH and 5'-PO4 respectively.Breach endonuclease recognition sequence (nickingendonuclease recognition sequences, NERS) is called as by the nucleotide sequence of breach restriction endonuclease identification wholly or in part in double chain acid molecule.
A kind of enzyme (as: HincII) of specific type is also had in restriction enzyme, this fermentoid has the function of convenient restriction restriction endonuclease, can identify and at restriction endonuclease recognition sequence (restriction endonuclease recognition sequences, the RERS) place of natural double chain acid molecule simultaneously enzyme cut two chains of double chain acid molecule.But, when the chain of in double chain acid molecule at least contains a derivatized nucleotide (as: time α sulfydryl-deoxynucleotide (α-thio deoxynucleotide) in RERS sequence, this derivatized nucleotide can stop restriction enzyme to cut this nucleic acid molecule chain, therefore, the native nucleic acid molecule chain that another does not contain derivatized nucleotide can only be cut.This only have the double chain acid molecule that the RERS sequence of a chain contains the cutting of prevention restriction enzyme to be called as half modification RESR.Visible, can identify and cut half restriction enzyme modifying RERS that there is the function similar to breach restriction endonuclease, can for the preparation of double chain acid molecule breach.
The above-mentioned biologic activity that the restriction enzyme of RESR is modified in breach restriction endonuclease and identifiable design hemisect half is widely used in relying on the strand replacement reaction of double chain acid molecule breach, and, this strand replacement reaction principle is widely used in multiple isothermal amplification technology, as SDA, EXPAR etc.Such as, breach restriction endonuclease (or: the restriction enzyme of RESR is modified in identifiable design hemisect half) and there is strand-displacement activity archaeal dna polymerase acting in conjunction under, there is nucleic acid molecule extension from indentation, there 3'-OH of 3'-OH, meanwhile, the old chain in downstream is peeled off by its nascent nucleic acid strand extending synthesis.The breach be closed because of chain extension can repeat to produce under the effect of breach restriction endonuclease (or: the restriction enzyme of RESR is modified in identifiable design hemisect half), thus the process of " cutting-extension-strand displacement " can be repeated, and in the process, constantly peel off or discharge single stranded nucleic acid molecule (the Walker GT identical with downstream old chain sequence with linear or exponential manner, et al.Strand displacement amplification--an isothermal, in vitro DNAamplification technique.Nucleic Acids Res.1992, 20 (7): 1691-6.Walker GT, et al.Strand displacement amplification--an isothermal, in vitro DNAamplification technique.Nucleic Acids Res.1992, 20 (7): 1691-6.Van Ness J, et al.Isothermal reactions for the amplification of oligonucleotides.Proc Natl Acad SciUSA.2003, 100 (8): 4504-9.Shi C, et al.Exponential strand-displacementamplification for detection of microRNAs.Anal Chem.2014, 86 (1): 336-9).
Lock nucleic acid (locked nucleid acid, LNA) a kind of special double-ring oligonucleotide derivative, 2'-O and 4'-C of the β-D-RIBOSE of its ribose forms Oxymethylene bridge, sulphur methylene bridge or amine methylene bridge by different shrink effects, and connect into annular, this annular bridge has locked the N configuration of furanose C3'-inner mold, reduce the snappiness of ribose structure, add the stability of phosphate backbone local structure.Because LNA and DNA/RNA structurally has identical phosphate backbone, therefore it has good recognition capability and powerful avidity to DNA, RNA.Compared with other oligonucleotide analogs, DNA/LNA inserted type oligonucleotide has good recognition capability to single nucleotide variation, is widely used in different kinds of molecules Biological Detection technology with DNA/LNA chimeric primers or probe geometries.
Liquid chip (liquid array, liquid chip) be also suspending chip (suspension array, suspension chip), grow up the mid-90 in 20th century, it is one multi-functional technology platform very flexibly, can the biomacromolecule detection such as albumen, nucleic acid be carried out, and the research such as acceptor and part discriminance analysis.Typical liquid chip mainly uses two or three and the fluorescence dye of different amount embeds in the microballoon of the cross-linked polymer formation that such as ps particle is formed, thus make often kind of microballoon all have unique fluorescent signal, therefore, this type of microballoon is also fluorescence-encoded micro-beads.When having different fluorescent signal uniqueness, or there is different fluorescence-encoded microballoon modified when can detect the marker of different target molecule respectively, and, when the correlation detection thing that target molecule produces can be attached to microsphere surface and discharge fluorescent reporter molecule signal, just can according to the multiple different target molecule of fluorescence-encoded feature high-throughput identification of microballoon.When the fluorescence dye of use two kinds amount different from three kinds embeds microballoon, can be formed respectively nearly 100 with 500 kinds of difference fluorescence-encoded microballoons, thus in single detecting unit, nearly 100 and 500 kind of different target molecule can be realized respectively, in specificity, high-throughput, high responsive, the existing detection technique of major part that is all better than nucleic acid and albumen in repeatability, sample consumption are few etc.For the liquid chip detection platform of the commercial Luminex company of the U.S. used clinically, the detection of Luminex liquid chip is the new technique platform of comprehensive flow cytometer, microballoon, laser and traditional chemical, digital processing.This technology can be widely used in multi-platform detection.The core of this technology is: 1. polystyrene microsphere inside by the method dyeed by two kinds of fluorescence proportionings carry out can on reach 100 kinds of coded combinations; 2. often kind of fluorescence-encoded micro-beads gene probe that covalently coating is special respectively or antibody antigen albumen probe carry out the target molecule in specific combination sample to be tested; 3. reaction system target is labeled corresponding reporter fluorescence simultaneously; 4. finally by the coding microball in Flow Cytometry separation of liquid suspension reaction system, and single coding microball is made to pass through measured zone successively; 5. measured zone is that laser and liquid stream cross part, and the coding fluorescence molecule in reporter fluorescence molecule and microballoon is subject to quantitative laser excitation and qualitative laser excitation respectively, excites rear optical signal to be converted into electrical signal; 6. by the analyzing and processing of computer, the quantitative and qualitative analysis information of the analyte that microballoon combines is determined.Except fluorescence-encoded micro-beads, also has other Multi-encoding microballoon, comprise quantum point coding microball, fluorescence-magnetic code microballoon, up-conversion luminescence coding microball, Raman spectrum coding microball etc., its microballoon coding producing principle and detection mode and above-mentioned fluorescence-encoded micro-beads similar, but expanded coding microball further, or the application category of liquid chip.When liquid chip is applied to the nucleic acid target molecule detection comprising miRNA, often depend on merely the mode of nucleic acid hybridization, target molecule needs amplification in advance, and, the hybridization of amplified production or target molecule and microballoon the step such as needs repeatedly to wash and removes non-specific hybridization and background signal disturbs, there are the problems such as detecting step is loaded down with trivial details, length consuming time, constrain the application of liquid chip in field of nucleic acid detection to a certain extent.
Therefore, if effectively integrate breach enzyme, there is the synergy advantage of strand-displacement activity archaeal dna polymerase and fluorescent label DNA/LNA chimeric primers, under higher single isothermal condition, the exponential amplification of target molecule just can be realized by " cutting-extension-strand displacement " autonomous chain circulation, simultaneously, above-mentioned constant temperature exponential amplification methods is combined with liquid chip, greatly can simplify existing liquid chip detecting step, 100 kinds can be completed in very short time, even up to the detection of 500 kinds of target molecules, thus effectively solve miRNA prior art bottleneck, realize the clinical practice application that miRNA detects.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of constant temperature exponential amplification system being fixed on the primer mediation on coding microball surface, this system can realize the constant temperature exponential amplification of target molecule by " cutting-extension-strand displacement " autonomous chain circulation on coding microball surface, and, the detectable signal that this exponential amplification discharges by microsphere surface immobilized primer characterizes, carry out quantitative and qualitative analysis detection to reaching 100 to 500 kinds of target molecules in theory simultaneously, there is detected energy high, high specificity, responsive high, reproducible, sample consumption is few, consuming time short, the advantages such as step is easy.
In order to solve the problems of the technologies described above, the invention provides following technical scheme:
Base case: the liquid chip Constant Temperature Detection method of Microrna, comprise reaction mixture, reaction mixture comprises following reacted constituent:
1. there is the miRNA target molecule of 3'-terminal hydroxy group;
2. upstream primer and downstream primer;
3. coding microball
4. archaeal dna polymerase;
5. the breach agent of upstream primer and downstream primer breach agent recognition sequence is identified;
6. triphosphate deoxy-nucleotide;
7. ion and the buffer system of above-mentioned archaeal dna polymerase and breach agent biologic activity is met;
Described upstream primer and downstream primer are the sense strand sequence containing jagged dose of recognition sequence, and its 5' → 3' base is all followed successively by the recognition sequence district of anchor series district, specific recognition miRNA target molecule sequence; The anchor series district of upstream primer and downstream primer and miRNA target molecule are without homology, and the recognition sequence district of upstream primer, downstream primer is complementary with the 3'-terminal sequence of miRNA target molecule and miRNA target molecule complementary strand respectively;
