CN104195268B - Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C - Google Patents
Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C Download PDFInfo
- Publication number
- CN104195268B CN104195268B CN201410464443.6A CN201410464443A CN104195268B CN 104195268 B CN104195268 B CN 104195268B CN 201410464443 A CN201410464443 A CN 201410464443A CN 104195268 B CN104195268 B CN 104195268B
- Authority
- CN
- China
- Prior art keywords
- type
- foot
- mouth disease
- virus
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The open one of the present invention can be used for detecting foot and mouth disease A type, O type and Asia? the primer of 1 C-type virus C, by the test kit and the preparation method that include this primer.Of the present invention for detecting foot and mouth disease A type, O type and Asia? the primer gene order of 1 C-type virus C totally 6, then add two universal primers.Relevant experiment shows, can primer sequence of the present invention specificity rapid amplifying foot and mouth disease A type, O type and Asia? the nucleic acid of 1 C-type virus C, specific band is detected by nucleic acid electrophoresis, but the nucleic acid of can not increase under equal conditions vesicular stomatitis virus and swine vesicular disease virus.The present invention can be used for differentiating foot and mouth disease A type, O type, Asia fast? 1 C-type virus C, and apply in foot and mouth disease virus epidemiological study.
Description
Technical field
The present invention relates to a kind of primer that can be used for detecting foot and mouth disease A type, O type and Asia1 C-type virus C, by the test kit and the preparation method that include this primer.
Background technology
Foot and mouth disease (Foot-and-mouthdisease, FMD) be by foot and mouth disease virus (Foot-and-mouthdiseasevirus, FMDV) animal caused is acute, deadly infectious disease, main harm pig, ox, sheep pox artiodactyl, sickness rate is high, cause huge politics, financial loss, be therefore classified as the first place of category-A transmissible disease by the World Health Organization (OIE).FMDV can be divided into 7 serotypes, i.e. A type, O type, C type, Asia1 type, SAT1 type, SAT2 type and SAT3 type, each serum has again many different hypotypes, and does not have intercrossing immunity between each serotype, only has partial intersection immunity between each hypotype of same serotype.
Be conducive to the selection of ad hoc type vaccine due to rapid differential diagnosis result and control epidemic disease and spread, the somatotype differential diagnosis of foot and mouth disease virus is the focus of research always.Owing to not having cross protection between each serotype of foot and mouth disease, only have partial intersection immunity between each hypotype of same serotype, this makes the diagnosis of foot and mouth disease and controls more difficult.Complement fixation test (CFT) was once used to foot and mouth disease diagnosis and Viral typing, until 1970s the method still uses in some prevailing disease areas, but the remolding sensitivity of the method is lower.Roeder and LeBlancSmith successfully have detected foot-and-mouth disease virus antigen by using the ELISA method of rabbit and cavy antivenom purification 146S foot and mouth disease virus particle height titered antiserum.The remolding sensitivity complement fixation test (CFT) of the method is high 125 times, and is used as diagnosis and the Viral typing of conventional foot and mouth disease.But the epithelium suspension that ELISA method detects containing virus is only had an appointment 70-80% positive findings, after therefore virus must be bred in tissue culture, then by carrying out in ELISA detecting and Serotypes.ELISA based on monoclonal antibody is also developed diagnosis for foot and mouth disease and Viral typing (Chen, H, etal., 2012; MoriokaK, etal., 2009).Recently, someone have developed the sandwich ELISA method of basic beta 2 integrin alpha ν β 6 and serological specificity monoclonal antibody, and the method and common polyclonal antibody sandwich ELISA method is compared.The ELISA of integral protein/monoclonal antibody can identify the plurality of antigens of FMDV and different serotype, although the method has higher specificity than conventional polyclone ELISA under the condition of same sensitivity, but still there are some FMDVs not to be detected, (FerrisNP, etal., 2011).
Because RT-PCR is quick, the advantage of sensitive and reliability, the method has been widely used in foot and mouth disease diagnosis.Various RT-PCR detection method is for early stage epithelial cell in recent years, and cell cultures is separated the detection (MeyerRF, etal., 1991) with foot and mouth disease virus RNA in its tissue.Rodriguez etc. carry out somatotype detection (Rodr í guezA, etal., 1992) by RT-PCR to foot and mouth disease virus O type, A type and C type first.Henceforth different serotypes Auele Specific Primer RT-PCR method has been used to foot and mouth disease virus 7 serotype part somatotypes and has detected (Callens, etal., 1997; Vangrysperre, etal., 1996).These detect the different positions that primer is positioned at foot-and-mouth disease virus gene group, comprise 5' non-coding region, open reading frame and 3' and hold non-coding region.In order to improve RT-PCR diagnostic sensitivity, the Multiple detection that many group primers combine also is used to detection (GiridharanP, etal., 2005 of foot and mouth disease; BaoH, etal., 2008), but the sensitivity of these RT-PCR method is still limited, if early stage uses together in conjunction with ELISA method again will inevitably make this process time and effort consuming more.
