CN110042175A - Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus - Google Patents
Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus Download PDFInfo
- Publication number
- CN110042175A CN110042175A CN201910399130.XA CN201910399130A CN110042175A CN 110042175 A CN110042175 A CN 110042175A CN 201910399130 A CN201910399130 A CN 201910399130A CN 110042175 A CN110042175 A CN 110042175A
- Authority
- CN
- China
- Prior art keywords
- mosaic virus
- primer
- rpa
- probe
- bean common
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer, probe, kit and applications based on RPA technology detection Bean common mosaic virus.The base sequence of upstream primer is as shown in SEQ ID NO.1, and the base sequence of downstream primer is as shown in SEQ ID NO.2, and the base sequence of probe is as shown in SEQ ID NO.3.In addition to the primer, probe, the kit further includes flow measurement chromatograph test strip, flow measurement chromatograph test strip buffer solution, RPA enzyme, buffer, magnesium acetate solution, ddH2O, one or more of reference substance.The invention also discloses the methods of the detection Bean common mosaic virus.The present invention is based on Bean common mosaic virus CP genes to devise specific primer and probe, reapplies recombinase polymeric enzymatic amplification-flow measurement chromatography method and is prepared for kit, sensibility is high, high specificity, diagnosis is accurate, and entire detection process only needs 30 minutes, and judgement as a result is extremely simple.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to it is a kind of detect Bean common mosaic virus RPA primer, visit
Needle, kit and application.
Background technique
Bean common mosaic virus (Bean common mosaic virus, BCMV) is to be only second to soybean Mosaic
A kind of legume virus disease, be distributed at home also more universal, field susceptible gene is higher, and it is wider to infect range, can invade
Contaminate the plant of a variety of Phaseolus, such as soybean, semen viciae fabae, red bean, mung bean, maljoe, Cassia, chick-pea, pea beans.BCMV is passed
It is relatively more to broadcast approach, common are aphid and pass, plant biography and pollen biography poison, the plant not belonged to can also be inoculated by mechanical friction
On.Aphid obtains the malicious phase and is typically only 15-60s, and after obtaining poison, poison can be passed in lmin, thus very high by aphid transmission efficiency.By
Big in BCMV host range, circulation way is more, so the virus at home and abroad causes greatly to pay attention to.
Currently, the method for detection Bean common mosaic virus mainly has indicator plant method, enzyme linked immunosorbent assay
(ELISA), inverse transcription polymerase chain reaction (RT-PCR) and real-time fluorescence PCR method.Indicator plant detection method is fairly simple, but
Its detection speed is very slow, and can not determine the type for infecting virus, and sensitivity is relatively low.Existing many utilizations both at home and abroad
ELISA method detects the report of Bean common mosaic virus, and this method high sensitivity is easy to operate, but required detection time
At 1~2 day, and the Antibody preparation period was long, and costly, sensitivity is not as good as RT-PCR.It is established using Protocols in Molecular Biology
The methods of RT-PCR, immunocapture RT-PCR, real-time fluorescence RT-PCR and probe hybridization check so that Kidney bean common mosaic
The testing result of poison is more quick, sensitive, accurate.But the method for traditional based on PCR needs to be denaturalized, annealing, extends three steps,
The temperature of each step is different, needs special thermal cycler to carry out, limits its use scope.Therefore many does not depend on
The isothermal amplification technique of PCR instrument is developed, and is especially most widely used with LAMP.
RPA (Recombinasepolymeraseamplifcation) is a novel isothermal amplification technique, main
Principle is that microfilament is formed using recombinase and primer when searching the sequence of complete complementary pairing therewith on template DNA, in list
Make template DNA unwinding under the protein-bonded side group of chain DNA, primer starts to match in template DNA, and in the effect of archaeal dna polymerase
Lower duplication extends.
Summary of the invention
Goal of the invention: not there are problems that in the prior art RPA method detect Bean common mosaic virus, it is of the invention
For the first purpose there is provided primer, probe, kit based on RPA technology detection Bean common mosaic virus, of the invention is another
One purpose is to provide the application of above-mentioned primer, probe, kit, and it is common that the third object of the present invention is to provide a kind of detection Kidney bean
The method of mosaic virus.
Technical solution: the primer and probe combination of the present invention based on RPA technology detection Bean common mosaic virus,
It is characterised by comprising:
Upstream primer: 5 '-TTAGATCATCTGTTGGATTACAAGCCAGAACA-3 '；
Downstream primer: [5 ' BIOTIN] CACCACACCATAAAGCCATTCATCACAATTGA-3 '；
Probe: [5 ' FAM] ACAAAGATGCAGTTTGAAATGTGGTACAAT [THF] CTGTGAAGGAAGAGTA [3 '
BLOCK]。
The present invention also provides a kind of kits based on RPA technology detection Bean common mosaic virus, comprising described
Primer and probe combination.