Described upstream primer and downstream primer have target molecule specificity, and reaction mixture comprises the specific upstream primer of multiple target molecule and downstream primer, often kind of specific upstream primer of target molecule and/or downstream primer are fixed on the surface of coding microball by its 5'-end, and, be fixed on the upstream primer on coding microball surface and/or downstream primer to mark respectively in the both sides (that is: 5'-end and 3'-end) of its breach agent recognition sequence there is FRET (fluorescence resonance energy transfer) (fluorescence resonance energy transfer, FRET) fluorescent reporter molecule acted on and quencher molecule (Fig. 1, Fig. 2).
Adopt the liquid chip Constant Temperature Detection method of the Microrna of technical solution of the present invention, breach agent (nicking agent, NA) be used to identify and cutting upstream primer, downstream primer breach agent recognition sequence (nicking agent recognition sequences, NARS).When the breach agent recognition sequence of primer is breach endonuclease recognition sequence (nicking endonuclease recognition sequences, NERS) time, breach agent used is the breach restriction endonuclease (nicking endonuclease, NE) identifying this breach endonuclease recognition sequence; When the breach agent recognition sequence of primer is half modification restriction endonuclease recognition sequence (restrictionendonuclease recognition sequences, RERS) time, breach agent used is the restriction enzyme (restriction endonuclease, RE) identifying this half modification RERS; In the reactive mixture, thing to be detected is the various biological specimens containing miRNA target molecule in the present invention.
Triphosphate deoxy-nucleotide, generally includes dCTP, dGTP, dTTP or dATP, synthesizes at biological DNA, and plays raw material effect in the chain extension reaction of DNA mediation.
Principle of work of the present invention and beneficial effect are: this system is reacted under constant temperature, upstream primer and downstream primer are the sense strand sequence containing jagged dose of recognition sequence, and its 5' → 3' base is followed successively by the recognition sequence district of anchor series district, specific recognition miRNA target molecule sequence.The recognition sequence district of upstream primer P1 and downstream primer P2 is complementary with the 3'-terminal sequence of miRNA target molecule and miRNA target molecule complementary strand (that is: miRNA*) respectively, therefore, upstream primer and downstream primer can identify miRNA target molecule or miRNA target molecule complementary strand respectively, and have single nucleotide variation recognition capability; The sequence in anchor series district and miRNA target molecule, without homology, can not produce non-specific hybridization with miRNA target molecule or miRNA target molecule complementary strand.In amplification procedure, upstream primer P1 and downstream primer P2 anchor series district can hold extension products to form stable heteroduplex with the 3'-of miRNA target molecule and miRNA target molecule complementary strand respectively, thus enable upstream primer P1 and downstream primer P2 respectively " grappling " hold extension products end at the 3'-of miRNA target molecule and miRNA target molecule complementary strand, and, " grappling " should can form breach agent recognition sequence double chain acid molecule in the anchor series district of primer, thus enable breach agent at the breach agent recognition sequence positive-sense strand cutting primer of primer, and under the synergy of archaeal dna polymerase, continuous generation nascent DNA chain, archaeal dna polymerase typically refers to RNA dependent form archaeal dna polymerase.Therefore, when the recognition sequence district of upstream primer and downstream primer identifies miRNA target molecule and miRNA target molecule complementary strand and after forming heteroduplex respectively, under the effect of archaeal dna polymerase, upstream primer, downstream primer, miRNA target molecule, miRNA target molecule complementary strand all produce 5' → 3' direction chain extension, and at upstream primer and miRNA target molecule, form two kinds of complete double chain acid molecules between downstream primer and miRNA target molecule complementary strand respectively, then, breach agent is at breach agent recognition sequence sense strand sequence place cutting upstream primer and downstream primer.Now, upstream primer and downstream primer are under the effect of archaeal dna polymerase, extend nascent DNA chain in indentation, there respectively, this nascent DNA chain and original miRNA target molecule or miRNA target molecule complementary strand are complementary respectively, namely new miRNA target molecule or miRNA target molecule complementary strand.These new miRNA target molecules or miRNA target molecule complementary strand constantly increase from indentation, there cutting-extension-strand displacement process under the synergy of breach agent and archaeal dna polymerase formation double chain acid molecule in cement out, trigger the upstream primer of a new round and the above-mentioned reaction of downstream primer, circulation like this, realizes the exponential amplification of miRNA target molecule under constant temperature.In above process, the anchor series district of upstream primer, downstream primer then enables said process continue to occur because of its " grappling " effect; Upstream primer and/or downstream primer are fixed on the surface of coding microball, and upstream primer and/or downstream primer mark fluorescent reporter molecule and the quencher molecule with FRET effect, therefore, when after the amplification of its occurrence index, fluorescent reporter molecule is luminous, thus by the different target molecule of fluoroscopic examination, simultaneously can carry out quantitative and qualitative analysis detection to nearly 100 to 500 kinds of target molecules, have that detected energy is high, high specificity, sensitivity is high, reproducible, sample consumption is few, short, the advantage such as step is easy consuming time.
At the preferred version one of base case, the described specific upstream primer of often kind of target molecule and downstream primer are fixed on a kind of surface (Fig. 3) of coding microball simultaneously;
Or, often kind of target molecule only have it to have surface (Fig. 4) that specific upstream primer is fixed on a kind of coding microball;
Or, often kind of target molecule only have it to have surface (Fig. 5) that specific downstream primer is fixed on a kind of coding microball;
Or the specific upstream primer of one or more target molecules and another kind or more the specific downstream primer of other target molecule is fixed on the surface of same coding microball simultaneously.
All can realize a kind of coding microball can detect multiple target molecule simultaneously, certainly, also can realize a kind of coding microball and detect a kind of target molecule, not affect the methodology parameter such as sensitivity and specificity of detection method.
Preferred version two at base case: described coding microball comprises fluorescence-encoded micro-beads, quantum point coding microball, fluorescence-magnetic code microballoon, up-conversion luminescence coding microball, Raman spectrum coding microball, often kind of coding microball has discernible uniqueness mark, in same reaction system, use Multi-encoding microballoon simultaneously.Such as, the fluorescence dye of two or three different amount is embedded polystyrene, the fluorescence-encoded micro-beads that at least 100 kinds and 500 kinds have different fluorescent signal uniqueness can be obtained respectively.
Preferred version three at base case: preferred coding microball is fluorescence-encoded micro-beads.
Preferred again scheme four at base case and preferred version one ~ tri-: the anchor series district 5'-end of the described upstream primer being fixed on coding microball surface and/or downstream primer also has poly base, and poly base comprises poly born of the same parents gland pyrimidine bases (Poly (T n)) or poly adenine base (Poly (A n)), and the surface of coding microball is fixed on by the 5'-end of described poly base, to simplify the surface that above-mentioned primer is fixed on coding microball, and, can minimize and (spacehindrance) is hindered to the space of enzyme effect (as: cutting action of breach agent), and increase the hybridization efficiency of primer and target molecule, improve constant-temperature amplification efficiency.Poly (T n) or Poly (A n) do not affect typical structure and the function thereof of primer of the present invention.
Preferred version again five on preferred version four, described target molecule specific upstream primer and/or downstream primer are fixed on the mode on coding microball surface, comprising: fix with the combination of covalent linkage and non-co-part key;
Or, be coupled mode by physical adsorption and/or chemistry and fix;
Or alkyl or the aryl compound with amido are fixed as connection peptides;
Or, there is the alkyl of thiol group or aryl compound as connection peptides immobilized primer;
Or, fixed by arm molecule.
Its fixing means comprises known fixing means in the technical field of the invention, comprise and be coupled mode by physical adsorption and/or chemistry upstream primer and/downstream primer are connected to the surface of coding microball, or, comprise there is amido alkyl or aryl compound as connection peptides immobilized primer, or, comprise the alkyl with thiol group or aryl compound is used in probe immobilized primer as connection peptides, or, be included in coding microball surface and/or primer mark, modify or synthesize and have arm molecule, and by arm molecule therebetween, primer is fixed on the surface of coding microball by the interaction of arm molecule and other molecule.