Recently, real-time fluorescent quantitative RT-PCR method has been used to the detection of foot and mouth disease virus, and the method is not needed PCR post-processed (example gel analysis) and directly monitored the amplification of target cDNA by induction signal.The Detection results synantigen of TaqMan experiment is tested the same (ReidSM, etal., 2003) in conjunction with the virus purification of ELISA.At present, two kinds of different real-time fluorescence quantitative RT-PCR TaqMan experiments generally use, for the internal ribosome entry site (IRES) (ReidSM, etal., 2002) of 5' non-coding region and the second for 3D(RNA polysaccharase) encoding sequence.The speed of real-time fluorescent quantitative RT-PCR method and accuracy can be extracted the coupling of testing the computer operation of setting up from sample nucleic and improve further.This makes this detection be suitable for main indicator case diagnosis and the detection in lasting epidemic situation.In real time/quantitative RT-PCR assay is diagnosed and quantitative conventionally test as a kind of foot and mouth disease virus in many developed countries at present.But, these experiments be not specialized designs for differentiation hoof-and-mouth disease serotypes.Prove that 5' holds non-coding region to detect more responsive in the detection of A serotype, and to detection SAT virus, there is higher sensitivity (KingDP, etal., 2006) at 3D detection experiment.In addition, due to the nucleotide mismatch of probe target area, these detection methods can not detect a small amount of FMDVs.Therefore, the detection method that any one is independent can not 100% detection FMDV.Recently, Tam etc. report and detect and the multiple rRT-PCR detection method of Viral typing fluorescence for foot and mouth disease virus, and the method has higher detection sensitivity, but can not distinguish the cross reactivity (TamS between some serotype, etal., 2009).
RRT-PCR handheld device makes the detection of FMDV field sample become possibility, however this equipment costly, more fragile and precision requirement is higher.Therefore, other method, the method as ring mediated amplification is used to the detection carrying out field sample.LAMP, at a constant temp specific amplification nucleotide sequence, does not therefore need thermal cycler.The method, based on the principle of DNA sequence dna by an automated cycle strand replacement reaction amplification, uses one group of two specially designed inner primer and two outer primers and has the highly active archaeal dna polymerase of strand displacement and carry out this assay method etal., 2000).Primer identifies 6 independently target sequence and later stage identification 4 the independently sequences in LAMP reaction in the starting stage, uses the water-bath of standard or heat block to carry out this reaction and is less than one hour, then with the naked eye carry out visual observation to result.Its advantage is its simple operations, and react fast and visual result, this makes the method be carried out field sample detection by the popular country of numerous disease.The foundation of the existing high-throughout RT-LAMP of foot and mouth disease virus, but the method causes false positive owing to easily polluting, just not yet the accreditation (DukesJP, etal., 2006) of wide model.
The foot and mouth disease detection method that ELISA and RT-PCR combines has very high reliability and accuracy, but the transportation problem of sample from sampling point to laboratory becomes the biggest obstacle of foot and mouth disease virus early diagnosis.Therefore, a kind of method that may be used for disease quick diagnosis and specific detection is badly in need of at suspected cases point.A kind of foot and mouth disease chromatograph test strip technology based on monoclonal antibody (ReidSM, etal., 2001) is set up by people such as Reid.Foot-and-mouth disease virus antigen susceptibility in this ELISA test strip epithelium suspension test is the same with conventional antigen ELISA susceptibility, and to foot and mouth disease virus serotype O, A, C and Asia1 have the susceptibility of 100% equivalence in cells and supernatant, but but can not distinguish these serotype.Therefore, be badly in need of a kind ofly highly sensitive specificity to distinguish the high-throughout detection method of different FMDV type.
Research shows, the RNA sequence homology of A, O, Asia1 tri-kinds of serotypes of foot and mouth disease virus is about about 70%, but the diversity ratio in the P1 region of its encode structural proteins is better, the nucleotide sequence in this region is also usually used to the somatotype and the evolutionary analysis that carry out foot and mouth disease virus.In these genes of virus, VP1 albumen participates in viral absorption, invasion, immune response, and relevant with the serotype specificity of virus.Therefore the gene order of VP1 is usually used to carry out the Genetic relationship between the different strain of FMDV, thus the molecular epidemiology rule of research foot and mouth disease.Precise Identification strain isolated kind and understand fully that its source will contribute to the epidemiological analysis of foot and mouth disease, significant.Find according to VP 1 Gene of Foot-and-Mouth Disease virus group sequence construct phylogenetic analysis, A type has 10 hypotypes (I-Ⅹ); O type also has 10 hypotypes, i.e. Europe-South America type (Euro-SA), the Middle East-South Africa type (ME-SA), southeast hypotype (SEA), sinotype (CHY), West Africa type (WA), East Africa 1 type (EA-1), East Africa 2 type (EA-2), East Africa 3 type (EA-3), Indonesia 1 type (ISA-1) and Indonesia 2 type (ISA-2); Asia1 has 6 hypotypes (I-VI).In addition, VP1 gene is also often used to the somatotype detection carrying out A, O, Asia1.Therefore, the present invention selects the Asia1 type of foot and mouth disease virus, O type and A type VP1 sequence as the region of target gene respectively, design the Auele Specific Primer can differentiating to detect foot and mouth disease Asia1 type, O type and A C-type virus C according to the requirement of GeXP multiplex PCR detection system primer, and set up the GeXP system of three C-type virus C differential diagnosiss.