The kit further includes flow measurement chromatograph test strip, flow measurement chromatograph test strip buffer solution, RPA enzyme, RPA buffering
Liquid, magnesium acetate solution, ddH2O, one or more of reference substance.These ingredients can be prepared voluntarily, can also use commercially available
Product, such as a kind of relatively good selection, flow measurement chromatograph test strip, flow measurement chromatograph test strip buffer solution use Germany Milenia
The Milenia GenLine HybriDetect kit of Biotec GmbH company；RPA enzyme, RPA buffer, magnesium acetate solution
Using the TwistAmp of TwistDX companyTMnfo kit。
The present invention also provides the primer and probe combinations based on RPA technology detection Bean common mosaic virus to exist
Detect the application in Bean common mosaic virus.
The present invention also provides the kits based on RPA technology detection Bean common mosaic virus in detection Kidney bean
Application in mosaic viruses.
The present invention finally provides a kind of method for detecting Bean common mosaic virus, comprising: with the cDNA of sample to be tested
As template, RPA amplification is carried out using the primer and probe combination, identifies amplified production.
Wherein, using identifying in Sidestream chromatography test strips amplified production, according to showing result judgement in test strips
Bean common mosaic virus is positive or negative.Method particularly includes: take 2 μ L amplified productions and 98 μ L HybriDetect Assay
Buffer solution mixes to form mixed liquor, then draws the sample-adding end that 10 μ L mixed liquors are added drop-wise to flow measurement chromatograph test strip, and will
Sample-adding end is immersed vertically equipped with 200 μ L HybriDetect Assay Buffer solution (flow measurement chromatograph test strip buffer solution)
Centrifuge tube in, after five minutes observe test strips on show result.
The overall reaction system of RPA amplification is 50 μ L, the 2.1 μ L of upstream primer that 10 μM of concentration, the downstream primer that 10 μM of concentration
2.1 μ L, the probe that 10 μM of concentration 0.6 μ L, Buffer 29.5 μ L, ddH212.2 μ L of O, 1 μ L sample to be tested cDNA template,
2.5 μ L concentration are that MgAc, RPA enzyme of 280mM is originated from the TwistAmp of TwistDX companyTMnfo kit。
Amplification condition are as follows: 39 DEG C, 20 minutes.
The utility model has the advantages that
The present invention is directed to Bean common mosaic virus CP gene, the primer and probe based on RPA technology is devised, due to mesh
The preceding primer and probe for RPA technology does not form design rule, and the primer of Standard PCR design, probe and is not suitable for
RPA reaction, it is therefore desirable to which technical staff continuously attempts to and explores, and inventor, which have passed through, largely to test and grope, and obtains one
The primer and probe combination that group-specific is high, sensitivity is good.
The present invention is built upon on molecular biology mechanism, first devises spy based on Bean common mosaic virus CP gene
Determine primer and probe, the gene is not only highly conserved, but also to other cause of disease high specials, reapplies the expansion of recombinase polymerase
Increasing-flow measurement chromatography method is prepared for quickly detecting the kit of Bean common mosaic virus, and sensibility is high, and high specificity is examined
Disconnected accurate, entire detection process only needs 30 minutes, and judgement as a result only need to observe the result that flow measurement chromatograph test strip is shown,
It operates extremely simple；Entire reaction process can carry out in a non-laboratory environment after obtaining nucleic acid samples, be applicable not only to room
It is interior to identify and can be applied to field on-site test.
Detailed description of the invention
Fig. 1 is the foundation of embodiment 1RPA detection method as a result, in figure, left: Bean common mosaic virus；It is right: positive
Control；
Fig. 2 is RPA sensitivity experiment testing result, and the dilution of template cDNA is respectively 1,10 from left to right in figure-1、
10-2With 10-3；
Fig. 3 is specificity experiments result figure, respectively is from left to right in figure: Bean common mosaic virus, big Tofu pudding
Mosaic virus, Brassica 2 et 4, negative control, positive control；
Fig. 4 is the testing result of comparative example 1, in figure, respectively is from left to right: Bean common mosaic virus, soybean
Mosaic virus, Brassica 2 et 4, positive control.