Preferred version six on preferred version five, the described specific upstream primer being fixed on the different target molecules of same-code microballoon and/or downstream primer mark have different fluorescent reporter molecules and the quencher molecule of FRET (fluorescence resonance energy transfer) effect.The upstream primer that coding microball surface is fixing and/or downstream primer comprise can produce detection signal there is fluorescent reporter molecule (donor molecule) that FRET (fluorescence resonance energy transfer) (fluorescence resonance energytransfer, FRET) acts on and quencher molecule (acceptor molecule) forms.In FRET technology, energy donor (that is: fluorescent reporter molecule or donor molecule) has fluorescence, and energy acceptor (that is: quencher molecule or acceptor molecule) can be fluorescence or non-fluorescent material.Two kinds of marks (that is: fluorescent reporter molecule and quencher molecule) with FRET effect of the present invention (are produced the part of breach cleavage sites by the specific site of in primer, i.e. breach agent recognition sequence positive-sense strand) be separated, thus, under target molecule existent condition, breach agent can at the breach agent recognition sequence positive-sense strand cutting primer of primer, this cleavage reaction can cause fluorescent reporter molecule and quencher molecule to be separated from each other, lose FRET effect, thus make fluorescent reporter molecule discharge fluorescent signal, produce the detected fluorescent signal characterizing target molecule.The primer fixed due to often kind of coding microball surface corresponds to a kind of specific miRNA target molecule, and therefore, the coding microball kind by discharging fluorescent signal determines the kind of the miRNA target molecule existed in thing to be detected.Fluorescent reporter molecule and quencher molecule are fluorescent substance, all can utilize known any material in the technical field of the invention, comprise: fluorescence phycoerythrin (PE, Fluorescentalgae of eggs, phycoerythin) (620), Cy2 tM(506), YO-PRO tM-1 (509), YOYO tM-1 (509), Calcein (517), FITC (518), FluorX tM(519), Alexa tM(520), Rhodamine 110 (520), Oregon Green tM500 (522), Oregon Green tM488 (524), RiboGreen tM(525), Rhodamine Green tM(527), Rhodamine 123 (529), MagnesiumGreen tM(531), Calcium Green tM(533), TO-PRO tM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPYTMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3TM (570), Alexa tM546 (570), TRITC (572), Magnesium Orange tM(575), Phycoerythrin R & B (575), RhodaminePhalloidin (575), Calcium Orange tM(576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine RedTM (590), Cy3.5TM (596), ROX (608), CalciumCrimson tM(615), AlexaTM 594 (615), Texas Red (615), Nile Red (628), YO-PROTM-3 (631), YOYOTM-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO tM-3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 tM(670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar650 (566), Quasar570 (667), Quasar 670 (705) and Quasar 705 (610).The numeral of bracket is the maximum emission wavelength represented with nanometer unit.Quencher molecule utilizes the known black quencher molecule of non-fluorescence can carrying out cancellation to the fluorescence of wide range of wavelength or specific wavelength in the technical field of the invention, comprises black hole quencher, (BHQ:black hole quencher; Comprise BHQ1, BHQ2, BHQ3), 4-[4-(dimethylamino) benzeneazo] phenylformic acid (DABCYL:4-[4-(Dimethylamino) phenylazo] benzoic acid).
In the FRET mark of primer of the present invention, fluorescent reporter molecule comprises the donor of FRET, and quencher molecule comprises the acceptor of FRET, such as, fluorescein(e) dye (fluorescein dye) is reporter molecules, and rhodamine (rhodamine dye) is quencher molecule.
Fluorescent reporter molecule of the present invention and quencher molecule are all positioned at the anchor series district of primer, and, lay respectively at the 5'-end of breach agent recognition sequence and the optional position of 3'-end; Or fluorescent reporter molecule and quencher molecule lay respectively at anchor series district and recognition sequence district, and, lay respectively at the 5'-end of breach agent recognition sequence and the optional position of 3'-end.The common trait of above-mentioned mark is, because primer is fixed on coding microball surface by its 5'-end, there is the condition of target molecule in reaction system under, the primer being fixed on coding microball surface discharges fluorescence in the cutting action of its breach agent recognition sequence positive-sense strand because of breach agent, this fluorescence is attached to coding microball surface because of the 5'-end fixed action of primer, thus judge to there is target molecule in detection system by the fluorescent signal that the primer that coding microball surface is fixing produces, realize the qualitative detection of target molecule.When under the condition that there is not target molecule corresponding to its immobilized primer in reaction system, the primer being fixed on microsphere surface can not be cut by breach agent, its fluorescent reporter molecule and quencher molecule do not produce fluorescent signal because of FRET effect, now, its coding microball surface also can not detect the detected fluorescent signal that primer produces, thus judges to there is not target molecule in detection system.Meanwhile, the detected fluorescence signal intensity of primer generation fixed due to microsphere surface and the Initial abundance positive correlation of target molecule, therefore, the fluorescence intensity of the primer release can fixed further by microsphere surface realizes the detection by quantitative of target molecule.
The principle of its work is: when there is not miRNA target molecule in reaction system, is fixed on the fluorescent reporter molecule of the primer on coding microball surface and quencher molecule because of FRET effect to make primer not produce fluorescent signal; When there is miRNA target molecule in reaction system, upstream primer, downstream primer, miRNA target molecule and the miRNA target molecule complementary strand produced thereof all can form complete double chain acid molecule under the effect of archaeal dna polymerase, thus enable nicking agent cutting be fixed on the upstream primer on coding microball surface and/or the breach agent recognition sequence positive-sense strand of downstream primer, now, the fluorescent reporter molecule and the quencher molecule that are fixed on coding microball surface lose FRET (fluorescence resonance energy transfer) effect and produce detectable fluorescent signal.When employing Multi-encoding microballoon in reaction system, and, often kind of coding microball secures the specific upstream primer of target molecule and/or downstream primer, just can in same detection system simultaneously quantitative and qualitative analysis detect multiple target molecule.Such as, according to existing fluorescence-encoded micro-beads, at least can detect nearly 100 to 500 kinds of miRNA target molecules in single detection system simultaneously.
As depicted in figs. 1 and 2, the upstream primer on coding microball surface is fixed on and/or downstream primer comprises the fluorescent reporter molecule and quencher molecule with FRET effect by its 5'-end, and, fluorescent reporter molecule and quencher molecule lay respectively at 5'-end and 3'-end optional position (Fig. 1) of primer anchor series district breach agent recognition sequence, or, fluorescent reporter molecule and quencher molecule lay respectively at primer anchor series district and recognition sequence district, further, the 5'-end and the 3'-that lay respectively at breach agent recognition sequence hold optional position (Fig. 2).The upstream primer and/or the downstream primer that are not fixed on coding microball surface mark the fluorescent reporter molecule and the quencher molecule (Fig. 1, Fig. 2) that do not comprise FRET effect.When the primer being fixed on coding microball surface is cut by breach agent, detectable fluorescent signal can be produced, and, because its 5'-end is fixed on coding microball surface, therefore, make coding microball surface produce producible fluorescent signal, and this fluorescent signal have target molecule specificity (Fig. 1, Fig. 2).
As shown in Figure 3,5' → 3' base sequence of upstream primer P1 and downstream primer P2 is breach agent recognition sequence (nicking agent recognition sequences, NARS) the anchor series district at sense strand sequence place, the recognition sequence district of specific recognition target miRNA successively.Above-mentioned primer has following three distinguishing feature (Fig. 1,2): the recognition sequence district of primer P1 and P2 is complementary with the 3'-terminal sequence of target miRNA and complementary strand (that is: miRNA*) thereof respectively, not only independent but also interactional " cutting-extension-strand displacement " linear amplification can be mediated respectively under the synergy of breach enzyme and archaeal dna polymerase, finally, the two coupling becomes an autonomous chain circulation, finally realizes the exponential amplification of target miRNA; The recognition sequence district specific position of the two all can introduce the LNA of proper amt, thus improve amplification temperature (reaching 55 ~ 65 DEG C), the Tm value (between 50 ~ 55 DEG C) of homogenization different GC content miRNA, strengthens the recognition capability of primer-template single base mismatch; Under the two can be fixed on coding microball surface condition simultaneously (Fig. 2), after primer to be combined with template specificity and to extend into double chain acid molecule, the cutting of breach agent will cause primer release fluorescence.Basic technique principle is as shown in Figure 2: target miRNA and primer P1 complementation combines, and because ripe miRNA and primer P1 all has 3'-OH, can extend into complete double chain acid molecule each other; Breach agent is at NARS sense strand sequence cutting primer P1, release fluorescent signal, simultaneously, the 5'-of this breach holds nucleic acid molecule, namely primer 5'-holds the 3'-terminal sequence of anchor series district place nucleic acid molecule because having 3'-OH, can extend further, and under the strand-displacement activity effect of archaeal dna polymerase, displace the nascent DNA chain (that is: miRNA*) with target miRNA complete complementary, thus form first " cutting-extension-strand displacement " linear amplification; The miRNA* that primer P1 discharges according to similarity principle, can trigger second " cutting-extension-strand displacement " linear amplification of primer P2 mediation again, and release and the identical nascent DNA chain (that is: miRNA) of target miRNA sequence; First with second linear amplification by the nascent DNA chain of separately release each other coupling become an autonomous chain circulation, and, often generate a nascent DNA chain, primer P1 or P2 all can be caused to discharge fluorescence, the fluorescence intensity of reaction system release and the proportional relation of initial amount of target miRNA; When the upstream primer that on often kind of coding microball, only fixing a kind of miRNA target molecule is corresponding and/or downstream primer, the upstream primer that often kind of miRNA target molecule is corresponding and/or downstream primer can mark identical fluorescent reporter molecule, now, often kind of coding molecule only detects a kind of miRNA target molecule; Or, when often kind of coding microball fixes upstream primer corresponding to two or more miRNA target molecule and/or downstream primer, with this understanding, the upstream primer that the fixing often kind of miRNA target molecule in often kind of coding microball surface is corresponding and/or downstream primer mark different fluorescent reporter molecules, but the upstream primer that the surperficial fixing miRNA target molecule of different types of coding microball is corresponding and/or downstream primer can mark identical fluorescent reporter molecule, with this understanding, a kind of coding microball can detect two or more different miRNA target molecule.Because the fluorescent signal of primer release is all attached to the surface of coding microball, therefore, detect while realizing multiple target molecule by the fluorescent signal kind of often kind of coding microball release in reaction system and abundance.When often kind of coding microball only fixes upstream primer corresponding to a kind of miRNA target molecule and/or downstream primer, the method for the invention can utilize existing liquid microarrays technology to detect 100 to 500 kinds of miRNA target molecules in theory simultaneously.When often kind of coding microball fixes upstream primer corresponding to two or more miRNA target molecule and/or downstream primer, the miRNA target molecule that the method for the invention can utilize existing liquid microarrays technology to detect in theory is simultaneously more than the twice of 100 to 500 kinds and twice, the direct positive correlation of primer kind quantity that its concrete multiple value is corresponding with miRNA target molecule fixing on often kind of coding microball.
