CN106834512A - A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) - Google Patents
A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) Download PDFInfo
- Publication number
- CN106834512A CN106834512A CN201710173785.6A CN201710173785A CN106834512A CN 106834512 A CN106834512 A CN 106834512A CN 201710173785 A CN201710173785 A CN 201710173785A CN 106834512 A CN106834512 A CN 106834512A
- Authority
- CN
- China
- Prior art keywords
- mirna
- probe
- double
- directly
- stranded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
Abstract
One kind can directly to miRNA 675（microRNA675）The kit of sxemiquantitative is carried out, for a certain miRNA 675 in total serum IgE（microRNA675）Half-quantitative detection is carried out, described one kind can directly to miRNA 675（microRNA675）Carry out probe and a kind of hybridization buffer containing DNA chain displacement enzyme of the one kind with " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " that quantitative kit is included, probe with " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " is assembled by two different oligonucleotides of length of A, B chain are single-stranded, A chains are more long, and B chains are shorter.The invention is directly to addition original sample in detection architecture-total miRNA（microRNA）Extract solution, without to miRNA 675（microRNA675）Carry out reverse transcription and amplification；Test limit is extremely low, and detection time is short, is applied in medical science and technical field of molecular biology.
Description
Technical field
It is a kind of directly to miRNA 675 in the present invention relates to medical science and technical field of molecular biology
（MicroRNA675 the kit of sxemiquantitative) is carried out.
Background technology
MiRNA（MicroRNA, miRNA）It is the small of raw, about 20-24 nucleotides of length in a class
RNA, plays a significant role in the important pathological processes such as cell development, apoptosis, differentiation, propagation.Research discovery, people's
Such as blood, urine, saliva, amniotic fluid, Pleural effusions are widely present microRNA in body fluid, the express spectra of these microRNA with
It is the same in histocyte, the change of characteristic can occur under the pathological states such as tumour, these specific microRNA express spectras
One of tumor cell specific biomarker, be a kind of new non-invasive diagnosis marker to help disease prediction,
Diagnosis and prognosis.Traditional MicroRNA detection method includes blot hybridization technique（Northern Blotting）, and reversion
Record and real-time quantitative PCR（realtime PCR）Use in conjunction, these method comparative maturities and widely used, but existed
Journey is cumbersome, expensive, time-consuming more long, sensitivity is low, easily the defects such as false positive results occur, cannot increasingly meet current inspection
Surveying needs.
Many research displays, MircroRNA675 tables high in the malignant tumours such as Stomach Carcinomas, carcinoma of urinary bladder, liver cancer and colon cancer
Reach, the effect of promotion sensitivity gene is played by signal paths such as CALN1, RUNX, Hedgehog.Because microRNA can be with a small amount of
Free form is present in peripheral blood, therefore MircroRNA675 can be used for some malignant tumours as tumor markers
Early screening.Therefore, research and develop a kind of directly to miRNA 675（microRNA675）Carry out the reagent of sxemiquantitative
Box new problem anxious to be resolved always.
The content of the invention
It is an object of the invention to provide a kind of directly to miRNA 675（microRNA675）Carry out sxemiquantitative
Kit, the invention be used for Cell culture invitro, in vitro tissue, blood equal samples extract total mircroRNA675 in
The half-quantitative detection for carrying out half-quantitative detection, mircroRNA675 being carried out using probe of a certain mircroRNA675, without
Reverse transcription and any amplification technique, only a small amount of sample need to be directly added into reaction system, 50-65 DEG C constant temperature 5-30 minute, examine
Fluorescence intensity is surveyed, fluorescence intensity cumulative speed is directly proportional to mircroRNA675 concentration.