Summary of the invention
The invention provides a kind of technology differentiating to detect foot and mouth disease A type, O type and concrete 1 C-type virus C of Asia for somatotype overcoming prior art deficiency, it is specifically the primer that can be used for detecting foot and mouth disease A type, O type and Asia1 C-type virus C, include the detection kit of this primer, and preparation method thereof.
Primer gene order for detecting foot and mouth disease A type, O type and Asia1 C-type virus C of the present invention is respectively:
SEQIDNo.1, can the upstream primer of specific amplification foot and mouth disease A C-type virus C nucleic acid: AGGTGACACTATAGAATAGGGTGATCTAGGGTCTCTCGC, is named as FMDV-A-F in the present invention;
SEQIDNo.2, can the downstream primer GTACGACTCACTATAGGGACAGGAGCTGCTTTGCAGGTGCAAT of specific amplification foot and mouth disease A C-type virus C nucleic acid, is named as FMDV-A-R in the present invention;
SEQIDNo.3, can the upstream primer of specific amplification foot and mouth disease O C-type virus C nucleic acid: AGGTGACACTATAGAATAGTGACTGAACTGCTTTACCGCAT, is named as FMDV-O-F in the present invention;
SEQIDNo.4, can the downstream primer of specific amplification foot and mouth disease O C-type virus C nucleic acid: GTACGACTCACTATAGGGAGACATGTCCTCCTGCATCTG, is named as FMDV-O-R in the present invention;
SEQIDNo.5, can the upstream primer of specific amplification foot and mouth disease Asia1 C-type virus C nucleic acid: AGGTGACACTATAGAATAACTGCCTACCAGAAGCAACC; Be named as FMDV-Asia1-F in the present invention;
SEQIDNo.6, can the downstream primer of specific amplification foot and mouth disease Asia1 C-type virus C nucleic acid: GTACGACTCACTATAGGGAAGTATGTCTCCGCACGCTTC, is named as FMDV-Asia1-R in the present invention.
SEQIDNo.7, general upstream primer: AGGTGACACTATAGAATA, is named as UWD-F in the present invention;
SEQIDNo.8, general downstream primer: GTACGACTCACTATAGGGA, is named as UEV-R in the present invention
Include aforesaid eight amplimer SEQIDNo.1, SEQIDNo.2, SEQIDNo.3, SEQIDNo.4, SEQIDNo.5, SEQIDNo.6, SEQIDNo.7 and SEQIDNo.8 that can be used for GeXP multiple gene analytical system in the detection kit of foot and mouth disease A type of the present invention, O type and Asia1 C-type virus C, wherein 5 ' the end of SEQIDNo.7 is added with Cy5 fluorescence labels.
The using method of test kit medical diagnosis on disease object of the present invention is for template with the RNA of test sample, with primer SEQIDNo.1, SEQIDNo.2, SEQIDNo.3, SEQIDNo.4, SEQIDNo.5, SEQIDNo.6, SEQIDNo.7 and SEQIDNo.8 increase, amplified production carries out capillary electrophoresis analysis, whether there is peak value according to 241bp place in Capillary Electrophoresis Signals analysis chart, and judge the foot and mouth disease virus A type yin and yang attribute of test sample when signal is greater than 2000; Whether there is peak value according to 280bp place in Capillary Electrophoresis Signals analysis chart, and judge the aphthovirus Asial type yin and yang attribute of test sample when signal is greater than 2000; Whether there is peak value according to 287bp place in Capillary Electrophoresis Signals analysis chart, and judge the foot and mouth disease virus O type yin and yang attribute of test sample when signal is greater than 2000.
According to relevant research, foot and mouth disease virus, P1 albumen participates in viral absorption, invasion, immune response, and relevant with the serotype specificity of virus.Therefore the gene order of VP1 is usually used to carry out the Genetic relationship between the different strain of FMDV, thus the molecular epidemiology rule of research foot and mouth disease.Precise Identification strain isolated kind and understand fully that its source will contribute to the epidemiological analysis of foot and mouth disease, significant.Find according to VP 1 Gene of Foot-and-Mouth Disease virus group sequence construct phylogenetic analysis, A type has 10 hypotypes (I-Ⅹ); O type also has 10 hypotypes, i.e. Europe-South America type (Euro-SA), the Middle East-South Africa type (ME-SA), southeast hypotype (SEA), sinotype (CHY), West Africa type (WA), East Africa 1 type (EA-1), East Africa 2 type (EA-2), East Africa 3 type (EA-3), Indonesia 1 type (ISA-1) and Indonesia 2 type (ISA-2); Asia1 has 6 hypotypes (I-VI).In addition, VP1 gene is also often used to the somatotype detection carrying out A, O, Asia I.Therefore, the present invention selects the region of A type VP1 sequence as target gene of foot and mouth disease virus, according to the Auele Specific Primer of the requirement design foot and mouth disease virus A type of GeXP multiplex PCR detection system primer.