Preferred version seven on base case, the specific upstream primer of described miRNA target molecule and/or the anchor series district of downstream primer and/or recognition sequence district introduce derivatized nucleotide, and derivatized nucleotide comprises lock nucleic acid, peptide nucleic acid(PNA) or thio-modification base.
Preferred version eight on base case, containing the Nucleotide with miRNA target molecule and complementary sequence 3'-end penultimate and/or the 3rd bit base mispairing in the specific upstream primer of described miRNA target molecule and/or the recognition sequence district of downstream primer;
Or, in described reaction mixture, add the bioactive molecules that can suppress non-specific amplification, comprise Taq MutS, RecA.
Preferred version nine on base case, described archaeal dna polymerase is the archaeal dna polymerase with strand-displacement activity; Or described archaeal dna polymerase does not have strand-displacement activity, and in described reaction mixture, add the bioactive molecules with strand-displacement activity.
The preferred version again ten of any one in above base case or preferred version, the range of reaction temperature of described constant temperature is 37-70 DEG C.
The temperature of reaction of the constant temperature described in preferred version 11 on preferred version ten is 37 DEG C, 55 DEG C, 60 DEG C or 65 DEG C.
The preferred version again 12 of any one in above base case or preferred version, the described reaction times is 10-80min.
Preferred version 13 on preferred version 12, the described reaction times is 10min, 20min, 30min, 40min, 50min or 60min.
In addition, present invention also offers the detection reagent utilizing the real-time constant temperature exponential amplification methods of liquid chip of the present invention or test kit.Its principal character and the reacted constituent comprised comprise: employ upstream primer of the present invention and downstream primer; Surface secures the coding microball of upstream primer and/or downstream primer; Thing to be detected is miRNA target molecule or has other small segment nucleic acid molecule of 3'-OH, or thing to be detected is containing miRNA target molecule or the various biological specimens with other small segment nucleic acid molecule of 3'-OH; Archaeal dna polymerase; Identify the breach agent of upstream primer and downstream primer breach agent recognition sequence; Triphosphate deoxy-nucleotide; Meet ion and the buffer system of above-mentioned archaeal dna polymerase and breach agent biologic activity function; Qualitative and/or the detection by quantitative of the high-throughput of multiple target molecule is realized by the detectable signal of joint-detection coding microball and the release of surperficial immobilized primer thereof.
Explanation of nouns:
" derivatized nucleotide (derivatized nucleotide) " refers to other type Nucleotide outside natural nucleotide.
" non-specific amplification " refers to the amplification that non-target molecules causes.
" target molecule " refers to the material adopting the method for the invention directly or indirectly to detect.
" oligonucleotide (oligonucleotide; ODN) " refers to small molecules nucleic acid, by nucleotide residue (fragment), by phosphodiester bond (phosphodiester) or other chemical bond, (as: phosphorothioate bond (phosphorothioates) connects or is polymerized, molecular weight between nucleic acid and Nucleotide, and tends to Nucleotide.The number of the present invention to nucleotide residue there is no strict boundary.
" nascent DNA chain " refers to the DNA molecular that primer synthesizes at the effect downward-extension of archaeal dna polymerase.
" qualitative detection " refers to whether detect nucleic acid target molecule exists, or whether detection target molecule is present in thing to be detected.
" detection by quantitative " refers to the concentration detecting target molecule, or detects the concentration of thing target to be detected, such as, detects the copy number of thing target to be detected.
" breach " refers to that a nucleic acid molecule chain of double chain acid molecule keeps integrity, the phosphodiester bond rupture between certain two contiguous nucleotides of another nucleic acid molecule chain, thus forms a breach.The nucleic acid molecule end of these breach both sides is 3'-OH and 5'-PO4 respectively.
" 5'-of breach holds nucleic acid molecule " refers to the nucleic acid molecule chain of double chain acid molecule indentation, there with 3'-OH.
" cutting (nicking) " refers to a chain of cutting complete complementary double chain acid molecule, or a chain in the double-stranded region of cutting part double chain acid molecule, and cutting position is positioned at the specific position of NARS.The specific position that nucleic acid molecule is cut is called as in " breach site (nickingsite, NS) " in the present invention
" breach agent recognition sequence (nicking agent recognition sequences, NARS) " refer to wholly or in part in double chain acid molecule by the nucleotide sequence of breach agent identification.NARS of the present invention comprises NERS and partly modifies RERS.
" breach endonuclease recognition sequence (nicking endonuclease recognitionsequences, NERS) " refer to wholly or in part in double chain acid molecule by the nucleotide sequence of breach restriction endonuclease identification.
" restriction endonuclease recognition sequence (restriction endonuclease recognitionsequences, RERS) " refers to the nucleotide sequence that identifies of enzyme (RE) earnestly of being limited property in double chain acid molecule wholly or in part.
" partly modify restriction endonuclease recognition sequence (hemimodified RERS) " and refer in the RERS sequence of a chain in double chain acid molecule wholly or in part at least containing a derivatized nucleotide (as: sulfydryl-deoxynucleotide (-thio deoxynucleotide), and, this derivatized nucleotide can stop the chain of restriction enzyme cutting containing this derivatized nucleotide (that is: cannot cut the nucleic acid molecule chain containing above-mentioned derivatized nucleotide in its recognition sequence at restriction enzyme) that can identify this RERS, another chain is then cut at the specific position of its recognition sequence, thus make restriction enzyme have the biological function the same with breach restriction endonuclease, that is: a chain in double chain acid molecule wholly or in part is only cut.
" breach agent (nicking agent, NA) " refers to the NARS sequence of identifiable design double chain acid molecule wholly or in part, and, the restriction endonuclease of a nucleic acid molecule chain is only cut in the breach site of NARS sequence double-stranded region.Breach agent comprises (but being not limited to) breach restriction endonuclease (nickingendonuclease, NE; As: N.BstNBI), restriction enzyme (restrictionendonuclease, RE; As: HincII).For restriction enzyme, only have when double chain acid molecule contains half modification RERS wholly or in part, restriction enzyme is just used by as breach agent.
" breach restriction endonuclease (nicking endonuclease; NE) " refer to a kind of nucleotide sequence that can identify double chain acid molecule wholly or in part, and only relative to its recognition sequence, namely the specific position of NERS cuts the restriction endonuclease of a nucleic acid molecule chain.This function is different from restriction enzyme, restriction enzyme needs to have a derivatized nucleotide at least usually in the recognition sequence of double chain acid molecule wholly or in part, this derivatized nucleotide can stop restriction enzyme cutting to contain the nucleic acid molecule chain of this derivatized nucleotide, and breach enzyme identifies natural nucleotide usually, further, a chain in double chain acid molecule wholly or in part is only cut.
" NARS sense strand sequence (sequence of the sense strand of the NARS) " refers to the NARS sequence can cut by breach agent in double chain acid molecule wholly or in part, and this sequence contains the breach site of the breach agent identifying this NARS.
" NARS antisense strand sequence (sequence of the antisense strand of the NARS) " refers to the NARS sequence can not cut by breach agent in double chain acid molecule wholly or in part, and this sequence does not identify the breach site of the breach agent of this NARS.
" NERS sense strand sequence (sequence of the sense strand of the NERS) " refers to the NERS sequence can cut by breach restriction endonuclease in double chain acid molecule wholly or in part, and this sequence contains the breach site of the breach agent identifying this NERS.
" NERS antisense strand sequence (sequence of the antisense strand of the NERS) " refers to the NARS sequence can not cut by breach restriction endonuclease in double chain acid molecule wholly or in part, and this sequence does not identify the breach site of the breach agent of this NERS.
" half modify RERS sense strand sequence (sequence of the sense strand of thehemimodified RERS) " refers in double chain acid molecule wholly or in part can the RERS sequence of being limited property restriction endonuclease cutting, this sequence contains the breach site of the breach agent identifying this RERS, it is characterized in that RERS sequence is all natural nucleotides.
" half modify RERS antisense strand sequence (sequence of the antisense strand of thehemimodified RERS) " refers in double chain acid molecule wholly or in part can not the RARS sequence of being limited property restriction endonuclease cutting, this sequence does not identify the breach site of the breach agent of this RERS, it is characterized in that in RERS sequence at least containing a derivatized nucleotide (as: sulfydryl-deoxynucleotide, further, this derivatized nucleotide can stop and can identify that the restriction enzyme of this RERS cuts this sequence.
" constant temperature (isothermalconditions) " refers in amplification procedure, temperature of reaction keeps substantially invariable reaction conditions, and (that is: temperature is identical, or top temperature and minimum temperature difference are no more than the narrow temperature variation range of 20 ° of C).
" fixing " of the present invention refers to and is coupled by physical adsorption and/or chemistry the surface that Oligonucleolide primers to be connected to coding microball by mode.
" physical adsorption " of the present invention refers to that Oligonucleolide primers to be connected with the surface of coding microball by secondary key (such as: ionic linkage) and to fix, or with non covalent bond effect by Oligonucleolide primers directly or constant potential be adsorbed onto the surface of coding microball, or pass through electrostatic interaction by the phosphate radical negative ion in primer of the present invention with the decorative layer of coding microball surface band positive charge and fix.