Specific embodiment
Combined with specific embodiments below, the present invention is furture elucidated, it should be understood that these embodiments are merely to illustrate the present invention
Rather than limit the scope of the invention, after the present invention has been read, those skilled in the art are to various equivalences of the invention
The modification of form falls within the application range as defined in the appended claims.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
RPA amplification kit TwistAmp in following embodimentsTMNfokits is the product of TwistDX company, product mesh
Record number is TANFO02KIT.
Soybean mosaic virus (Soybean mosaic virus) in following embodiments is in document " Cui Xiaoyan, Chen Xin, goldenrain tree
Crane Xiang, the structure of the soybean cDNA library applied to memebrane protein yeast two-hybrid of Zhi Haijian .2013. soybean mosaic virus induction
It builds Plant Pathology .43 (5): being disclosed in 556-560. ", the public can obtain from Jiangsu Province Agriculture Science Institute.It can also adopt
Strains of Soybean Mosaic Virus disclosed in other.
Bean common mosaic virus (Bean common mosaic virus) in following embodiments document " Shen Liang,
A kind of newfound Bean common mosaic virus Molecular Identification China for infecting mung bean of Cui Jin, Xia Yan, Cui Xiaoyan, Chen Xin .2014.
Northern agronomy reports .29 (4): being disclosed in 1-8. ", the public can obtain from Jiangsu Province Agriculture Science Institute.Other disclosures can also be used
Bean common mosaic virus strain.
Brassica 2 et 4 (Turnip mosaic virus) in following embodiments document " Xiaoyan Cui,
HodaYaghmaiean,Guanwei Wu,Xiaoyun Wu,Xin Chen,Greg Thornc and Aiming
Wang.2017.The C-terminal region of the Turnip mosaic virus P3protein is
essential for viral infection via targeting P3to the viral replication
Complex.Virology.510:147-155. it is disclosed in ", the public can obtain from Jiangsu Province Agriculture Science Institute.It can also adopt
Turnip Mosaic Virus Strains On Oilseed disclosed in other.
Embodiment 1
RPA primer, probe and its RPA kit for detecting Bean common mosaic virus include:
One, the design and synthesis of RPA primer, probe
With reference to CP gene (sequence that the present embodiment strain measures, the online ratio of Bean common mosaic virus in GenBank
Right, the genbank accession number of homology highest 96% is the conserved sequence of KP903372), selects specific conservative region
(position is 9186-9343 in KP903372), designs RPA primer and probe.All primer and probes are by the handsome biology in Shanghai
Technology Co., Ltd.'s synthesis, the base sequence of primer and probe are as follows.
Upstream primer (SEQ ID NO.1):
5′-TTAGATCATCTGTTGGATTACAAGCCAGAACA-3′；
Downstream primer (SEQ ID NO.2):
[5'BIOTIN]CACCACACCATAAAGCCATTCATCACAATTGA-3′；
Probe (SEQ ID NO.3):
[5’FAM]ACAAAGATGCAGTTTGAAATGTGGTACAAT[THF]CTGTGAAGGAAGAGTA[3’a
phosphate]；
In probe, THF is tetrahydrofuran, and FAM is fluorescein, and phosphate is phosphate group；BIOTIN is biotin.
Two, kit forms:
(1) RPA primed probe mixed liquor: upstream primer shown in the NO.1 of ID containing SEQ, downstream shown in SEQ ID NO.2 are drawn
Probe shown in object, SEQ ID NO.3, each primer, probe concentration be 10 μM；
(2) (flow measurement chromatograph test strip is used cooperatively ingredient, Milenia to HybriDetect Assay Buffer solution
GenLine HybriDetect kit, German Milenia Biotec GmbH company, article No. 041)；
(3) Sidestream chromatography test strips (Milenia GenLine HybriDetect, German Milenia Biotec GmbH
Company, article No. 041)
(4) RPA lyophozyme (containing three kinds of polymerase, recombinase and single strand binding protein) and RPA reaction premixed liquid, RPA are anti-
Answer premixed liquid mixed for 29.5 μ L Rehydration Buffer and 2.5 μ L 280mM Magnesium Acetate (magnesium acetate)
Close liquid (TwistDX company, TwistAmpTMNfo kit ingredient).
Mentioned reagent box specific is conventionally bought or is prepared the preparation method comprises the following steps: synthesize the primer and probe
Remaining each ingredient.