GeXP multiple gene analytical system (GeXPGeneticAnalysisSystem) is the platform for multi-gene expression quantitative analysis of BeckmanCoulter company of U.S. research and development.Capillary electrophoresis separation technology and high-sensitive laser Induced Fluorescence Technology combine by this system, make Quantitative analysis of gene expression achieve higher sensitivity and speed faster.This system take mRNA as masterplate, and the multiple PCR caused by fluorescently-labeled universal primer and specific chimeric primer in same PCR reaction system reacts, with after analyze through capillary electrophoresis separation technology.The method has the advantages such as high-throughput, high accuracy, highly sensitive, is progressively applied in the detection of various disease pathogen at present.The GeXP multiplex PCR detection system of bubble varicella zoster virus, influenza virus, Respirovirus, hand foot mouth disease and papilloma virus has successively been established in China, but the report that there is no both at home and abroad at present based on GeXP differential diagnosis foot and mouth disease virus test kit and detection method, separately same or conbined usage can differentiate that the GeXP method detecting foot and mouth disease virus also there is no report.
Relevant experiment shows, sequence FMDV-A-F of the present invention, FMDV-A-R, FMDV-O-F, FMDV-O-R, FMDV-Asia1-F, FMDV-Asia1-R, can the nucleic acid of specificity rapid amplifying foot and mouth disease A type, O type and Asia1 C-type virus C, specific band is detected by nucleic acid electrophoresis, but the nucleic acid of can not increase under equal conditions vesicular stomatitis virus and swine vesicular disease virus.
Relevant experiment points out sequence of the present invention preparing the application in the GeXP diagnostic kit differentiating foot and mouth disease A type, O type, Asia1 C-type virus C fast, and applies in foot and mouth disease virus epidemiological study.
Accompanying drawing explanation
Fig. 1 is the nucleic acid electrophoresis detected result of foot and mouth disease A C-type virus C primer specificity checking.Wherein foot and mouth disease A C-type virus C primer can amplify the genomic fragment of FMDV-A type specifically, and foot and mouth disease Asia1 C-type virus C, foot and mouth disease A C-type virus C, vesicular stomatitis virus and swine vesicular disease virus all produce without specific band, illustrate that the specificity of the GeXP primer of foot and mouth disease A C-type virus C is very high.
Fig. 2 is the electrophorogram of FMDV-Asia1 primer specificity of the present invention checking, M:DL500Marker in figure; 1:FMDV-Asia1; 2:FMDV-A; 3:FMDV-O; 4:VSV; 5:SVDV, can find out that FMDV-Asia1 primer has good specificity, not occur non-specific amplification.
Fig. 3 is the electrophorogram of FMDV-O primer specificity of the present invention checking, M:DL500Marker in figure; 1:FMDV-O; 2:FMDV-A; 3:FMDV-Asia1; 4:VSV; 5:SVDV, can find out that FMDV-O primer has good specificity, not occur non-specific amplification.
Fig. 4 is the nucleic acid electrophoresis detected result of foot and mouth disease A C-type virus C primer PCR susceptibility checking.Wherein M is DL2000Marker; 1 is 10
9individual copy; 2 is 10
8individual copy; 3 is 10
7individual copy; 4 is 10
6individual copy; 5 is 10
5individual copy; 6 is 10
4individual copy; 7 is 10
3individual copy; 8 is 10
2individual copy; 9 is 10 copies.As seen from the figure 10
9~ 10
4the template of individual copy produces by specific product, and along with the minimizing of template amount, product band is dimmed.Foot and mouth disease A C-type virus C GeXP primer as can be seen from Fig. designed by the present invention PCR under 58 DEG C of conditions reacts minimum and can detect 10
4the template of individual copy.
Fig. 5 is the nucleic acid electrophoresis detected result of foot and mouth disease O C-type virus C primer PCR susceptibility checking.Wherein M is DL2000Marker; 1 is 10
9individual copy; 2 is 10
8individual copy; 3 is 10
7individual copy; 4 is 10
6individual copy; 5 is 10
5individual copy; 6 is 10
4individual copy; 7 is 10
3individual copy; 8 is 10
2individual copy; 9 is 10 copies.As seen from the figure 10
9~ 10
4the template of individual copy produces by specific product, and along with the minimizing of template amount, product band is dimmed.Foot and mouth disease O C-type virus C GeXP primer as can be seen from Fig. designed by the present invention PCR under 58 DEG C of conditions reacts minimum and can detect 10
4the template of individual copy.
Fig. 6 is the nucleic acid electrophoresis detected result of foot and mouth disease Asia1 C-type virus C primer PCR susceptibility checking.Wherein M is DL2000Marker; 1 is 10
9individual copy; 2 is 10
8individual copy; 3 is 10
7individual copy; 4 is 10
6individual copy; 5 is 10
5individual copy; 6 is 10
4individual copy; 7 is 10
3individual copy; 8 is 10
2individual copy; 9 is 10 copies.As seen from the figure 10
9~ 10
4the template of individual copy produces by specific product, and along with the minimizing of template amount, product band is dimmed.Foot and mouth disease Asia1 C-type virus C GeXP primer as can be seen from Fig. designed by the present invention PCR under 58 DEG C of conditions reacts minimum and can detect 10
5the template of individual copy.