The object of the present invention is achieved like this：One kind can directly to miRNA 675（microRNA675）Carry out
The kit of sxemiquantitative, for a certain miRNA 675 in total serum IgE（microRNA675）Carry out sxemiquantitative inspection
Survey, described one kind can directly to miRNA 675（microRNA675）Carry out one kind that the kit of sxemiquantitative is included
Probe with " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " and a kind of containing the miscellaneous of DNA chain displacement enzyme
Hand over buffer solution；
Described one kind has the probe of " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " by A, B chain two
The different oligonucleotides of bar length is single-stranded to be assembled, and A chains are more long, and B chains are shorter, and wherein A chains nucleotides sequence is classified as SEQ ID
NO.1： 5’ROX-GCCTCGGTGAGCGGTGAGGGCATACAGCCGAGGCT(-BHQ2)
CTCCAGACGTCACTCAGTGCACC-3 ', the ROX in sequence is fluorophor, and BHQ2 is quenching group；The nucleotides sequence of B chains
It is classified as SEQ ID NO.2：5’-GGTGCACTGAGTGACGTCTGGAGAG-3’；Probe is initial " to be tieed up by multi-functional loop-stem structure
Unilateral 3 ' the outstanding end double-spiral structures held " are not the space structures that DNA chain displacement enzyme can be catalyzed, and the one kind after deforming is " single
The imperfect double-spiral structure of chain-double-strand-single-stranded-double-strand " is the space structure that DNA chain displacement enzyme can be catalyzed；
A kind of described hybridization buffer containing DNA chain displacement enzyme, hybridization temperature between 55-65 DEG C, by Bst 2.0
The mM/ kinds of 32 10 mM, dNTP Mix of U, MgSO4 of WarmStart DNA Polymerase 1, the mM of Tris-HCl 20,
(NH4) 2,SO4 10 mM, KCl 50 mM composition, wherein MgSO4 concentration can be adjusted between 5-20 mM；In the hybridization bar
Under part, probe can be triggered and be deformed into one kind from initial " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure "
" single-stranded-double-strand-single-stranded-double-strand " imperfect double-stranded unique conditional is outer in probe " multi-functional loop-stem structure "
Ring structure and miRNA 675（microRNA675）Specifically bind；
Described one kind has the fluorescent base of the probe of " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure "
The modification position with quenching group is rolled into a ball, fluorophor is modified on 5 ' terminal nucleotides of probe A chains, quenching group modification is at 5 ' ends
Paratope nucleotides or adjacent nucleotides on；After so modifying, probe " is maintained in initial by multi-functional loop-stem structure
During unilateral 3 ' outstanding end double-spiral structure ", fluorophor is less than 10nm with quenching group space length, it will fluorescence resonance energy occurs
Amount transfer, causes fluorescence to be quenched, therefore probe is in initial " unilateral 3 ' the outstanding end double helix knots maintained by multi-functional loop-stem structure
During structure ", therefore can't detect fluorescence.When probe deformations are a kind of " single-stranded-double-strand-single-stranded-double-strand " imperfect double-spiral structure
When, space length is much larger than 10 nm between fluorophor and quenching group, it is impossible to which FRET, fluorescent base occur
Group can not be quenched, therefore detectable fluorescence；Whenever " appearance of target sequence → combined with probe → probe deformations → chain extension →
Strand displacement → target sequence dissociates again " circular response once, the amount of the probe that is opened is increased by a target sequence original vol, target sequence
The original vol of row is bigger, and the probe amount that fluorescence is sent in the unit interval is bigger, i.e. the cumulative speed and target sequence of fluorescence intensity
Concentration is directly proportional；Therefore, the presence that probe has its own signal enlarging function, denier target sequence can also be detected, no
Needs are expanded；
Described one kind can directly to miRNA 675（microRNA675）The kit for carrying out sxemiquantitative is used for total
A certain miRNA 675 in RNA（microRNA675）It is to be implemented by the following steps to carry out half-quantitative detection
's：
（1）The μ L of probe 1 that concentration is 10 μM are taken, is added in the hybridization buffer of the μ L of 12 μ L enzymes containing DNA chain displacement 2, mixed
It is even；
（2）5 μ L samples are wherein added to aforesaid liquid, send realtimePCR instrument to detect after mixing；
（3）Testing conditions are usually 60 DEG C of constant temperature 30 minutes, detection temperature and detection time and can as the case may be in 50-
Adjusted between 65 DEG C, 5-30 minutes；
（4）Interpretation of result, fluorescence intensity cumulative speed and purpose miRNA 675 in sample（microRNA675）Content
It is directly proportional, the method that testing result judges there are two kinds, when purpose miRNA 675 in sample to be tested（microRNA675）
When content is relatively low, fluorescence intensity level sample higher in same time, its purpose miRNA 675（microRNA675）
Content it is higher；When purpose miRNA 675 in sample to be tested（microRNA675）When content is higher, reach identical glimmering
The shorter sample of time used by light intensity value, its miRNA 675（microRNA675）Content it is higher；
Described one kind can directly to miRNA 675（microRNA675）The kit of sxemiquantitative is carried out using this
Space structure carries out miRNA 675（microRNA675）The operation principle of half-quantitative detection be, small ribose core
Acid 675（microRNA675）Its own signal circulation iodine of startup "：The probe of initial configuration（Unstressed configuration signal）→ micro-
Micro ribonucleic acid 675（microRNA675）Appearance → combined with probe after trigger probe deformations（Fluorescence letter is sent after deformation
Number, non-trivial ribonucleic acid 675（microRNA675）Do not cause probe deformations）→ chain extension → strand displacement（Initial configuration probe
Chain extension and strand replacement reaction will not occur）→ miRNA 675（microRNA675）Dissociate again → cause it again
The probe deformations of its initial configuration（Its own signal circulation is amplified）.
It is of the invention to be characterized by detection miRNA 675（microRNA675）The non-natural that has of probe
Space structure --- " unilateral 3 ' outstanding end double-spiral structures maintained by multi-functional loop-stem structure " and using this space structure
Carry out miRNA 675（microRNA675）Half-quantitative detection operation principle.
It is a kind of direct to miRNA 675（MicroRNA675 the kit and prior art phase of sxemiquantitative) are carried out
Than its advantage is：Directly to adding original sample in detection architecture --- total miRNA（microRNA）Extract
Liquid, without to miRNA 675（microRNA675）Carry out reverse transcription and amplification；Test limit is extremely low, can detect 1.0*
10-18The miRNA 675 of mol（microRNA675）；Specific high, 100 times of single base mismatch sequences are noiseless, also not
Disturbed by DNA impurity in sample；Operation is extremely simple, and only needing step sample-adding to operate can censorship；Detection time is short, only needs 5-
30 minutes；In can be widely used in medical science and technical field of molecular biology.