" chemistry is coupled " of the present invention is by forming covalent linkage (such as: amido linkage, ester bond, ehter bond etc.) active group on Oligonucleolide primers and coding microball surface is interacted, thus Oligonucleolide primers is fixed to the surface of coding microball, such as: the first surface of activating pretreatment coding microball, introduce various required active group, as amino, carboxyl, sulfydryl, hydroxyl, halogen radical (comprises fluorine, chlorine, bromine, iodine etc.) etc., or derivatized nucleotide, it is made to bring suitable functional gene, surface Oligonucleolide primers being fixed to coding microball is got in touch with subsequently with bi-functional reagents or coupling activator, conventional double functional group has glutaraldehyde (GA), p-nitrophenyl chloroformate (NPC), maleimide (MA), diisothio-cyanate etc.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, technical solution of the present invention is further illustrated:
Fig. 1 is the typical structure example one of primer of the present invention;
Fig. 2 is the typical structure example two of primer of the present invention;
Fig. 3 present invention uses the constant temperature exponential amplification principle schematic that coding microball surface secures fluorescent mark upstream primer and downstream primer simultaneously;
Fig. 4 present invention uses the constant temperature exponential amplification principle schematic that coding microball surface only secures fluorescent mark upstream primer;
Fig. 5 present invention uses the constant temperature exponential amplification principle schematic that coding microball surface only secures fluorescent mark downstream primer.
Embodiment
The upstream primer that the fixing a kind of miRNA target molecule in embodiment one: often kind coding microball surface is corresponding and/or downstream primer, detect 6 kinds of miRNA target molecules in single detection system simultaneously.
The present embodiment adopts the MicroPlex of the commercial carboxyl modified of Luminex company of the U.S. tMfluorescence-encoded micro-beads, this coding microball has 100 kinds of fluorescence-encoded micro-beads.In theory, when upstream primer corresponding to a kind of miRNA target molecule and/or downstream primer are fixed in often kind of coding microball surface, the upstream primer that often kind of target molecule is corresponding and/or downstream primer all can mark identical fluorescent reporter molecule, can detect 100 kinds of miRNA target molecules in single reaction system simultaneously.The present invention only using the detection of 6 kinds of miRNA target molecules as embodiment, so that Detection results of the present invention to be described.In the microsphere surface of primer is fixed, in order to increase its simplification, introduce 10 continuous print poly T base (Poly (T at the 5'-end in the anchor series district of the present invention of immobilized primer 10)), and by Poly (T 10) chemistry of the amino of 5'-end and the carboxyl of microsphere surface is coupled and realizes fixing at microsphere surface of primer.The chemistry that the present embodiment adopts is coupled, the detection of Luminex fluorescence-encoded micro-beads, fluorescence-encoded micro-beads is all place of the present invention technical fields known technology and method.
1. the Design and synthesis of target molecule Auele Specific Primer
SEQ No.1 and SEQ No.2 is upstream primer and the downstream primer of amplification miRNA target molecule miR-105 (SEQ No.3) respectively, SEQ No.4 and SEQ No.5 is upstream primer and the downstream primer of amplification miRNA target molecule miR-26a (SEQ No.6) respectively, SEQ No.7 and SEQ No.8 is upstream primer and the downstream primer of amplification miRNA target molecule miR-16 (SEQ No.9) respectively, SEQ No.10 and SEQ No.11 is upstream primer and the downstream primer of amplification miRNA target molecule miR-189 (SEQ No.12) respectively, SEQ No.13 and SEQ No.14 is upstream primer and the downstream primer of amplification miRNA target molecule miR-451 (SEQNo.15) respectively, SEQ No.16 and SEQ No.17 is upstream primer and the downstream primer of amplification miRNA target molecule miR-7e (SEQ No.18) respectively.
The consensus feature in each primer 5' → 3' direction is containing Nt.BstNBI otch restriction endonuclease NERS sense strand sequence (that is: 5'-successively gAGTC-the recognition sequence district of anchor series district 3'), specific recognition miRNA target molecule (SEQ No.3, SEQ No.6, SEQ No.9, SEQ No.12, SEQ No.15, SEQ No.18) and complementary strand thereof.Wherein, the recognition sequence district of upstream primer and downstream primer is complementary with the 3'-end sequence of miRNA target molecule and complementary strand thereof respectively, and is designed with lock nucleic acid (LNA at the portion in recognition sequence district; In sequence with+number base).For the primer being fixed on fluorescence-encoded micro-beads surface, comprise SEQ NO.1, SEQ NO.4, SEQ NO.8, SEQ NO.11, SEQ NO.13, SEQ NO.14, SEQ NO.16, SEQ NO.17, the 5'-end all in the anchor series district of above-mentioned primer introduces Poly (T 10), and at Poly (T 10) the end modified amino group of 5'-.
Above-mentioned all oligonucleotide molecules are synthesized by specialized company.
Upstream primer SEQ No.1 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)ACC+AC+A+GG+AG
Downstream primer SEQ No.2 (5' → 3' direction)
CCGATCTAGT GAGTCtgttcttTC+AA+ATGC+TCA
MiRNA-105SEQ No.3 (5' → 3' direction)
UCAAAUGCUCAGACUCCUGUGGU
Upstream primer SEQ No.4 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)AGCC+TA+TCC+TG
Downstream primer SEQ No.5 (5' → 3' direction)
CCGATCTAGT GAGTCtgttcttT+TCA+AGT+AAT
MiR-26a SEQ No.6 (5' → 3' direction)
UUCAAGUAAUCCAGGAUAGGCU
Upstream primer SEQ No.7 (5' → 3' direction)
CCGATCTAGT GAGTCtgttcttCGCC+AA+TA+TT
Downstream primer SEQ No.8 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)T+AGC+AGC+ACGT
MiR-16SEQ No.9 (5' → 3' direction)
UAGCAGCACGUAAAUAUUGGCG
Upstream primer SEQ No.10 (5' → 3' direction)
CCGATCTAGT GAGTCtgttcttAC+TGA+TA+TCAG
Downstream primer SEQ No.11 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)TGCC+TAC+TG+AG
MiR-189SEQ No.12 (5' → 3' direction)
UGCCUACUGAGCUGAUAUCAGU
Upstream primer SEQ No.13 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)A+ACTC+AGT+AATG
Downstream primer SEQ No.14 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)A+A+ACCGT+TACC
MiR-451SEQ No.15 (5' → 3' direction)
AAACCGUUACCAUUACUGAGUU
Upstream primer SEQ No.16 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)A+ACTA+TACA+ACC
Downstream primer SEQ No.17 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GAGTCtgttctt(BHQ3)TG+AGGT+AGG+AG
Let-7e SEQ No.18 (5' → 3' direction)
UGAGGUAGGAGGUUGUAUAGUU。
2. the upstream primer that different target molecule is corresponding and/or downstream primer are fixed on the surface of fluorescence-encoded micro-beads
Adopt the technical field of the invention known technological method, by the Poly (T of upstream primer and/or downstream primer 10) 5'-terminal amino group and MicroPlex tMthe chemistry of the carboxylic group on fluorescence-encoded micro-beads surface is coupled, and primer is fixed on microsphere surface, wherein:
The upstream primer SEQ No.1 that miR-105 target molecule is corresponding is fixed on LC10001 MicroPlex tMfluorescence-encoded micro-beads surface;
The upstream primer SEQ No.4 that miR-26a target molecule is corresponding is fixed on LC10002 MicroPlex tMfluorescence-encoded micro-beads surface;
The downstream primer SEQ No.8 that miR-16 target molecule is corresponding is fixed on LC10003 MicroPlex tMfluorescence-encoded micro-beads surface;
The downstream primer SEQ No.11 that miR-189 target molecule is corresponding is fixed on LC10004 MicroPlex tMfluorescence-encoded micro-beads surface;
The upstream primer SEQ No.13 that miR-451 target molecule is corresponding and downstream primer SEQ No.14 is fixed on LC10005 MicroPlex simultaneously tMfluorescence-encoded micro-beads surface;
The upstream primer SEQ No.16 that miR-7e target molecule is corresponding and downstream primer SEQ No.17 is fixed on LC10006 MicroPlex simultaneously tMfluorescence-encoded micro-beads surface.
Further, the upstream described above and/or the downstream primer that are fixed on coding microball surface are all marked with PE fluorescent reporter molecule and BHQ3 quencher molecule respectively in the base of the NERS sense strand sequence both sides at place, anchor series district.
3. the extraction of serum total serum IgE
Commercialization total RNA extraction reagent box is adopted to extract 10 routine human peripheral blood leukocytes total serum IgE.
4. the structure of liquid chip constant temperature exponential amplification system
Reaction system amounts to 50 μ L, and this system comprises following component: 20mM Tris-HCl, 10mM (NH 4) 2sO 4, 50mM KCl, 8mM MgSO 4, 0.1%Tween-20,100 μ g/ml BSA, 5%DMSO, 0.2 unit Vent r(exo-) archaeal dna polymerase (NEB), 1.6 unit Nt.BstNBI breach enzyme (NEB), 1.5 μ g heat-resisting mismatch binding albumen Taq MutS (Nippon Gene), 600 μMs of dNTPs (Promega), the upstream and/or the downstream primer that are not fixed on coding microball surface in step 1 and 2 are often kind of primer 50nM, in step 2, to secure LC10001 to the LC10006 fluorescence-encoded micro-beads of upstream and/or downstream primer appropriate on surface, target molecule is that the miRNA target molecule of the 0.1zmol of synthesis (comprising: SEQNo.3, SEQ No.6, SEQ No.9, SEQ No.12, SEQ No.15, SEQ No.18), or 10 routine human peripheral blood leukocytes total serum IgE prepared by step 3.
4. the amplification of target molecule and fluoroscopic examination
The reaction system of above-mentioned preparation is placed in ViiA7 real-time fluorescence quantitative PCR, and reaction conditions is: 60 DEG C 40 minutes.After completion of the reaction, Luminex is adopted tMthe fluorescence on the 200 each coding microball surfaces of equipment Inspection.
5. detected result and analysis
5.1 when only having miR-105 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10001 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.2 when only having miR-26a target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10002 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.3 when only having miR-16 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10003 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.4 when only having miR-189 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10004 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.5 when only having miR-451 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10005 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.6 when only having miR-7e target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10006 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.7 when existing 6 kinds of target molecules described in the present embodiment simultaneously in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being encoded to LC10001 to LC10006 number all has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of each target molecule.
The detected result of 5.8 clinical samples shows, miR-105, miR-26a, miR-16, miR-189, miR-451, miR-7e detected result of 10 routine samples is 5.23 ~ 7.28 × 10 respectively 3, 1.27 ~ 4.38 × 10 4, 2.13 ~ 3.24 × 10 4, 6.23 ~ 8.23 × 10 3, 4.23 ~ 6.89 × 10 4.
5.9 relative to the existing liquid chip detection method based on hybridization, the present embodiment is nucleic acid amplification and the detection method being detected as one, nucleic acid amplification can be completed in 40 minutes, amplified production can be directly used in relevant device and detect, without the need to follow-up hybridization step, totally only about 50 minutes consuming time, well below the existing similar detection method based on hybridization, further, its methodology such as sensitivity and specificity parameter and existing similar detection method have good dependency.
Upstream primer corresponding to two kinds of miRNA target molecules and/or downstream primer are fixed in embodiment two: often kind coding microball surface, detect 6 kinds of miRNA target molecules in single detection system simultaneously.
The present embodiment adopts the MicroPlex of the commercial carboxyl modified of Luminex company of the U.S. tMfluorescence-encoded micro-beads, this coding microball has 100 kinds of fluorescence-encoded micro-beads.In theory, when upstream primer corresponding to two kinds of miRNA target molecules and/or downstream primer are fixed in often kind of coding microball surface, the fluorescent reporter molecule that the primer mark two kinds that above-mentioned two kinds of target molecules are corresponding is different, but primer fixing between different coding microballoon can mark identical fluorescent reporter molecule, can detect 200 kinds of miRNA target molecules in single reaction system simultaneously.The present invention only using the detection of 6 kinds of miRNA target molecules as embodiment, so that Detection results of the present invention to be described.In the microsphere surface of primer is fixed, in order to increase its simplification, introduce 10 continuous print poly T base (Poly (T at the 5'-end in the anchor series district of the present invention of immobilized primer 10)), and by Poly (T 10) chemistry of the amino of 5'-end and the carboxyl of microsphere surface is coupled and realizes fixing at microsphere surface of primer.The chemistry that the present embodiment adopts is coupled, the detection of Luminex fluorescence-encoded micro-beads, fluorescence-encoded micro-beads is all place of the present invention technical fields known technology and method.
1. the Design and synthesis of target molecule Auele Specific Primer
SEQ No.1 and SEQ No.2 is upstream primer and the downstream primer of amplification miRNA target molecule miR-105 (SEQ No.3) respectively, SEQ No.4 and SEQ No.5 is upstream primer and the downstream primer of amplification miRNA target molecule miR-26a (SEQ No.6) respectively, SEQ No.7 and SEQ No.8 is upstream primer and the downstream primer of amplification miRNA target molecule miR-16 (SEQ No.9) respectively, SEQ No.10 and SEQ No.11 is upstream primer and the downstream primer of amplification miRNA target molecule miR-189 (SEQ No.12) respectively, SEQ No.13 and SEQ No.14 is upstream primer and the downstream primer of amplification miRNA target molecule miR-451 (SEQNo.15) respectively, SEQ No.16 and SEQ No.17 is upstream primer and the downstream primer of amplification miRNA target molecule miR-7e (SEQ No.18) respectively.
The consensus feature in each primer 5' → 3' direction is containing Nt.AlwI otch restriction endonuclease NERS sense strand sequence (that is: 5'-successively gGATC-the recognition sequence district of anchor series district 3'), specific recognition miRNA target molecule (SEQNo.3, SEQ No.6, SEQ No.9, SEQ No.12, SEQ No.15, SEQ No.18) and complementary strand thereof.Wherein, the recognition sequence district of upstream primer and downstream primer is complementary with the 3'-end sequence of miRNA target molecule and complementary strand thereof respectively, and is designed with lock nucleic acid (LNA at the portion in recognition sequence district; In sequence with+number base).For the primer being fixed on fluorescence-encoded micro-beads surface, comprise SEQ NO.1, SEQ NO.4, SEQ NO.8, SEQ NO.11, SEQ NO.13, SEQ NO.14, SEQ NO.16, SEQ NO.17, the 5'-end all in the anchor series district of above-mentioned primer introduces Poly (T 10), and at Poly (T 10) the end modified amino group of 5'-.
Above-mentioned all oligonucleotide molecules are synthesized by specialized company.
Upstream primer SEQ No.1 (5' → 3' direction)
NH 2-tttttttttt(FAM)CCGATCTAGT GGATCtgttctt(BHQ1)ACCACAGGAG
Downstream primer SEQ No.2 (5' → 3' direction)
CCGATCTAGT GGATCtgttcttTCAAATGC+TCA
MiRNA-105SEQ No.3 (5' → 3' direction)
UCAAAUGCUCAGACUCCUGUGGU
Upstream primer SEQ No.4 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GGATCtgttctt(BHQ3)AGCCTA+TCCTG
Downstream primer SEQ No.5 (5' → 3' direction)
CCGATCTAGT GGATCtgttcttTTCAAGTAAT
MiR-26a SEQ No.6 (5' → 3' direction)
UUCAAGUAAUCCAGGAUAGGCU
Upstream primer SEQ No.7 (5' → 3' direction)
CCGATCTAGT GGATCtgttcttCGCCAATATT
Downstream primer SEQ No.8 (5' → 3' direction)
NH 2-tttttttttt(FAM)CCGATCTAGT GGATCtgttctt(BHQ1)TAGCAGCACGT
MiR-16SEQ No.9 (5' → 3' direction)
UAGCAGCACGUAAAUAUUGGCG
Upstream primer SEQ No.10 (5' → 3' direction)
CCGATCTAGT GGATCtgttcttACTGA+TATCAG
Downstream primer SEQ No.11 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GGATCtgttctt(BHQ3)TGCCTACTGAG
MiR-189SEQ No.12 (5' → 3' direction)
UGCCUACUGAGCUGAUAUCAGU
Upstream primer SEQ No.13 (5' → 3' direction)
NH 2-tttttttttt(FAM)CCGATCTAGT GGATCtgttctt(BHQ1)AACTCAGTAATG
Downstream primer SEQ No.14 (5' → 3' direction)
NH 2-tttttttttt(FAM)CCGATCTAGT GGATCtgttctt(BHQ1)A+AACCGTTACC
MiR-451SEQ No.15 (5' → 3' direction)
AAACCGUUACCAUUACUGAGUU
Upstream primer SEQ No.16 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GGATCtgttctt(BHQ3)AACTATACAACC
Downstream primer SEQ No.17 (5' → 3' direction)
NH 2-tttttttttt(PE)CCGATCTAGT GGATCtgttctt(BHQ3)TGAGGT+AGGAG
Let-7e SEQ No.18 (5' → 3' direction)
UGAGGUAGGAGGUUGUAUAGUU。
2. the upstream primer that different target molecule is corresponding and/or downstream primer are fixed on the surface of fluorescence-encoded micro-beads
Adopt the technical field of the invention known technological method, by the Poly (T of upstream primer and/or downstream primer 10) 5'-terminal amino group and MicroPlex tMthe chemistry of the carboxylic group on fluorescence-encoded micro-beads surface is coupled, and primer is fixed on microsphere surface, wherein:
The upstream primer SEQ No.1 that miR-105 target molecule is corresponding and upstream primer SEQ No.4 corresponding to miR-26a target molecule is fixed on LC10001 MicroPlex simultaneously tMfluorescence-encoded micro-beads surface, primer flag F AM and the PE fluorescent reporter molecule respectively of the two;
The downstream primer SEQ No.8 that miR-16 target molecule is corresponding and downstream primer SEQ No.11 corresponding to miR-189 target molecule is fixed on LC10002 MicroPlex simultaneously tMfluorescence-encoded micro-beads surface, primer flag F AM and the PE fluorescent reporter molecule respectively of the two;
The upstream primer SEQ No.13 that miR-451 target molecule is corresponding and upstream primer SEQ No.16 corresponding to downstream primer SEQ No.14, miR-7e target molecule and downstream primer SEQ No.17 is fixed on LC10003 MicroPlex all simultaneously tMfluorescence-encoded micro-beads surface, primer flag F AM and the PE fluorescent reporter molecule respectively of the two.
3. the extraction of serum total serum IgE
Commercialization total RNA extraction reagent box is adopted to extract 10 routine human peripheral blood leukocytes total serum IgE.
4. the structure of liquid chip constant temperature exponential amplification system
Reaction system amounts to 50 μ L, and this system comprises following component: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl 2, 100 μ g/ml BSA, 0.5 unit K lenow (exo-) archaeal dna polymerase (NEB), 2 unit Nt.AlwI breach enzyme (NEB), 600 μMs of dNTPs (Promega), the upstream and/or the downstream primer that are not fixed on coding microball surface in step 1 and 2 are often kind of primer 50nM, in step 2, to secure LC10001 to the LC10003 fluorescence-encoded micro-beads of upstream and/or downstream primer appropriate on surface, target molecule is that the miRNA target molecule of the 0.1zmol of synthesis (comprising: SEQ No.3, SEQ No.6, SEQ No.9, SEQ No.12, SEQ No.15, SEQ No.18), or 10 routine human peripheral blood leukocytes total serum IgE prepared by step 3.
4. the amplification of target molecule and fluoroscopic examination
The reaction system of above-mentioned preparation is placed in ViiA7 real-time fluorescence quantitative PCR, and reaction conditions is: 37 DEG C 30 minutes.After completion of the reaction, Luminex is adopted tMthe fluorescence on the 200 each coding microball surfaces of equipment Inspection.
5. detected result and analysis
5.1 when only having miR-105 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10001 has FAM to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.2 when only having miR-26a target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10001 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.3 when only having miR-16 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10002 has FAM to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.4 when only having miR-189 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10002 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.5 when only having miR-451 target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10003 has FAM to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.6 when only having miR-7e target molecule in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being only encoded to No. LC10003 has PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of this target molecule.
5.7 when existing 6 kinds of target molecules described in the present embodiment simultaneously in reaction system, the detected fluorescent signal that the fluorescence-encoded micro-beads surface being encoded to LC10001 to LC10003 number all has FAM and PE to discharge, and the intensity of fluorescent signal is directly proportional to the starting point concentration of each target molecule.
The detected result of 5.8 clinical samples shows, miR-105, miR-26a, miR-16, miR-189, miR-451, miR-7e detected result of 10 routine samples is 5.23 ~ 7.28 × 10 respectively 3, 1.27 ~ 4.38 × 10 4, 2.13 ~ 3.24 × 10 4, 6.23 ~ 8.23 × 10 3, 4.23 ~ 6.89 × 10 4.
5.9 relative to the existing liquid chip detection method based on hybridization, the present embodiment is nucleic acid amplification and the detection method being detected as one, nucleic acid amplification can be completed in 30 minutes, amplified production can be directly used in relevant device and detect, without the need to follow-up hybridization step, totally only about 40 minutes consuming time, well below the existing similar detection method based on hybridization, further, its methodology such as sensitivity and specificity parameter and existing similar detection method have good dependency.
For a person skilled in the art, under the prerequisite not departing from technical solution of the present invention, can also make some distortion and improvement, these also should be considered as protection scope of the present invention, and these all can not affect effect of the invention process and practical applicability.

Claims (15)

1. the liquid chip Constant Temperature Detection method of Microrna, it is characterized in that: comprise reaction mixture, reaction mixture comprises following reacted constituent:
1. there is the miRNA target molecule of 3'-terminal hydroxy group;
2. upstream primer and downstream primer;
3. coding microball;
4. archaeal dna polymerase;
5. the breach agent of upstream primer and downstream primer breach agent recognition sequence is identified;
6. triphosphate deoxy-nucleotide;
7. ion and the buffer system of above-mentioned archaeal dna polymerase and breach agent biologic activity is met; Described upstream primer and downstream primer are the sense strand sequence containing jagged dose of recognition sequence, and its 5' → 3' base is all followed successively by the recognition sequence district of anchor series district, specific recognition miRNA target molecule sequence; The anchor series district of upstream primer and downstream primer and miRNA target molecule are without homology, and the recognition sequence district of upstream primer, downstream primer is complementary with the 3'-terminal sequence of miRNA target molecule and miRNA target molecule complementary strand respectively;
Described upstream primer and downstream primer have target molecule specificity, and reaction mixture comprises the specific upstream primer of multiple target molecule and downstream primer, often kind of specific upstream primer of target molecule and/or downstream primer are fixed on the surface of coding microball by its 5'-end, further, the upstream primer and/or the downstream primer that are fixed on coding microball surface mark fluorescent reporter molecule and the quencher molecule with FRET (fluorescence resonance energy transfer) effect respectively in the both sides (that is: 5'-end and 3'-end) of its breach agent recognition sequence.
2. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, is characterized in that: the described specific upstream primer of often kind of target molecule and downstream primer are fixed on a kind of surface of coding microball simultaneously;
Or, often kind of target molecule only have it to have surface that specific upstream primer is fixed on a kind of coding microball;
Or, often kind of target molecule only have it to have surface that specific downstream primer is fixed on a kind of coding microball;
Or the specific upstream primer of one or more target molecules and another kind or more the specific downstream primer of other target molecule is fixed on the surface of same coding microball simultaneously.
3. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, it is characterized in that: described coding microball comprises fluorescence-encoded micro-beads, quantum point coding microball, fluorescence-magnetic code microballoon, up-conversion luminescence coding microball, Raman spectrum coding microball, often kind of coding microball has discernible uniqueness mark, in same reaction system, use Multi-encoding microballoon simultaneously.
4. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, is characterized in that: described coding microball is fluorescence-encoded micro-beads.
5. as the liquid chip Constant Temperature Detection method of the Microrna in Claims 1 to 4 as described in any one, it is characterized in that: the anchor series district 5'-end of the described upstream primer being fixed on coding microball surface and/or downstream primer also has poly base, and poly base comprises poly born of the same parents gland pyrimidine bases (Poly (T n)) or poly adenine base (Poly (A n)), and the surface of coding microball is fixed on by the 5'-end of described poly base.
6. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 5, is characterized in that: described target molecule specific upstream primer and/or downstream primer are comprised by the mode being fixed on coding microball surface: fix with the combination of covalent linkage and non-co-part key;
Or, be coupled mode by physical adsorption and/or chemistry and fix;
Or alkyl or the aryl compound with amido are fixed as connection peptides;
Or, there is the alkyl of thiol group or aryl compound as connection peptides immobilized primer;
Or, fixed by arm molecule.
7. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 6, is characterized in that: the described specific upstream primer being fixed on the different target molecules of same-code microballoon and/or downstream primer mark have different fluorescent reporter molecules and the quencher molecule of FRET (fluorescence resonance energy transfer) effect.
8. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, it is characterized in that: the specific upstream primer of described miRNA target molecule and/or the anchor series district of downstream primer and/or recognition sequence district introduce derivatized nucleotide, derivatized nucleotide comprises lock nucleic acid, peptide nucleic acid(PNA) or thio-modification base.
9. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, is characterized in that: containing the Nucleotide with miRNA target molecule and complementary sequence 3'-end penultimate and/or the 3rd bit base mispairing in the specific upstream primer of described miRNA target molecule and/or the recognition sequence district of downstream primer;
Or, in described reaction mixture, add the bioactive molecules that can suppress non-specific amplification, comprise Taq MutS, RecA.
10. the liquid chip Constant Temperature Detection method of Microrna as claimed in claim 1, is characterized in that: described archaeal dna polymerase is the archaeal dna polymerase with strand-displacement activity;
Or described archaeal dna polymerase does not have strand-displacement activity, and in described reaction mixture, add the bioactive molecules with strand-displacement activity.
11., as the liquid chip Constant Temperature Detection method of the Microrna in Claims 1 to 4,6 ~ 10 as described in any one, is characterized in that: the range of reaction temperature of described constant temperature is 37-70 DEG C.
The liquid chip Constant Temperature Detection method of 12. Micrornas as claimed in claim 11, is characterized in that: the temperature of reaction of described constant temperature is 37 DEG C, 55 DEG C, 60 DEG C or 65 DEG C.
13., as the liquid chip Constant Temperature Detection method of the Microrna in Claims 1 to 4,6 ~ 10 as described in any one, is characterized in that: the described reaction times is 10-80min.
The liquid chip Constant Temperature Detection method of 14. Micrornas as claimed in claim 13, is characterized in that: the described reaction times is 10min, 20min, 30min, 40min, 50min or 60min.
15. detection reagent and the test kits that utilize the liquid chip Constant Temperature Detection method of Microrna as described in any one in Claims 1 to 4,6 ~ 10,12,14.
CN201510460236.8A 2015-07-30 2015-07-30 Liquid-stage chip constant-temperature detection method for tiny RNA Pending CN105002285A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510460236.8A CN105002285A (en) 2015-07-30 2015-07-30 Liquid-stage chip constant-temperature detection method for tiny RNA

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510460236.8A CN105002285A (en) 2015-07-30 2015-07-30 Liquid-stage chip constant-temperature detection method for tiny RNA

Publications (1)

Publication Number Publication Date
CN105002285A true CN105002285A (en) 2015-10-28

Family

ID=54375146

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510460236.8A Pending CN105002285A (en) 2015-07-30 2015-07-30 Liquid-stage chip constant-temperature detection method for tiny RNA

Country Status (1)

Country Link
CN (1) CN105002285A (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834512A (en) * 2017-03-22 2017-06-13 中国医科大学 A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675)
CN107561043A (en) * 2017-07-06 2018-01-09 复旦大学 Biology sensor based on transform coding fluorescent technique on polychrome
CN109402226A (en) * 2018-10-08 2019-03-01 厦门大学附属第医院 A kind of kit detecting aldolase mRNA express spectra
CN111410950A (en) * 2020-02-25 2020-07-14 常州诺达生化科技有限公司 Double-block DNA modified upconversion nanoparticle and preparation method and application thereof
CN111443073A (en) * 2020-04-30 2020-07-24 北京大学 Micro L ED chip micro Raman combined photoluminescence detection device and method thereof
CN112760362A (en) * 2021-02-04 2021-05-07 中国人民解放军陆军特色医学中心 Circular signal amplification template for oligonucleotide amplification and application thereof
CN114196737A (en) * 2020-09-18 2022-03-18 赛纳生物科技(北京)有限公司 Sequencing method for constant-temperature amplification
CN114196735A (en) * 2020-09-18 2022-03-18 赛纳生物科技(北京)有限公司 Method for on-chip constant temperature amplification sequencing
CN114214397A (en) * 2021-12-20 2022-03-22 昂凯生命科技(苏州)有限公司 Methylation detection method

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101962685A (en) * 2010-11-11 2011-02-02 江苏省疾病预防控制中心 Liquid-phase chip-based method for detecting micro ribonucleic acid
US20120045768A1 (en) * 2009-04-16 2012-02-23 Padma Arunachalam Methods and compositions to detect and differentiate small rnas in rna maturation pathway
CN104278088A (en) * 2014-09-23 2015-01-14 深圳先进技术研究院 MiRNA detection method based on constant-temperature index amplification reaction and surface-enhanced raman spectroscopy detection and application of miRNA detection method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120045768A1 (en) * 2009-04-16 2012-02-23 Padma Arunachalam Methods and compositions to detect and differentiate small rnas in rna maturation pathway
CN101962685A (en) * 2010-11-11 2011-02-02 江苏省疾病预防控制中心 Liquid-phase chip-based method for detecting micro ribonucleic acid
CN104278088A (en) * 2014-09-23 2015-01-14 深圳先进技术研究院 MiRNA detection method based on constant-temperature index amplification reaction and surface-enhanced raman spectroscopy detection and application of miRNA detection method

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LENG ET AL: "Suspension arrays based on nanoparticle-encoded micropheres for high-throughput multiplexed detection", 《ROYAL SOCIETY OF CHEMISTRY》 *
SHI ET AL: "Exponential Strand-Displacemant Amplification for Detection of MicroRNAs", 《ANALYTICAL CHEMISTRY》 *
同颖娜 等: "microRNA的液体芯片检测方法", 《分子诊断与治疗杂志》 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834512A (en) * 2017-03-22 2017-06-13 中国医科大学 A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675)
CN107561043A (en) * 2017-07-06 2018-01-09 复旦大学 Biology sensor based on transform coding fluorescent technique on polychrome
CN109402226A (en) * 2018-10-08 2019-03-01 厦门大学附属第医院 A kind of kit detecting aldolase mRNA express spectra
CN111410950A (en) * 2020-02-25 2020-07-14 常州诺达生化科技有限公司 Double-block DNA modified upconversion nanoparticle and preparation method and application thereof
CN111410950B (en) * 2020-02-25 2023-04-07 常州诺达生化科技有限公司 Double-block DNA modified upconversion nanoparticle and preparation method and application thereof
CN111443073A (en) * 2020-04-30 2020-07-24 北京大学 Micro L ED chip micro Raman combined photoluminescence detection device and method thereof
CN111443073B (en) * 2020-04-30 2021-06-01 北京大学 micro-Raman combined photoluminescence detection device and method for micro LED chip
CN114196737A (en) * 2020-09-18 2022-03-18 赛纳生物科技(北京)有限公司 Sequencing method for constant-temperature amplification
CN114196735A (en) * 2020-09-18 2022-03-18 赛纳生物科技(北京)有限公司 Method for on-chip constant temperature amplification sequencing
CN112760362A (en) * 2021-02-04 2021-05-07 中国人民解放军陆军特色医学中心 Circular signal amplification template for oligonucleotide amplification and application thereof
CN112760362B (en) * 2021-02-04 2023-07-07 中国人民解放军陆军特色医学中心 Annular signal amplification template for oligonucleotide amplification and application thereof
CN114214397A (en) * 2021-12-20 2022-03-22 昂凯生命科技(苏州)有限公司 Methylation detection method

Similar Documents

Publication Publication Date Title
US10829808B2 (en) Amplification and detection of ribonucleic acids
CN105002285A (en) Liquid-stage chip constant-temperature detection method for tiny RNA
US10655173B2 (en) Spatial and cellular mapping of biomolecules in situ by high-throughput sequencing
JP6633514B2 (en) Multiplex analysis of target nucleic acids
RU2542478C2 (en) Target-discriminating probe, method of constructing thereof and method of detecting nucleic acid target-sequence (versions)
KR101569476B1 (en) TSG Primer Target Detection
CN101528763B (en) Methods and substances for isolation and detection of small polynucleotides
JP6228242B2 (en) Detection of target nucleic acid sequence in solid phase using dual-labeled immobilized probe
JP6099684B2 (en) Detection of target nucleic acid sequences by repetitive exonucleolytic cleavage reaction
KR101622780B1 (en) Detection of Target Nucleic Acid Sequence by PO Cleavage and Hybridization
CN105154534A (en) Real-time constant-temperature index amplification method of tiny RNAs
CN105112507A (en) Digital constant-temperature detection method of miRNA
CN105705657B (en) Detection of target nucleic acid sequences in solid phase based on pto cleavage and extension analysis using hybrid-capture and templated oligonucleotides
CN110023507B (en) Method for detecting small RNAs or proteins associated with small RNAs
CN105063190A (en) Solid chip constant temperature detection method of MiRNA
US10246739B2 (en) Exonuclease cycling assay
TW202120693A (en) Method for detecting polymerase incorporation of nucleotides

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20151028