Fig. 7 is the GeXP-PCR specific detection result of foot and mouth disease A C-type virus C GeXP primer.There is peak value in foot and mouth disease virus A type 241bp place as can be seen from Fig., and think positive findings when signal is greater than 2000.Occur without any fignal center when carrying out GeXP reaction with the primer pair foot and mouth disease O C-type virus C of foot and mouth disease A C-type virus C, foot and mouth disease Asia1 C-type virus C, vesicular stomatitis virus and swine vesicular disease virus genome, this illustrates that the GeXP primer of foot and mouth disease A C-type virus C has extraordinary specificity simultaneously.
Fig. 8 is the GeXP-PCR specific detection result of foot and mouth disease O C-type virus C GeXP primer.There is peak value in foot and mouth disease virus O type 287bp place as can be seen from Fig., and think positive findings when signal is greater than 2000.Occur without any fignal center when carrying out GeXP reaction with the primer pair foot and mouth disease Asia1 C-type virus C of foot and mouth disease O C-type virus C, foot and mouth disease A C-type virus C, vesicular stomatitis virus and swine vesicular disease virus genome, this illustrates that the GeXP primer of foot and mouth disease O C-type virus C has extraordinary specificity simultaneously.
Fig. 9 is the GeXP-PCR specific detection result of foot and mouth disease Asia1 C-type virus C GeXP primer.There is peak value in aphthovirus Asial type 280bp place as can be seen from Fig., and think positive findings when signal is greater than 2000.Occur without any fignal center when carrying out GeXP reaction with the primer pair foot and mouth disease O C-type virus C of foot and mouth disease Asia1 C-type virus C, foot and mouth disease A C-type virus C, vesicular stomatitis virus and swine vesicular disease virus genome, this illustrates that the GeXP primer of foot and mouth disease Asia1 C-type virus C has extraordinary specificity simultaneously.
Figure 10 to Figure 13 is the GeXP-PCR susceptibility detected result of foot and mouth disease A C-type virus C GeXP primer, and wherein Figure 10 is 10
4copies/ μ L, Figure 11 are 10
3copies/ μ L, Figure 12 are 10
2copies/ μ L, Figure 13 are 10copies/ μ L.Result display 10
4copies/ μ L ~ 10
2the template of copies/ μ L all can detect specific peak value, and along with the detection of template amount, the strength of signal of peak value also constantly weakens, and when 10copies/ μ L, specific signal peak is less than 2000.As can be seen from the figure designed in the present invention foot and mouth disease A C-type virus C GeXP primer can detect the template of 10copies/ μ L in detection system of the present invention.
Figure 14 to Figure 17 is the GeXP-PCR susceptibility detected result of foot and mouth disease O C-type virus C GeXP primer, and wherein Figure 14 is 10
4copies/ μ L, Figure 15 are 10
3copies/ μ L, Figure 16 are 10
2copies/ μ L, Figure 17 are 10copies/ μ L.Result display 10
4copies/ μ L ~ 10
2the template of copies/ μ L all can detect specific peak value, and along with the detection of template amount, the strength of signal of peak value also constantly weakens, 10
2during copies/ μ L, specific signal peak is less than 2000.As can be seen from the figure designed in the present invention foot and mouth disease O C-type virus C GeXP primer can detect 10 in detection system of the present invention
2the template of copies/ μ L.
Figure 18 to Figure 21 is the GeXP-PCR susceptibility detected result of foot and mouth disease Asia1 C-type virus C GeXP primer, and wherein Figure 18 is 10
4copies/ μ L, Figure 19 are 10
3copies/ μ L, Figure 20 are 10
2copies/ μ L, Figure 21 are 10copies/ μ L.Result display 10
4copies/ μ L ~ 10
2the template of copies/ μ L all can detect specific peak value, and along with the detection of template amount, the strength of signal of peak value also constantly weakens, 10
2during copies/ μ L, specific signal peak is less than 2000.As can be seen from the figure designed in the present invention foot and mouth disease Asia1 C-type virus C GeXP primer can detect 10 in detection system of the present invention
2the template of copies/ μ L.
Figure 22 to Figure 25 is GeXP multiplex PCR susceptibility proof diagram of the present invention, as can be seen from the figure 10
5copies/ μ L, 10
4copies/ μ L, 10
3copies/ μ L and 10
2copies/ μ L level can detect 3 kinds of viral RNAs, wherein 10 simultaneously
2during copies/ μ L level, the strength of signal of FMDV-O type amplified fragments, lower than 2000, cannot detect the biased sample that the next one dilutes gradient.Therefore, GeXP multiple gene detection system detects 3 kinds of viral susceptibilitys is simultaneously 10
2copies/ μ L.
Embodiment
Below in conjunction with embodiment, the present invention is explained orally in detail.