Embodiment 2
The method for quickly detecting Bean common mosaic virus using mentioned reagent box, specifically includes the following steps:
(1) recombinase polymeric enzymatic amplification (RPA) is reacted:
Use TwistAmpTMNfo kit prepares the real-time RPA reaction system of 50 μ L, and 10 μM of concentration of upstream primer 2.1 is added
μ L, the 2.1 μ L of downstream primer that 10 μM of concentration, 0.6 μ L, Rehydration Buffer of probe, the 29.5 μ L that 10 μM of concentration, distillation
12.2 μ L of water, is transferred in the 0.2mL reaction tube of the lyophozyme containing RPA after mixing, is 280mM by 1 μ L cDNA template, 2.5 μ L concentration
MgAc be added in the reaction tube, 39 DEG C, amplification obtains amplified production in 20 minutes.
(2) detection of amplified production:
2 μ L RPA amplified productions are drawn after amplified reaction and 98 μ L HybriDetect Assay Buffer solution mix
After form mixed liquor, then draw the sample-adding end that 10 μ L mixed liquors are added drop-wise to Sidestream chromatography test strips, it is finally that test strips are endways
In the centrifuge tube equipped with 200 μ L HybriDetect Assay Buffer solution of insertion, test strips are observed after five minutes and are shown
As a result, if test strips show two thick sticks, be then negative (figure if it is a thick stick for the Bean common mosaic virus positive
1)。
The sensitivity experiments of the kit of the invention of embodiment 3
Experimentation are as follows: Bean common mosaic virus cDNA is subjected to RPA amplified reaction, is added in each amplified reaction dilute
Degree of releasing is 1,10-1, 10-2, 10-3Bean common mosaic virus cDNA be template.It is common according to Kidney bean of the present invention after reaction
Mosaic virus rapid detection method carries out the detection of Sidestream chromatography test strips, and testing result is as shown in fig. 2, it can be seen that this method
It can detecte Bean common mosaic virus cDNA (57.416ng/ul) in reaction system and dilute 100 times, detection sensitivity is high.
Embodiment 4
The specificity experiments of kit of the invention:
Experimentation are as follows: with the cDNA of soybean mosaic virus, Brassica 2 et 4 cDNA and Bean common mosaic virus
CDNA carries out specificity experiments, and experimental result is fig. 3, it is shown that only detect Bean common mosaic virus cDNA's
There is Liang Tiaogang in test strips, and the test strips for detecting other viruses are Yi Tiaogang, illustrate that kit of the present invention is common to Kidney bean
Mosaic virus cDNA has very strong specificity.
Comparative example 1
It is related to primer and probe, specific base sequence for the sequence that position in KP903372 is 9492-9634
It is as follows:
F (SEQ ID NO.4): 5 '-GCATACATTGAGATGAGAAATTCTGAGAGGCC-3 '；
Probe (SEQ ID NO.6):
[5’FAM]CTACTTCGGAATTTGAGGGACAAAAATCTA[THF]CTCGCTACGCT TTTGA[3’a
phosphate]；
R (SEQ ID NO.5):
[5’BIOTIN]GCTTCTCTTGCTCGATCCGATGTTTTGGATGT-3′。
The method progress specific detection of reference embodiment 4, testing result such as Fig. 4, the poor specificity of primer and probe,
BCMV, SMV, TuMV can detect band.
Sequence table
<110>Jiangsu Province Agriculture Science Institute
<120>primer, probe, kit and application based on RPA technology detection Bean common mosaic virus
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ttagatcatc tgttggatta caagccagaa ca 32
<210> 2
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caccacacca taaagccatt catcacaatt ga 32
<210> 3
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (31)
<223>n is tetrahydrofuran
<400> 3
acaaagatgc agtttgaaat gtggtacaat nctgtgaagg aagagta 47
<210> 4
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gcatacattg agatgagaaa ttctgagagg cc 32
<210> 5
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gcttctcttg ctcgatccga tgttttggat gt 32
<210> 6
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (31)
<223>n is tetrahydrofuran
<400> 6
ctacttcgga atttgaggga caaaaatcta nctcgctacg cttttga 47
Claims (9)
1. a kind of primer and probe combination based on RPA technology detection Bean common mosaic virus characterized by comprising
Upstream primer: 5 '-TTAGATCATCTGTTGGATTACAAGCCAGAACA-3 '；
Downstream primer: [5 ' BIOTIN] CACCACACCATAAAGCCATTCATCACAATTGA-3 '；
Probe: [5 ' FAM] ACAAAGATGCAGTTTGAAATGTGGTACAAT [THF] CTGTGAAGGAAGAGTA [3 ' BLOCK].
2. a kind of kit based on RPA technology detection Bean common mosaic virus, which is characterized in that include claim 1 institute
The primer and probe combination stated.
3. the kit according to claim 1 based on RPA technology detection Bean common mosaic virus, which is characterized in that
It further include flow measurement chromatograph test strip, flow measurement chromatograph test strip buffer solution, RPA enzyme, buffer, magnesium acetate solution, ddH2O, right
According to one or more of product.
4. the primer and probe combination according to claim 1 based on RPA technology detection Bean common mosaic virus is being examined
Survey the application in Bean common mosaic virus.
5. the kit according to claim 2 or 3 based on RPA technology detection Bean common mosaic virus is in detection Kidney bean
Application in mosaic viruses.
6. a kind of method for detecting Bean common mosaic virus characterized by comprising using the cDNA of sample to be tested as mould
Plate carries out RPA amplification using primer and probe combination described in claim 1, identifies amplified production.
7. the method for detection Bean common mosaic virus according to claim 6, which is characterized in that tried using Sidestream chromatography
Amplified production is identified on paper slip.
8. the method for detection Bean common mosaic virus according to claim 6, which is characterized in that RPA is expanded total anti-
Answering system is 50 μ L, the 2.1 μ L of upstream primer that 10 μM of concentration, the 2.1 μ L of downstream primer that 10 μM of concentration, the probe that 10 μM of concentration
0.6 μ L, Buffer 29.5 μ L, ddH212.2 μ L of O, the cDNA template of 1 μ L sample to be tested, 2.5 μ L concentration are 280mM's
MgAc, RPA enzyme are originated from the TwistAmp of TwistDX companyTMnfo kit。
9. the method for detection Bean common mosaic virus according to claim 6, which is characterized in that amplification condition are as follows: 39
DEG C, 20 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910399130.XA CN110042175A (en) | 2019-05-14 | 2019-05-14 | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910399130.XA CN110042175A (en) | 2019-05-14 | 2019-05-14 | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110042175A true CN110042175A (en) | 2019-07-23 |
Family
ID=67281850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910399130.XA Withdrawn CN110042175A (en) | 2019-05-14 | 2019-05-14 | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110042175A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241265A (en) * | 2019-07-29 | 2019-09-17 | 中国农业科学院兰州兽医研究所 | The quick detection primer probe groups of pig Delta coronavirus LFD-RPA and kit |
| CN114231665A (en) * | 2021-12-09 | 2022-03-25 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof |
-
2019
- 2019-05-14 CN CN201910399130.XA patent/CN110042175A/en not_active Withdrawn
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241265A (en) * | 2019-07-29 | 2019-09-17 | 中国农业科学院兰州兽医研究所 | The quick detection primer probe groups of pig Delta coronavirus LFD-RPA and kit |
| CN114231665A (en) * | 2021-12-09 | 2022-03-25 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110184390A (en) | For identifying the double FQ-PCR detection kit of African swine fever and wild strains of classical swine fever virus | |
| CN110358867A (en) | African hog cholera virus fluorescent type RAA detection kit | |
| CN104195268B (en) | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN104862420A (en) | Primer, probe and kit for detecting foot-and-mouth disease virus in aerosol through RPA-lateral flow assay technology | |
| CN109609695A (en) | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus | |
| CN107435080A (en) | A kind of recombinase normal temperature amplification of nucleic acid for detecting CSFV（RT‑RPA）Test strips kit and application | |
| CN104946795A (en) | Primers, probes and kit for on-site detection of a variety of serotype foot and mouth disease viruses | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN110218819A (en) | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| CN110042175A (en) | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus | |
| CN108546779A (en) | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota | |
| CN108977578A (en) | Detect the kit and its method of H7N9 avian influenza virus | |
| CN106119421B (en) | QYYZ plants of pig blue-ear disease of fluorogenic quantitative detection primer, probe and kit | |
| CN102994650B (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| US20230250497A1 (en) | One-step nested pcr primers set and kit modified with locked nucleic acid for detecting african swine fever virus | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN109943667A (en) | Primer, probe, kit and application based on RPA technology detection soybean mosaic virus | |
| CN110129482A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN109971886A (en) | A kind of kit for detecting CPV nucleic acid, RPA primer pair, probe and method | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN113462814A (en) | RPA primer, probe, kit and detection method for detecting sweet potato golden vein virus | |
| CN106755567B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) detection primer, probe, detection kit and detection method for simian SRV (sequence-related syndrome Virus) | |
| CN111206117A (en) | Kit for detecting human immunodeficiency virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190723 |
|
| WW01 | Invention patent application withdrawn after publication |