Below in conjunction with the accompanying drawings and embodiment the present invention is described in detail.
Brief description of the drawings
Fig. 1 is detection principle diagram of the invention.
Fig. 2 is the secondary structure prediction figure of the probe A chains using mircroRNA675 as target sequence.
Fig. 3 is the initial space structure chart of the probe for detecting microRNA675.
Fig. 4 is to detect that different content mircroRNA675 is investigated as the probe sensitivity of target sequence --- difference contained
The microRNA675 standard items of amount carry out semi-quantitative analysis.
Fig. 5 is that probe specificity is investigated --- add single base mismatch sequence of the content higher than 100 times of microRNA675
Testing result.
Specific embodiment
Referring to the drawings, one kind can directly to miRNA 675（microRNA675）The kit of sxemiquantitative is carried out,
For a certain miRNA 675 in total serum IgE（microRNA675）Half-quantitative detection is carried out, described one kind can
Directly to miRNA 675（microRNA675）Carrying out one kind that the kit of sxemiquantitative includes has " by multi-functional stem
The probe and a kind of hybridization buffer containing DNA chain displacement enzyme of unilateral 3 ' the outstanding end double-spiral structures that ring structure is maintained ".
Described one kind has the probe of " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " by A, B
Two different oligonucleotides of length of chain are single-stranded to be assembled, and A chains are more long, and B chains are shorter, and wherein A chains nucleotides sequence is classified as SEQ
ID NO.1： 5’ROX-GCCTCGGTGAGCGGTGAGGGCATACAGCCGAGGCT(-BHQ2)
CTCCAGACGTCACTCAGTGCACC-3 ', the ROX in sequence is fluorophor, and BHQ2 is quenching group；The nucleotides sequence of B chains
It is classified as SEQ ID NO.2：5’-GGTGCACTGAGTGACGTCTGGAGAG-3’；Probe is initial " to be tieed up by multi-functional loop-stem structure
Unilateral 3 ' the outstanding end double-spiral structures held " are not the space structures that DNA chain displacement enzyme can be catalyzed, and the one kind after deforming is " single
The imperfect double-spiral structure of chain-double-strand-single-stranded-double-strand " is the space structure that DNA chain displacement enzyme can be catalyzed.
A kind of described hybridization buffer containing DNA chain displacement enzyme, hybridization temperature between 55-65 DEG C, by Bst 2.0
The mM/ kinds of 32 10 mM, dNTP Mix of U, MgSO4 of WarmStart DNA Polymerase 1, the mM of Tris-HCl 20,
(NH4) 2,SO4 10 mM, KCl 50 mM composition, wherein MgSO4 concentration can be adjusted between 5-20 mM；In the hybridization bar
Under part, probe can be triggered and be deformed into one kind from initial " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure "
" single-stranded-double-strand-single-stranded-double-strand " imperfect double-stranded unique conditional is outer in probe " multi-functional loop-stem structure "
Ring structure and miRNA 675（microRNA675）Specifically bind.
Described one kind has the glimmering of the probe of " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure "
The modification position of light group and quenching group, fluorophor is modified on 5 ' terminal nucleotides of probe A chains, and quenching group modification exists
On the paratope nucleotides or adjacent nucleotides at 5 ' ends；After so modifying, probe " is tieed up in initial by multi-functional loop-stem structure
During unilateral 3 ' the outstanding end double-spiral structures held ", fluorophor is less than 10nm with quenching group space length, it will fluorescence occurs and is total to
Shake energy transfer, cause fluorescence to be quenched, therefore probe is in initial " unilateral 3 ' the outstanding double spiral shells in end maintained by multi-functional loop-stem structure
During rotation structure ", therefore can't detect fluorescence.When probe deformations are a kind of " single-stranded-double-strand-single-stranded-double-strand " imperfect double helix
During structure, space length is much larger than 10 nm between fluorophor and quenching group, it is impossible to which FRET occurs, glimmering
Light group can not be quenched, therefore detectable fluorescence；Whenever " appearance of target sequence → combined with probe → probe deformations → chain prolongs
Stretch → strand displacement → target sequence dissociates again " circular response once, the amount of the probe that is opened is increased by a target sequence original vol,
The original vol of target sequence is bigger, and the probe amount that fluorescence is sent in the unit interval is bigger, i.e. the cumulative speed and target of fluorescence intensity
Sequence concentration is directly proportional；Therefore, the presence that probe has its own signal enlarging function, denier target sequence can also be detected
Arrive, it is not necessary to expanded.