1. the preparation of sequence
According to the genome of the FMDV-A type that GeXP design of primers requires and NCBI announces, FMDV-O type, FMDV-Asia1, select conservative region design Auele Specific Primer, and form specific chimeric primer by adding universal primer, and universal primer sequence belongs to the nucleotide sequence of abiotic source property, in addition synthesize universal primer sequence, and add Cy5 fluorescence labels at 5 ' end of upstream universal primer.
2. viral genome is extracted
Monolayer cell grow to more than 80% merge after, virus inoculation, 37 DEG C hatch 30min after discard venom.Add cell maintenance medium, 37 DEG C of 5%CO
2cultivate, routine observation cytopathy (CPE), occur receiving poison after CPE until more than 90% cell.By viral multigelation 3 times, put-20 DEG C of Refrigerator stores for subsequent use.Use the RNA in TaKaRa company DNA extraction kit extraction cell strain.
3.FMDV primer specificity is verified
With the viral RNA of extraction purification for template increases, experimental system is as follows:
Reaction conditions is as follows:
Respectively get the PCR primer sample nucleic electrophoresis of 5 μ L, electrophoresis result is undertaken detecting and taking pictures by ultraviolet gel imaging system.Detected result shows, the GeXP primer of foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, foot and mouth disease Asia1 C-type virus C can amplify specific genomic fragment specifically under the condition of 58 DEG C, and between them, do not intersect amplification, and vesicular stomatitis virus and swine vesicular disease virus all produce without specific band, illustrate that the specificity of the GeXP primer of foot and mouth disease virus 3 types is very high.
4. the GeXP primer substance PCR susceptibility checking of foot and mouth disease virus
Utilize NanoDropND-1000 ultraviolet spectrophotometer to measure FMDV-A type, FMDV-O type, the genomic concentration of FMDV-Asia1 type, calculate its corresponding copy number according to FMDV-A type, FMDV-O type, the genomic molecular weight of FMDV-Asia1 type and concentration.Carry out gradient dilution to FMDV-A type, FMDV-O type, FMDV-Asia1 type genome, respectively get 1 μ L as template, detect the susceptibility of substance PCR, PCR reaction system is:
Reaction conditions is as follows:
Respectively get the PCR primer sample nucleic electrophoresis of 5 μ L, electrophoresis result is undertaken detecting and taking pictures by ultraviolet gel imaging system.Detected result shows, 10
9~ 10
4the template of individual copy all has specific product to produce, and along with the minimizing of template amount, product band is dimmed.Can find out that the GeXP primer of foot and mouth disease A type designed by the present invention, O type, Asia1 C-type virus C is 58 DEG C from figure, 10 can be detected in reaction system
4, 10
4, 10
5the template of individual copy.
5. the specific detection of foot and mouth disease virus GeXP-PCR
According to the GenomeLab fragment analysis strategy of BeckmanCoulter company, set up the PCR reaction system of 25 μ L, reaction system is:
RT-PCR reacts:
The capillary electrophoresis analysis of PCR primer:
With methane amide (SampleLoadingSolution, SLS), PCR primer is carried out to the dilution of 10 times; Configuration loading reaction system (40 μ l), comprises the methane amide (SampleLoadingSolution, SLS) of 38.5 μ l, mark-400 in the DSS400(molecular weight of 0.5 μ l), the PCR primer diluent of 1 μ l; Whirlpool device shakes 30s mixing, or mixes with rifle head, and do simple centrifugal to remove bubble, every Kong Jiayi dropstone wax oil prevents sample from volatilizing; The dissociating buffer of 3/4 volume is added in damping fluid plate with upper model corresponding aperture; Enter the SetUp program of GeXP, input sample ID, specifies Frag-3 separation method to each sample, and specify the GeXP analytical procedure of acquiescence, bring into operation sample.
Capillary electrophoresis terminates, and derives experimental data and analyzes experimental result, occurring peak value respectively as can be seen from Fig., and think positive findings when signal is greater than 2000 at 287bp, 241bp and 280bp place.Do not intersect amplification between each primer simultaneously with foot and mouth disease virus, and occur without any fignal center when carrying out GeXP reaction to vesicular stomatitis virus and swine vesicular disease virus genome, this illustrates that the GeXP primer of foot and mouth disease virus has extraordinary specificity.
6. foot and mouth disease virus substance GeXP-PCR susceptibility detects
Utilize NanoDropND-1000 ultraviolet spectrophotometer to measure the concentration of foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, foot and mouth disease Asia1 C-type virus C RNA, calculate its corresponding copy number according to the molecular weight of viral RNA and concentration.Gradient dilution is carried out to viral RNA, is diluted to 10
6copies/ μ L ~ 10copies/ μ L, respectively gets 1 μ L as template, detects the susceptibility of foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, foot and mouth disease Asia1 C-type virus C GeXP-PCR.
Result shows, and foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, foot and mouth disease Asia1 C-type virus C GeXP primer carry out the detected result after GeXP-PCR to different concns genome at 58 DEG C.It is 10copies/ μ L that result display removes FMDV-A type, and other are 10
2copies/ μ L.As can be seen from the figure designed in the present invention foot and mouth disease A C-type virus C GeXP primer can detect the template of 10copies/ μ L in detection system of the present invention, and foot and mouth disease O type and Asia1 C-type virus C GeXP primer can detect 10 in detection system of the present invention
2the template of copies/ μ L.
7. foot-and-mouth disease virus multiple GeXP-PCR susceptibility detects
Utilize NanoDropND-1000 ultraviolet spectrophotometer to measure the concentration of foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, foot and mouth disease Asia1 C-type virus C RNA, calculate its corresponding copy number according to the molecular weight of viral RNA and concentration.Gradient dilution is carried out to viral RNA, is diluted to 10
6copies/ μ L ~ 10copies/ μ L, the RNA getting equivalent mixes, and detects the susceptibility of foot and mouth disease A C-type virus C, foot and mouth disease O C-type virus C, the multiple GeXP-PCR of foot and mouth disease Asia1 C-type virus C.
Result shows, and uses 3 kinds of RNA as hybrid template, 10
5copies/ μ L, 10
4copies/ μ L, 10
3copies/ μ L and 10
2copies/ μ L level can detect 3 kinds of target genes, wherein 10 simultaneously
2during copies/ μ L level, the strength of signal of FMDV-O type amplified fragments, lower than 2000, cannot detect the biased sample that the next one dilutes gradient.Therefore, GeXP multiple gene detection system detects 3 kinds of viral susceptibilitys is simultaneously 10
2copies/ μ L.
As fully visible, 8 gene orders of design and synthesis and the foot and mouth disease multiple GeXP method of its formation can be differentiated to detect domestic popular A type, O type and Asia1 type foot and mouth disease virus fast here.
<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120> detects test kit and the preparation method of foot and mouth disease A type, O type and Asia1 C-type virus C
<160>8
<210>1
<211>39
<212>DNA
<213> artificial sequence (FMDV-A-F)
<400>
aggtgacactatagaatagggtgatctagggtctctcgc39
<210>2
<211>43
<212>DNA
<213> artificial sequence (FMDV-A-R)
<400>
gtacgactcactatagggacaggagctgctttgcaggtgcaat43
<210>3
<211>41
<212>DNA
<213> artificial sequence (FMDV-O-F)
<400>
aggtgacactatagaatagtgactgaactgctttaccgcat41
<210>4
<211>39
<212>DNA
<213> artificial sequence (FMDV-O-R)
<400>
gtacgactcactatagggagacatgtcctcctgcatctg39
<210>5
<211>
<212>DNA
<213> artificial sequence (FMDV-Asia1-F)
<400>
aggtgacactatagaataactgcctaccagaagcaacc38
<210>6
<211>39
<212>DNA
<213> artificial sequence (FMDV-Asia1-R)
<400>
gtacgactcactatagggaagtatgtctccgcacgcttc39
<210>7
<211>18
<212>DNA
<213> artificial sequence (UWD-F)
<400>
aggtgacactatagaata18
<210>8
<211>19
<212>DNA
<213> artificial sequence (UEV-R)
<400>
gtacgactcactataggga19
Claims (3)
1., for detecting the primer of foot and mouth disease A type, O type and Asia1 C-type virus C, it is characterized in that primer gene order is SEQIDNo.1, SEQIDNo.2, SEQIDNo.3 and SEQIDNo.4, SEQIDNo.5 and SEQIDNo.6.
2. the detection kit of a foot and mouth disease A type, O type and Asia1 C-type virus C, it is characterized in that including eight amplimer SEQIDNo.1, SEQIDNo.2, SEQIDNo.3, SEQIDNo.4, SEQIDNo.5, SEQIDNo.6, SEQIDNo.7 and SEQIDNo.8 for GeXP multiple gene analytical system in test kit, wherein 5 ' the end of SEQIDNo.7 is added with Cy5 fluorescence labels.