Described one kind can directly to miRNA 675（microRNA675）The kit for carrying out sxemiquantitative is used for
A certain miRNA 675 in total serum IgE（microRNA675）It is to come real as follows to carry out half-quantitative detection
Existing：
（1）The μ L of probe 1 that concentration is 10 μM are taken, is added in the hybridization buffer of the μ L of 12 μ L enzymes containing DNA chain displacement 2, mixed
It is even；
（2）5 μ L samples are wherein added to aforesaid liquid, send realtimePCR instrument to detect after mixing；
（3）Testing conditions are usually 60 DEG C of constant temperature 30 minutes, detection temperature and detection time and can as the case may be in 50-
Adjusted between 65 DEG C, 5-30 minutes；
（4）Interpretation of result, fluorescence intensity cumulative speed and purpose miRNA 675 in sample（microRNA675）Content
It is directly proportional, the method that testing result judges there are two kinds, when purpose miRNA 675 in sample to be tested（microRNA675）
When content is relatively low, fluorescence intensity level sample higher in same time, its purpose miRNA 675（microRNA675）
Content it is higher；When purpose miRNA 675 in sample to be tested（microRNA675）When content is higher, reach identical glimmering
The shorter sample of time used by light intensity value, its miRNA 675（microRNA675）Content it is higher.
Described one kind can directly to miRNA 675（microRNA675）The kit for carrying out sxemiquantitative is utilized
This space structure carries out miRNA 675（microRNA675）The operation principle of half-quantitative detection be, small core
Ribosomal ribonucleic acid 675（microRNA675）Its own signal circulation iodine of startup "：The probe of initial configuration（Unstressed configuration signal）
→ miRNA 675（microRNA675）Appearance → combined with probe after trigger probe deformations（Fluorescence is sent after deformation
Signal, non-trivial ribonucleic acid 675（microRNA675）Do not cause probe deformations）→ chain extension → strand displacement（Initial configuration is visited
Pin will not occur chain extension and strand replacement reaction）→ miRNA 675（microRNA675）Again dissociate → cause again
The probe deformations of other initial configurations（Its own signal circulation is amplified）.
Embodiment one
MircroRNA675 standard items to different content carry out semi-quantitative analysis.
Step one：The design and secondary structure prediction of probe, mircroRNA675 nucleotides sequences are classified as SEQ ID NO.3：
5’CTGTATGCCCTCACCGCTCA 3’.A chain nucleotides sequences are classified as SEQ ID NO.1： 5’ROX-GLCLCLTCGGTGAGCGGTGAGGGCATACAGCCGAGGCT(- BHQ2) CTCCAGACGTCACTCAGTGCACC-3 ', B chain
Nucleotides sequence is classified as SEQ ID NO.2：5’-GGTGCACTGAGTGACGTCTGGAG
AG-3’.The sequence of single underscore is complementary, 5 ' terminal modified ROX（Red fluorescence group）, the T modifications BHQ2 of double underline（It is glimmering
Optical quenching group）, the nucleotides with upper right footmark L is lock nucleic acid, and the modification of lock nucleic acid is served only for increasing probe initial configuration
Heat endurance, reduce background fluorescence, without other effect.By http:The A chains two that //sg.idtdna.com/UNAFold is provided
Level structure predicts the outcome and Δ G=-2.85, shows that the secondary structure can be spontaneously formed.As shown in Fig. 2 holding the 2nd alkali from 5 '
Base C to the 33rd bases G is expected " multi-functional loop-stem structure ".It is the line without secondary structure from the 34th base T to 3 ' end
Property is single-stranded, and used as the binding domain of B chains, linear single-stranded without secondary structure is conducive to the quick combination of B chains.A chain secondary structures are pre-
Survey result completely the same with expected design.It is the A chain secondary structure figures of software prediction of the invention referring to Fig. 2.B chain warps are identical soft
Part predicts that Δ G minimum values are 1.15, show that B chains are linear single-stranded without secondary structure.The binding site of its 3 ' end C is A chains 5 '
The 33rd bases G is held, holds the 2nd base C preferentially to occupy by " multi-functional loop-stem structure " 5 ', therefore B chains and A chain combinations
It is the double-spiral structure of free state to form the end C of B chains 3 ' afterwards, i.e. " unilateral 3 ' outstanding end double-spiral structure ", is this hair referring to Fig. 3
Bright mircroRNA675 probe design drawings.
Step 2：The synthesis of probe, it is 100 μm of μ L of A chains freeze-dried powder 10 of ol/L to take concentration, is added to 80 μ L's
95 DEG C of metal baths 1 minute, are slowly cooled to room temperature after taking-up in PBS, stand 10 minutes, and it is 100 μm of ol/L to add concentration
The μ L of B chains freeze-dried powder 10, stand 10 minutes at room temperature after mixing, obtain final product.
Step 3：The μ L of titer 1 of the artificial synthesized mircroRNA675 templates containing various concentrations are taken, is separately added into
To in the union of 200 μ L milkys eight, the content of mircroRNA675 is respectively 1.0*10 in sample-12mol 、1.0*10- 13Mol, 1.0*10-14Mol, 1.0*10-15Mol, 1.0*10-16Mol, 1.0*10-17Mol, 1.0*10-18Mol, and use ultra-pure water generation
Blank is done for mircroRNA675, acquired results are background fluorescence activity；
Step 4：To adding concentration to be 10 μm of the μ L of probe 1 and the μ L of hybridization buffer 18 of ol/L in aforesaid liquid, add up to
20 μ L, send qPCR instrument to detect after mixing；
Step 5：Testing conditions are in 60 DEG C of constant temperature 30 minutes；
Step 6：Interpretation of result.Testing result is as shown in figure 4, all sample fluorescence values containing mircroRNA675 are notable
Higher than blank, wherein mircroRNA675 contents are 1.0*10-18mol（1 amol）Fluorescence intensity level be higher by blank pair
According to about 2 times；And mircroRNA675 contents sample higher, fluorescence intensity is stronger, and the reaction time is shorter, mircroRNA675
Content is 1.0*10-12mol（1 pmol）Sample just reached reaction end at 10 minutes, it is empty that its fluorescence intensity is higher by l
White control an order of magnitude, fully shows that the art of this patent has high sensitivity.
The content of mircroRNA675 is followed successively by representative sample respectively from a to g：1.0*10-12mol、1.0*10-13mol
1.0*10-14mol、1.0*10-15mol、1.0*10-16mol、1.0*10-17mol、1.0*10-18Mol, nethermost curve is empty
White control.
Embodiment two
The specificity of this method is investigated using high concentration single base mismatch sequence
Step one：MircroRNA675 probes are designed and synthesis, one and step 2 the step of see embodiment 1, single base mismatch core
Nucleotide sequence is SEQ ID NO.4：5’ CTGTATGCTCTCACCGCTCA 3 ', compared with mircroRNA675 sequences, only one
Individual base T is variant；
Step 2：It is 10 μm of the μ L of probe 1 and the μ L of hybridization buffer 18 of ol/L to take concentration respectively, adds up to 19 μ L, is mixed
After be added in the union of 200 μ L milkys eight；
Step 3：To the μ L of addition mircroRNA675 standard items 1 in A sample apertures, the content for making mircroRNA675 in sample is
1 pmol；To the μ L of single base mismatch template 1 are added in B sample apertures, the content for making single base mismatch template in sample is 100
Pmol, two sample population products are only higher than the single base mismatch template in 100 times of A holes in being 20 μ L, i.e. B samples, and are not added with
Enter microRNA675, send realtimePCR instrument to detect after mixing, and blank is done with ultra-pure water；
Step 4：Testing conditions are in 60 DEG C of constant temperature 60 minutes（The extension time is special in order to clearer this detection of display
Property）；
Step 5：Interpretation of result.Testing result is as shown in figure 5, A sample fluorescence values are consistently higher than B sample an order of magnitude, probe
Under the interference of high concentration single base mismatch template, testing result and background fluorescence（C samples）Indifference shows very high
Specificity.Research to microRNA shows that most of microRNA sequence differences are more than 2 bases, therefore sheet
Patented technology has superpower recognition capability to microRNA675.
Accompanying drawing 1 is the fundamental diagram of mircroRNA675 probes, A：" unilateral 3 ' maintained by multi-functional loop-stem structure hang
End double-spiral structure "（Probe initial configuration）；B：" single-stranded-double-strand-single-stranded-double-strand " imperfect double-spiral structure（Probe deformations
Structure）；C：Intact duplex with A chains as template（Reaction final structure）.
Its operation principle is " its own signal circulation iodine that microRNA675 starts "：The probe of initial configuration（Nothing
Fluorescence signal）Trigger probe deformations after the appearance of → microRNA675 → combined with probe（Fluorescence signal is sent after deformation, it is non-
MicroRNA675 does not cause probe deformations）→ chain extension → strand displacement（Initial configuration probe will not occur chain extension and strand displacement
Reaction）→ microRNA675 dissociate → causes the probe deformations of other initial configurations again again（Its own signal circulation is amplified）.
FRET（fluorescence resonance energy transfer, FRET）, it is apart from close two
A kind of energy transfer phenomenon produced between individual fluorescence molecule.When the suction of the emission spectrum and acceptor fluorescence molecule of donor fluorescent molecule
Spectra overlapping is received, and two distances of molecule are when within 10 nanometer ranges, a kind of energy of on-radiation will occur and turn
Move so that many (fluorescent quenchings) that will be low during its individualism of the fluorescence intensity ratio of donor, and the fluorescence of acceptor emission is significantly
Enhancing (sensitized fluorescence).Such as Fig. 1, the space length of fluorophor and fluorescent quenching group in A is less than 10 nanometers, it may occur that
FRET, causes fluorescence to be quenched, therefore, can't detect fluorescence signal；And the A that goes out to be now able to make of microRNA675 is deformed into B,
Fluorophor is much larger than 10 nanometers with the space length of fluorescent quenching group, and FRET stops, and fluorescence signal can be detected；DNA
Substituted enzyme can be catalyzed B generation C, and microRNA675 combined under displacement, it is dissociated again, so
MicroRNA675 can be combined with the probe of other initial configurations again, realize that its own signal circulation is amplified.
Accompanying drawing 2 is the secondary structure prediction figure of the probe A chains using microRNA675 as target sequence, A：Outer ring structure；B：
" occupy-place cane structure "；C：Wire single-stranded structure.From 5 ' the 1st nucleotides C to the 7th nucleotides A in end, with the 34th nucleotides
G to the 28th nucleotides T-shaped into 7 double helixs of base-pair be " occupy-place cane structure ", wherein the 34th nucleotides G is B
The complementary site at the outstanding end of chain 3 '；8th cyclic single strand of nucleotides A to the 28th nucleotides T is outer ring structure；35th nucleosides
The sour ends of T to 3 ' are linear structure, are the domains of B chain combinations." occupy-place cane structure ", outer ring structure and three knots of wire single-stranded structure
Structure domain collectively constitutes " multi-functional loop-stem structure ".
Accompanying drawing 3 is the initial space structure chart of the probe for detecting microRNA675., A：Outer ring structure（Annular closed list
Chain）；B：Occupy-place cane structure（Double helix）；C：Wire single-stranded structure；D：Unilateral 3 ' outstanding end double-spiral structure（Occupy-place cane knot
Structure 5 ' holds+B chains+wire single-stranded structure）；E：The C bases of the position are that the knot at the outstanding end in 3 ' for capturing is held by occupy-place cane structure 5 '
Close site；F：3 ' outstanding ends." unilateral 3 ' outstanding end double-spiral structure " that " the multi-functional loop-stem structure " and B chains that A chains are formed are formed
Collectively constitute " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " of probe.The 5 ' of A chains are terminal modified red
Color fluorescent dye ROX, the adjacent T base modifications fluorescent quenching group BHQ2 of complimentary positions.
Accompanying drawing 4 is to detect that different content mircroRNA675 is investigated as the probe sensitivity of target sequence --- difference contained
The microRNA675 standard items of amount carry out semi-quantitative analysis.The content of microRNA675 is in representative sample successively from a to g：
1.0*10-12mol、1.0*10-13mol 1.0*10-14mol、1.0*10-15mol、1.0*10-16mol、1.0*10-17mol、1.0*
10-18Mol, nethermost curve is blank（Water）.Ordinate is fluorescence intensity level, and abscissa is the time, and unit is point
Clock.Blank sample replaces microRNA675 with ultra-pure water, and acquired results are background fluorescence activity.
Accompanying drawing 5 adds the testing result of single base mismatch sequence of the content higher than 100 times of microRNA675.A：To sample
In comprise only 1 pmol microRNA675 standard items testing result；B：To containing 1 pmol's in sample
The testing result of microRNA675 standard items, the single base mismatch sequence of 100 pmol and 1 pmol double-stranded DNAs；C：To sample
In do not contain microRNA675, but the single base mismatch sequence containing 100 pmol and double-stranded DNA testing result；D：To sky
The testing result of white check sample.Ordinate is fluorescence intensity level, and abscissa is the time, and unit is minute.Blank sample
Replace microRNA675 with ultra-pure water, acquired results are background fluorescence activity.
Sequence table
<110>Chinese Medical Sciences University
<120>One kind can directly to miRNA 675（microRNA675）Carry out the kit of sxemiquantitative
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 58
<212> DNA
<213>Artificial sequence
<400> 1
gcctcggtga gcggtgaggg catacagccg aggctctcca gacgtcactc agtgcacc 58
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence
<400> 2
ggtgcactga gtgacgtctg gagag 25
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
ctgaatgccc tcaccgctca 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
ctgaatgctc tcaccgctca 20
Claims (7)
1. one kind can directly to miRNA 675（microRNA675）The kit of sxemiquantitative is carried out, for total serum IgE
In a certain miRNA 675（microRNA675）Carry out half-quantitative detection, it is characterised in that：Described one kind can
Directly to miRNA 675（microRNA675）Carrying out one kind that the kit of sxemiquantitative includes has " by multi-functional stem
The probe and a kind of hybridization buffer containing DNA chain displacement enzyme of unilateral 3 ' the outstanding end double-spiral structures that ring structure is maintained ".
2. one kind according to claim 1 can directly to miRNA 675（microRNA675）Carry out sxemiquantitative
Kit, it is characterised in that：Described one kind has " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure "
Probe assembled by two different oligonucleotides of length of A, B chain are single-stranded, A chains are more long, and B chains are shorter, wherein A chains nucleotides
Sequence is SEQ ID NO.1： 5’ROX-GCCTCGGTGAGCGGTGAGGGCATACAGCCGAGGCT(-BHQ2)
CTCCAGACGTCACTCAGTGCACC-3 ', the ROX in sequence is fluorophor, and BHQ2 is quenching group；The nucleotides of B chains
Sequence is SEQ ID NO.2：5’-GGTGCACTGAGTGACGTCTGGAGAG-3’；Probe it is initial " by multi-functional loop-stem structure
Unilateral 3 ' outstanding end double-spiral structures of maintenance " are not the space structures that DNA chain displacement enzyme can be catalyzed, and the one kind after deforming
" single-stranded-double-strand-single-stranded-double-strand " imperfect double-spiral structure is the space structure that DNA chain displacement enzyme can be catalyzed.
3. one kind according to claim 1 can directly to miRNA 675（microRNA675）Carry out sxemiquantitative
Kit, it is characterised in that：A kind of described hybridization buffer containing DNA chain displacement enzyme, hybridization temperature between 55-65 DEG C,
By the mM/ kinds of 2.0 WarmStart DNA Polymerase of Bst, 32 10 mM, dNTP Mix of U, MgSO4 1, Tris-HCl
20 mM, (NH4) 2,SO4 10 mM, KCl 50 mM composition, wherein MgSO4 concentration can be adjusted between 5-20 mM；At this
Under hybridization conditions, probe from initial " unilateral 3 ' the outstanding end double-spiral structures maintained by multi-functional loop-stem structure " deformation can be triggered
For a kind of " single-stranded-double-strand-single-stranded-double-strand " imperfect double-stranded unique conditional is probe " multi-functional loop-stem structure "
In outer ring structure and miRNA 675（microRNA675）Specifically bind.
4. one kind according to claim 1 and 2 can directly to miRNA 675（microRNA675）Carry out semidefinite
The kit of amount, it is characterised in that：Described one kind has " unilateral 3 ' the outstanding end double helix knots maintained by multi-functional loop-stem structure
The fluorophor of the probe of structure " and the modification position of quenching group, fluorophor are modified on 5 ' terminal nucleotides of probe A chains,
Quenching group modification is on the paratope nucleotides or adjacent nucleotides at 5 ' ends；After so modifying, probe is initial " by many
During unilateral 3 ' the outstanding end double-spiral structures that function loop-stem structure is maintained ", fluorophor is less than 10nm with quenching group space length,
FRET will occur, cause fluorescence to be quenched, therefore probe " is maintained in initial by multi-functional loop-stem structure
During unilateral 3 ' outstanding end double-spiral structure ", therefore can't detect fluorescence.
5. when probe deformations are a kind of " single-stranded-double-strand-single-stranded-double-strand " imperfect double-spiral structure, fluorophor be quenched
Space length is much larger than 10 nm between group, it is impossible to FRET occurs, fluorophor can not be quenched, therefore can
Detect fluorescence；Whenever " the appearance of target sequence → combined with probe → probe deformations → chain extension → strand displacement → target sequence weight
It is new free " circular response once, the amount of the probe that is opened is increased by a target sequence original vol, and the original vol of target sequence is bigger,
The probe amount that fluorescence is sent in unit interval is bigger, i.e. the cumulative speed of fluorescence intensity is directly proportional to target sequence concentration；Therefore,
The presence that probe has its own signal enlarging function, denier target sequence can also be detected, it is not necessary to be expanded.
6. according to claim 1 a kind of directly to miRNA 675（microRNA675）Carry out the examination of sxemiquantitative
Agent box, it is characterised in that：Described one kind can directly to miRNA 675（microRNA675）Carry out the examination of sxemiquantitative
Agent box be used for total serum IgE in a certain miRNA 675（microRNA675）It is by as follows to carry out half-quantitative detection
Step is realized：
（1）The μ L of probe 1 that concentration is 10 μM are taken, is added in the hybridization buffer of the μ L of 12 μ L enzymes containing DNA chain displacement 2, mixed
It is even；
（2）5 μ L samples are wherein added to aforesaid liquid, send realtimePCR instrument to detect after mixing；
（3）Testing conditions are usually 60 DEG C of constant temperature 30 minutes, detection temperature and detection time and can as the case may be in 50-
Adjusted between 65 DEG C, 5-30 minutes；
（4）Interpretation of result, fluorescence intensity cumulative speed and purpose miRNA 675 in sample（microRNA675）Content
It is directly proportional, the method that testing result judges there are two kinds, when purpose miRNA 675 in sample to be tested（microRNA675）
When content is relatively low, fluorescence intensity level sample higher in same time, its purpose miRNA 675（microRNA675）
Content it is higher；When purpose miRNA 675 in sample to be tested（microRNA675）When content is higher, reach identical glimmering
The shorter sample of time used by light intensity value, its miRNA 675（microRNA675）Content it is higher.
7. one kind according to claim 1 can directly to miRNA 675（microRNA675）Carry out sxemiquantitative
Kit, it is characterised in that：Described one kind can directly to miRNA 675（microRNA675）Carry out sxemiquantitative
Kit carries out miRNA 675 using this space structure（microRNA675）Half-quantitative detection work it is former
Reason is, miRNA 675（microRNA675）Its own signal circulation iodine of startup "：The probe of initial configuration
（Unstressed configuration signal）→ miRNA 675（microRNA675）Appearance → combined with probe after trigger probe deformations（Become
Fluorescence signal, non-trivial ribonucleic acid 675 are sent after shape（microRNA675）Do not cause probe deformations）→ chain extension → chain is put
Change（Initial configuration probe will not occur chain extension and strand replacement reaction）→ miRNA 675（microRNA675）Again
Dissociate → cause the probe deformations of other initial configurations again（Its own signal circulation is amplified）.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710173785.6A CN106834512A (en) | 2017-03-22 | 2017-03-22 | A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710173785.6A CN106834512A (en) | 2017-03-22 | 2017-03-22 | A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834512A true CN106834512A (en) | 2017-06-13 |
Family
ID=59130173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710173785.6A Withdrawn CN106834512A (en) | 2017-03-22 | 2017-03-22 | A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834512A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789667A (en) * | 2015-04-08 | 2015-07-22 | 西安交通大学 | Small RNA (ribonucleic acid) detection kit and quantitative method based on unbiased recognition and isothermal amplification |
| CN105002285A (en) * | 2015-07-30 | 2015-10-28 | 中国人民解放军第三军医大学第一附属医院 | Liquid-stage chip constant-temperature detection method for tiny RNA |
| CN105063190A (en) * | 2015-07-30 | 2015-11-18 | 中国人民解放军第三军医大学第一附属医院 | Solid chip constant temperature detection method of MiRNA |
| CN105154534A (en) * | 2015-07-30 | 2015-12-16 | 中国人民解放军第三军医大学第一附属医院 | Real-time constant-temperature index amplification method of tiny RNAs |
-
2017
- 2017-03-22 CN CN201710173785.6A patent/CN106834512A/en not_active Withdrawn
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789667A (en) * | 2015-04-08 | 2015-07-22 | 西安交通大学 | Small RNA (ribonucleic acid) detection kit and quantitative method based on unbiased recognition and isothermal amplification |
| CN105002285A (en) * | 2015-07-30 | 2015-10-28 | 中国人民解放军第三军医大学第一附属医院 | Liquid-stage chip constant-temperature detection method for tiny RNA |
| CN105063190A (en) * | 2015-07-30 | 2015-11-18 | 中国人民解放军第三军医大学第一附属医院 | Solid chip constant temperature detection method of MiRNA |
| CN105154534A (en) * | 2015-07-30 | 2015-12-16 | 中国人民解放军第三军医大学第一附属医院 | Real-time constant-temperature index amplification method of tiny RNAs |
Non-Patent Citations (5)
| Title |
|---|
| GUO-LEI WANG ET AL.: ""Sensitive Detection of MicroRNAs with Hairpin Probe-Based Circular Exponential Amplification Assay"", 《ANALYTICAL CHEMISTRY》 * |
| HAIYUN LIU ET AL.: ""Sensitive and rapid detection of microRNAs using hairpin probes-mediated exponential isothermal amplification"", 《BIOSENSORS AND BIOELECTRONICS》 * |
| MARIA CHIARA GIUFFRIDA ET AL.: ""Isothermal circular-strand-displacement polymerization of DNA and microRNA in digital microfluidic devices"", 《ANAL BIOANAL CHEM》 * |
| ZHEN LI ET AL.: ""A label-free amplified fluorescence DNA detection based on isothermal circular strand-displacement polymerization reaction and graphene oxide"", 《ANALYST》 * |
| 马强 等: ""MiRNA与肾上腺皮质癌"", 《生命的化学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2835101T3 (en) | Nucleic acid detection | |
| ES2605237T3 (en) | Novel markers for bladder cancer detection | |
| CN109897887B (en) | Telomerase activity detection method based on FRET | |
| CA2769302A1 (en) | A set of oligonucleotide probes as well as methods and uses related thereto | |
| CN109913546A (en) | A kind of fluorescent bio-probes detecting miRNA and detection method and purposes | |
| Tang et al. | Programmable DNA triple-helix molecular switch in biosensing applications: from in homogenous solutions to in living cells | |
| CN107604042A (en) | The method of detection terminal deoxynucleotidyl transferase activity based on single quantum dot | |
| Cai et al. | A signal-on fluorescent aptasensor based on single-stranded DNA-sensitized luminescence of terbium (III) for label-free detection of breast cancer cells | |
| ES2281743T3 (en) | TEST TO DETECT THE STATE OF METHODATION BY EXTENSION WITH SPECIFIC INITIATORS OF METHODATION (MSPE). | |
| CN109563540A (en) | DNA probe in situ hybridization on chromosome | |
| CN105274226B (en) | MicroRNA SDA detection SDA reaction solution based on AgNCs/HpDNA probe | |
| CN104928390B (en) | A kind of MicroRNA detection method | |
| CN104726603B (en) | Graphene quantum dot based molecular beacon sensor as well as preparation method and application of sensor | |
| CN108624691A (en) | A kind of marker and its application for judging prostatic disorders | |
| Shandilya et al. | Gold based nano-photonic approach for point-of-care detection of circulating long non-coding RNAs | |
| CN107354227A (en) | MicroRNA probe one-step method real-time fluorescent quantitative PCR detecting methods | |
| CN109913534A (en) | A method of two kinds of miRNA based on concatenated dna chain circular response and fluorescence resonance energy transfer effect are detected simultaneously | |
| CN106834514A (en) | One kind can be directly to miRNA（microRNA）Carry out the probe of sxemiquantitative | |
| RU2463354C1 (en) | Diagnostic technique for bladder cancer by cancer-specific marker tedp1 (versions) and kit for implementing it | |
| Kim et al. | The detection of a mismatched DNA by using hairpin DNA-templated silver nanoclusters | |
| CN111944821A (en) | Rapid screening of tissue sample of colon cancer aptamer and application of rapid screening in detection preparation | |
| CN114507706B (en) | Enzyme DNA repair cascade driving fluorophore coding/de-coding based biosensor and application thereof in telomerase detection | |
| CN106834512A (en) | A kind of kit that sxemiquantitative is directly carried out to miRNA 675 (microRNA675) | |
| CN106754902B (en) | A kind of fluorescence resonance probe and its application and kit | |
| CN109161580A (en) | HER2 gene by fluorescence in situ hybridization probe and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170613 |
|
| WW01 | Invention patent application withdrawn after publication |