3. the using method of test kit non-diseases diagnostic purpose described in claim 2, it is characterized in that with the RNA of test sample for template, with SEQIDNo.1, SEQIDNo.2, SEQIDNo.3, SEQIDNo.4, SEQIDNo.5, SEQIDNo.6, SEQIDNo.7 and SEQIDNo.8 primer increases, amplified production carries out capillary electrophoresis analysis, whether there is peak value according to 241bp place in Capillary Electrophoresis Signals analysis chart, and judge the foot and mouth disease virus A type yin and yang attribute of test sample when signal is greater than 2000; Whether there is peak value according to 280bp place in Capillary Electrophoresis Signals analysis chart, and judge the aphthovirus Asial type yin and yang attribute of test sample when signal is greater than 2000; Whether there is peak value according to 287bp place in Capillary Electrophoresis Signals analysis chart, and judge the foot and mouth disease virus O type yin and yang attribute of test sample when signal is greater than 2000.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410464443.6A CN104195268B (en) | 2014-09-15 | 2014-09-15 | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410464443.6A CN104195268B (en) | 2014-09-15 | 2014-09-15 | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195268A CN104195268A (en) | 2014-12-10 |
| CN104195268B true CN104195268B (en) | 2016-03-30 |
Family
ID=52080630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410464443.6A Active CN104195268B (en) | 2014-09-15 | 2014-09-15 | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195268B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611471B (en) * | 2015-02-13 | 2017-03-15 | 重庆出入境检验检疫局检验检疫技术中心 | For detecting gene chip and its detection method of foot and mouth disease viruses |
| CN105018641A (en) * | 2015-05-28 | 2015-11-04 | 四川农业大学 | Gene chip and kit used for detecting foot and mouth disease viruses, vesicular stomatitis viruses and swine vesicular disease viruses |
| CN105586437B (en) * | 2015-11-17 | 2021-07-27 | 天津海关动植物与食品检测中心 | Establishment of detection method for GeXP virus carried by four entry cows |
| CN106498094A (en) * | 2016-05-23 | 2017-03-15 | 河南省农业科学院畜牧兽医研究所 | A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application |
| CN105779658A (en) * | 2016-05-23 | 2016-07-20 | 河南省农业科学院畜牧兽医研究所 | Primer and kit used for detecting mixed infection with foot-and-mouth disease virus types O, A and Asia1 as well as using method and application of kit |
| CN105861752A (en) * | 2016-05-23 | 2016-08-17 | 河南省农业科学院畜牧兽医研究所 | Primer and kit for detecting foot and mouth disease virus type A and type Asia1 mixed infection, use method and application of kit |
| CN106435022A (en) * | 2016-09-23 | 2017-02-22 | 中国农业科学院兰州兽医研究所 | A type and O type foot and mouth disease virus specific primer and kit |
| CN112034028B (en) * | 2020-08-25 | 2021-10-15 | 中国科学院过程工程研究所 | Method for detecting 146S antigen in foot-and-mouth disease vaccine based on capillary electrophoresis method and application thereof |
| CN114164299A (en) * | 2021-05-26 | 2022-03-11 | 郑州中道生物技术有限公司 | Foot-and-mouth disease (OAA 1) triple fluorescence RT-PCR detection kit |
| CN114480384B (en) * | 2021-06-30 | 2024-03-08 | 山东舜丰生物科技有限公司 | Method for detecting foot-and-mouth disease virus based on CRISPR technology |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101423874B (en) * | 2007-10-31 | 2011-08-31 | 中国农业科学院兰州兽医研究所 | Foot-and-mouth disease virus multiple RT-PCR detection kit, preparation method thereof and application |
| CN102899402B (en) * | 2012-09-06 | 2014-08-27 | 中国科学院南海海洋研究所 | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof |
-
2014
- 2014-09-15 CN CN201410464443.6A patent/CN104195268B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101423874B (en) * | 2007-10-31 | 2011-08-31 | 中国农业科学院兰州兽医研究所 | Foot-and-mouth disease virus multiple RT-PCR detection kit, preparation method thereof and application |
| CN102899402B (en) * | 2012-09-06 | 2014-08-27 | 中国科学院南海海洋研究所 | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Detection of foot-and-mouth disease virus rna by reverse transcription loop-mediated isothermal amplification;Hao-tai Chen et al;《Virology Journal》;20111231;第8卷(第510期);第1-4页 * |
| 利用多重RT-PCR对口蹄疫病毒分型;刘耀方等;《江苏农业科学》;20071231(第5期);第136-139页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195268A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104195268B (en) | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C | |
| CN107630109A (en) | A kind of fluorescence quantification PCR primer and kit for detecting Novel pig acute diarrhea syndrome coronavirus | |
| CN110358867A (en) | African hog cholera virus fluorescent type RAA detection kit | |
| CN106399590A (en) | General nucleic acid isothermal detection reagent of respiratory tract infection associated adenoviruses | |
| CN109913584A (en) | Four kinds of pig enterovirus multi-fluorescence RT-PCR kits and detection method | |
| CN106834549A (en) | The cross primer amplification immune chromatography test paper of detection pseudorabies virus street strain is combined the primer and probe groups and kit of method | |
| CN110499393A (en) | The real-time fluorescence quantitative PCR detection of hepatitis infectiosa canis virus, hepatitis infectiosa canis virus I type and hepatitis infectiosa canis virus II type and diagnostic primers and probe | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN104388588B (en) | NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| Li et al. | Development of a recombinase-aided amplification combined with lateral flow dipstick assay for the rapid detection of the African swine fever virus | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN104342500B (en) | Detect the primer of foot and mouth disease Asia 1 C-type virus C, detection kit and preparation method | |
| CN103224994A (en) | Foot and mouth disease virus typing diagnosis loop-mediated isothermal amplification kit and its use method | |
| CN101831508B (en) | Quantitative detection method of tea-geometrid-type polyhedrosis viruses | |
| CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application | |
| CN110042175A (en) | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus | |
| McHenry et al. | Detection of SARS-CoV-2 in tissue: the comparative roles of RT-qPCR, in situ RNA hybridization, and immunohistochemistry | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN104212916B (en) | A kind of test kit and preparation and application detecting foot and mouth disease A C-type virus C | |
| CN104342501A (en) | Primer and detection kit for detecting swine vesicular disease virus and preparation method thereof | |
| CN108384892A (en) | A kind of LAMP primer group, kit and the method for detection huichun viremia virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |