CN106498094A - A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application - Google Patents
A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application Download PDFInfo
- Publication number
- CN106498094A CN106498094A CN201610977701.XA CN201610977701A CN106498094A CN 106498094 A CN106498094 A CN 106498094A CN 201610977701 A CN201610977701 A CN 201610977701A CN 106498094 A CN106498094 A CN 106498094A
- Authority
- CN
- China
- Prior art keywords
- primer
- foot
- mouth disease
- kit
- disease virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application, described primer includes primer pair FMDO and FMDAsia, and wherein, primer pair FMDO includes：Upstream primer FMDOF：5 ' TGGCCTCAAAGACTCTCG 3 ', downstream primer FMDOR：5′‑CAAGCTACAGATCACTTTAC‑3′；Primer pair FMDAsia includes：Upstream primer FMDAsiaF：5 ' CTGGGTTTTACAAACCTGTG 3 ', downstream primer FMDAsiaR：5′‑CTCTGACGTCACAATTGGC‑3′.The using method of kit of the present invention includes the collection of infected animal fresh sample, nucleic acid extraction；Reverse transcriptional PCR, agarose gel electrophoresis are detected.The method high specificity, sensitivity are high, easy to operate, saving of work and time, improve the accuracy and specificity of detection.
Description
Technical field
The present invention relates to a kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, make
With method and its application, belong to biological technical field.
Background technology
Aftosa (aphthae epizooticae；Foot and mouth disease, FMD) it is by foot and mouth disease virus
The acute, hot of a kind of Zoonosis that cause, highly contagious disease, which faces to examine and is characterized in that under oral mucosa, four limbs
End and breast etc. skin forms blister and speck.The disease is propagated rapidly, popular wide, takes optimum process, young age adults more
Animal is more, and because of myocardial damage, the death rate is higher.Aftosa is widely current in huge economic loss all over the world, is caused, respectively
Government of state and international organization pay much attention to, and are listed in world community and decide through consultation jointly the No.1 Notifiable disease that puts out.With the world
Increasingly the increase of trade, material exchange and international association more and more frequent, increased difficulty to the prevention and control of aftosa, because
This countries in the world all spends a large amount of human and material resources and financial resources to study, control and eliminate aftosa.
Foot and mouth disease virus (Foot-and-Mouth disease virus) belongs to the foot and mouth disease virus in microRNA Viraceae
Category, is minimum in RNA virus one.The characteristics of foot and mouth disease virus has polymorphism, easily makes a variation.According to its serological characteristic,
7 serotypes, i.e. A, O, C, SAT1 (South Africa I), SAT2 (south Africa II type), SAT3 (III type of South Africa) and 1 types of Asia can be divided into
(Type Asia 1).Without cross immunity phenomenon between each serotype.Each serotype includes several hypotypes, each Asia of homotype again
Also only has partial intersection immunity between type.This characteristic of the virus brings many difficulties to the anti-system of aftosa.
Content highest of the foot and mouth disease virus in the blister liquid of infected animal, blister skin, lymph liquid and hot stage blood, its
Secondary is each histoorgan, secretion, excreta, can long-term existence outside toxin expelling, restrovirus of bringing down a fever can come across breast, excrement,
In urine, tear, saliva and each internal organs.The resistance of foot and mouth disease virus environment to external world is very strong, resistance to drying.Under field conditions (factors), contain
The contained virus such as the feed of poison tissue and pollution, drinking-water, forage grass, fur and soil still has infection within a few days or even several weeks
Property.Foot and mouth disease virus is all especially sensitive to bronsted lowry acids and bases bronsted lowry, and in the buffer solution of pH3.0 and more than pH9.0, viral infection is by moment
Disappear, 2%～4% NaOH, 3%～5% formalin solution, 5% ammoniacal liquor, 0.2%～0.5% Peracetic acid or 5%
Sodium hypochlorite etc. is the good disinfectant of foot and mouth disease virus.
Aftosa is a kind of extremely strong infectious disease of infectiousness, once occurring often in popularity, in pastoral area, assumes big stream more
OK, epidemic situation is once occur, can the flowing of follower spread rapidly, after the regular period, epidemic situation just dies away.Aftosa can
Infection many animals, artiodactylous animals neurological susceptibility highest, the order of neurological susceptibility height be followed successively by ox, milk cow, yak, buffalo,
Pig, sheep, camel.
For the preventing and treating of aftosa there is no specific medicament therapy at present, comprehensive measures for prevention and control and heteropathy is mainly taken.
Most basic method is to eliminate the malicious animal of infected animal, band and thorough disinfection, cuts off route of transmission.Therefore quarantine and mouth should be strengthened
Fever aphthous is monitored, in case aftosa diffusion.
At present, the tentative diagnosis of aftosa can be made according to epidemiology, clinical symptom and case cut open inspection feature, but really
Examining needs to carry out laboratory diagnosis.The separation of virus and the method that identification and serodiagnosis are that laboratory diagnosis is commonly used, but compared with
Waste time and energy, take longer.
Content of the invention
The technical problem to be solved is to provide one kind and mixes with Asia1 types for detecting that foot and mouth disease virus is O-shaped
The primer of infection, kit, using method and its application, using the kit of the present invention, can pay a home visit in three hours
Disconnected, it is that aftosa clinical diagnosis and Molecule Epidemiology Investigation provide a kind of effective molecular biological testing.
To achieve these goals, the technical solution adopted in the present invention is：A kind of for detect foot and mouth disease virus O-shaped and
The primer of Asia1 type mixed infections, described primer include primer pair FMDO and FMDAsia, wherein,
Primer pair FMDO：
Upstream primer FMDOF：5′-TGGCCTCAAAGACTCTCG-3′
Downstream primer FMDOR：5′-CAAGCTACAGATCACTTTAC-3′
Primer pair FMDAsia：
Upstream primer FMDAsiaF：5′-CTGGGTTTTACAAACCTGTG-3′
Downstream primer FMDAsiaR：5′-CTCTGACGTCACAATTGGC-3′.
A kind of for detecting that foot and mouth disease virus is O-shaped and the kit of Asia1 type mixed infections, described kit includes drawing
Thing to FMDO and FMDAsia, wherein,
Primer pair FMDO：
Upstream primer FMDOF：5′-TGGCCTCAAAGACTCTCG-3′
Downstream primer FMDOR：5′-CAAGCTACAGATCACTTTAC-3′
Primer pair FMDAsia：
Upstream primer FMDAsiaF：5′-CTGGGTTTTACAAACCTGTG-3′
Downstream primer FMDAsiaR：5′-CTCTGACGTCACAATTGGC-3′.
Described kit also includes 5 × RT Buffer, dNTPs, Taq enzyme, RNase inhibitor, reverse transcriptase, ultrapure
Water, lysate and flushing liquor.
Described kit also includes positive control and negative control.
The group of described lysate is divided into：Oxyquinoline 3～5% (mass fraction), 3.2～5.2 μM of TCEP,
1.5～3.5 μM of phenyl isothiocyanate, PVP 1.3～3.5% (mass fraction), 0.3～0.5M of sodium chloride and
0.6～0.9M of sodium citrate.
The group of described flushing liquor is divided into：10 μM of trishydroxymethylaminomethane, 1 μM of ethylenediamine tetra-acetic acid, ethanol 60～
80% (volume fraction)；pH 7.0.
A kind of using method for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus, including following
Step：
(1) collection of sample
(2) extraction of sample RNA
(3)RT-PCR
RT-PCR amplifications, 25 μ l of reaction system is carried out to sample RNA：5×RT Buffer 5μl、12.5μM dNTPs 5μ
Under l, 125 μM of upstream primer FMDOF and each 1 μ l of 125 μM of downstream primer FMDOR, 125 μM of upstream primer FMDAsiaF and 125 μM
The each 1 μ l of trip primers F MDAsiaR, 0.5 μ l of 25U/ μ l Taq enzymes, 1 μ l of 2.5U/ μ l RNase inhibitors, 2.5 μM of 1 μ of reverse transcriptase
L, 3.5 μ l and 5ng/ μ l RNA of ultra-pure water, 5 μ l；
RT-PCR amplification programs are：50 DEG C of 30min, 94 DEG C of 3min；94 DEG C of 40s, 55 DEG C of 45s, 72 DEG C of 30s, totally 35 are followed
Ring；72℃3min；
(4) detection of RT-PCR amplified productions
Pcr amplification product is entered row agarose gel electrophoresis, and result is observed under gel imaging system.
The collection of described sample is divided into the collection of solid-like animal tissue or the collection of liquid animal tissue；Wherein,
The acquisition method of solid-like animal tissue is：Aseptic collection animal tissue pathological material of disease 0.1-100mg, loads without RNase
Standby in the centrifuge tube of pollution；
The collection of liquid animal tissue is divided into the collection of juice or the collection of blood, and the acquisition method of juice is：
Nasopharynx liquid is gathered with Nasopharyngeal swabs, is loaded standby in the centrifuge tube without RNase pollution；The acquisition method of blood is：Take whole blood, blood
Clear or blood plasma 10-100 μ l, add standby in the centrifuge tube without RNase pollution.
The extraction of described sample RNA, concrete grammar is：
(1) animal tissue of solid-like is first carried out milled processed, liquid animal tissue is directly used in extraction；
(2) after grinding in the animal tissue 20-100mg or liquid animal tissues 20-100 μ l of pasty state, plus cracking
500 μ l of liquid, 12000rpm are centrifuged 30s, isolate supernatant；
(3) supernatant is proceeded in centrifuge tube, plus 500 μ l of absolute ethyl alcohol, gone on RNA purification columns by several times, 12000rpm
Centrifugation 30s, the RNA for slightly being carried；
(4) RNA purification columns are rinsed with 500 μ l of flushing liquor, 12000rpm is centrifuged 30s；
(5) RNA purification columns are gone to another centrifuge tube, plus 50 μ l of ultra-pure water, 12000rpm centrifugation 30s, obtain virus and
The RNA of tissue gene group, saves backup in -20 DEG C.
A kind of O-shaped in detection foot and mouth disease virus for detecting O-shaped and Asia1 type mixed infections the kit of foot and mouth disease virus
With the application in terms of Asia1 type mixed infections.
Beneficial effects of the present invention
1st, the present invention is improved to nucleic acid extraction process, i.e., using lysate and the punching with available reagent box different formulations
Washing lotion, substantially reduces the nucleic acid extraction time, the extraction time of nucleic acid is shorten to 2 minutes by original 1-2 hours, saves
The time of nucleic acid extraction, so as to improve the service efficiency of kit, make the inspection of kit more quick, economical.Wherein, originally
The lysate of invention can be such that sample cracks rapidly, discharge RNA.Flushing liquor can effectively remove protein, salt and impurity etc.,
Make extracted RNA purer.
2nd, the present invention is using foot and mouth disease virus 3D genome sequences as genes of interest region, be designed to detect O-shaped and
Aftosa other serotypes can not be expanded under the specific primer of Asia1 types, equal conditions, with very high specificity.Meanwhile,
There is the kit of the present invention very high sensitivity, lowest detection to be limited to 0.1pg/ μ l.
3 the invention provides a kind of for detecting that foot and mouth disease virus is O-shaped and the kit of Asia1 type mixed infections, the examination
Agent box can fast and accurately detect that foot and mouth disease virus is O-shaped and Asia1 type mixed infection strains.Can be to the O-shaped of infection of foot-and-mouth disease
Detect with Asia1 types single sample, also can be used for aftosa to O-shaped in clinical case and Asia1 type mixed infections detection
Virus causing disease generaI investigation, Molecule Epidemiology Investigation and vaccine screening and monitoring.
4th, the method for the present invention is built upon on molecular biology mechanism, provides negative control and the positive is right in detection
According to, the degree of accuracy of detection being substantially increased, reduces false-positive occurrence probability, specificity is relatively strong, time saving and energy saving, and the kit will
Detection time is foreshortened to 3 hours, substantially increases operating efficiency.
5 the invention is particularly suited to the quick diagnosis of a large amount of clinical samples of mouth disease virus infection, can be clinical and
In scientific research, hoof-and-mouth disease preventing and treating and treatment provide scientific basis, and to the detection of raising foot and mouth disease virus cause of disease, monitoring, vaccine
Development etc. is significant.
Description of the drawings
Fig. 1 is RT-PCR product agarose gel electrophoresis testing result figures；Wherein, swimming lane M represents DL 2000DNA
Marker (is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp) from top to bottom, and swimming lane 1,2 is hoof-and-mouth disease
Malicious negative control, 3 is that foot and mouth disease virus is O-shaped with Asia1 type mixed infection positive controls, and 4 is that foot and mouth disease virus is O-shaped and Asia1
Type mixed infection sample.
Fig. 2 is RT-PCR product agarose gel electrophoresis testing result figures；Wherein, swimming lane M represents DL 2000DNA
Marker (is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp) from top to bottom, and in a, swimming lane 1 represents mouth hoof
Epidemic disease virus type O and Asia1 type mixed infection samples, swimming lane 2 represent the O-shaped sample of foot and mouth disease virus, and swimming lane 3 represents foot and mouth disease virus
Asia1 pattern product；In b, swimming lane 1 represents that foot and mouth disease virus is O-shaped and Asia1 type mixed infection positive controls, and swimming lane 2 represents mouth hoof
Epidemic disease virus type O positive control, swimming lane 3 represent aphthovirus Asial type positive control.
Fig. 3 is RT-PCR product agarose gel electrophoresis testing result figures；Wherein, swimming lane M represents DL 2000DNA
Marker (is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp) from top to bottom, and swimming lane 1 represents hoof-and-mouth disease
The O-shaped sample with Asia1 type mixed infections of poison；Swimming lane 2-6 represent respectively foot and mouth disease virus A types, c-type, SAT1 (South Africa I),
SAT2 (south Africa II type) and SAT3 (III type of South Africa) sample.
Specific embodiment
With reference to embodiments the specific embodiment of the present invention is described in further detail.
The relative molecular weight of the PVP used by the present invention is 40000.
Oxyquinoline used by the present invention is 2- oxyquinolines.
Embodiment 1 is used for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus
1st, the design of primer
According to the 3D genome sequences of foot and mouth disease virus, design primer pair FMDO and FMDAsia, wherein, primer pair FMDO：
Upstream primer FMDOF：5′-TGGCCTCAAAGACTCTCG-3′(SEQ ID NO.1)
Downstream primer FMDOR：5′-CAAGCTACAGATCACTTTAC-3′(SEQ ID NO.2)
Primer pair FMDAsia：
Upstream primer FMDAsiaF：5′-CTGGGTTTTACAAACCTGTG-3′(SEQ ID NO.3)
Downstream primer FMDAsiaR：5′-CTCTGACGTCACAATTGGC-3′(SEQ ID NO.4).
2nd, the extraction of RNA
Carry that foot and mouth disease virus is O-shaped and the ox of Asia1 type mixed infections is as animal used as test to make a definite diagnosis, extract sample RNA,
Comprise the following steps：
(1) collection of sample
100 μ l of collection ox whole blood, add standby in the centrifuge tube without RNase pollution.
(2) extraction of sample RNA
A () is in 100 μ l whole bloods of collection, plus 500 μ l of lysate, 12000rpm centrifugation 30s, isolates supernatant；
C () proceeds to supernatant in centrifuge tube, plus 500 μ l of absolute ethyl alcohol, is gone on RNA purification columns by several times, 12000rpm
Centrifugation 30s, the RNA for slightly being carried；
D () rinses RNA purification columns with 500 μ l of flushing liquor, 12000rpm is centrifuged 30s；
E RNA purification columns are gone to another centrifuge tube by (), plus 50 μ l of ultra-pure water, 12000rpm centrifugation 30s, obtain virus and
The RNA of tissue gene group, saves backup in -20 DEG C.
The group of lysate is divided into：Oxyquinoline 3% (mass fraction), 3.2 μM of TCEP, phenyl isothiocyanate
3.5 μM, PVP 1.3% (mass fraction), sodium chloride 0.3M and sodium citrate 0.9M.
The group of flushing liquor is divided into：10 μM of trishydroxymethylaminomethane, 1 μM of ethylenediamine tetra-acetic acid, 60% (volume integral of ethanol
Number)；pH 7.0.
3、RT-PCR
With sample RNA as template, RT-PCR amplifications are carried out, while with swine vesicular disease virus as negative control, with aftosa
Virus type O and the mixed infection of Asia1 types are positive control, extract the RNA of negative control and positive control sample, and RT-PCR expands
Increase, 25 μ l of reaction system：Under 5 × RT Buffer, 5 μ l, 12.5 μM of 5 μ l of dNTPs, 125 μM of upstream primer FMDOF and 125 μM
The trip each 1 μ l of primers F MDOR, 125 μM of upstream primer FMDAsiaF and each 1 μ l of 125 μM of downstream primer FMDAsiaR, 25U/ μ l Taq
0.5 μ l of enzyme, 1 μ l of 2.5U/ μ l RNase inhibitors, 2.5 μM of 1 μ l of reverse transcriptase, 3.5 μ l and 5ng/ μ l RNA of ultra-pure water, 5 μ l.
RT-PCR amplification programs are：50 DEG C of 30min, 94 DEG C of 3min；94 DEG C of 40s, 55 DEG C of 45s, 72 DEG C of 30s, totally 35 are followed
Ring；72℃3min.
4th, the detection of RT-PCR amplified productions
5 μ l and Loading Buffer of RT-PCR amplified productions, 5 μ l mixings are taken, the agarose for being added to containing EB 1.0% coagulates
In glue, negative control, the RT-PCR amplified productions of positive control and DL2000DNA Marker is simultaneously introduced, voltage is 120V,
Electrophoresis 35min, then observation result in gel imaging instrument (result is shown in Fig. 1).
Agarose gel electrophoresis result shows that the RT-PCR amplified productions of inventive samples RNA are in RT-PCR amplified productions
There is band in 1350bp and 200bp, with expection be consistent, it was demonstrated that RT-PCR amplified productions of the present invention be foot and mouth disease virus O-shaped and
Asia1 type mixed infection purpose fragments.
Embodiment 2 is used for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus
The kit of embodiment 2 is essentially identical with the kit of embodiment 1, and difference is：The cracking of the present embodiment
The group of liquid is divided into oxyquinoline 5% (mass fraction), 4 μM of TCEP, 2.5 μM of phenyl isothiocyanate, polyvinyl pyrrole
Pyrrolidone 2% (mass fraction), sodium chloride 0.5M and sodium citrate 0.6M.The group of flushing liquor is divided into trishydroxymethylaminomethane 10
μM, 1 μM of ethylenediamine tetra-acetic acid, ethanol 80% (volume fraction)；pH 7.0.
The present embodiment carries the O-shaped ox of foot and mouth disease virus as animal used as test to make a definite diagnosis, O-shaped as the positive with foot and mouth disease virus
Control, extracts sample RNA, carries out RT-PCR amplifications, and the Ago-Gel testing result of RT-PCR amplified productions is shown in Fig. 2 (detections
Method with embodiment 1).
Embodiment 3 is used for detecting the O-shaped kit with I mixed infections of Asia of foot and mouth disease virus
The kit of embodiment 3 is essentially identical with the kit of embodiment 1, and difference is：The cracking of the present embodiment
The group of liquid is divided into oxyquinoline 4% (mass fraction), 5.2 μM of TCEP, 1.5 μM of phenyl isothiocyanate, polyvinyl
Pyrrolidones 3.5% (mass fraction), sodium chloride 0.4M and sodium citrate 0.8M.The group of flushing liquor is divided into trihydroxy methyl amino first
10 μM of alkane, 1 μM of ethylenediamine tetra-acetic acid, ethanol 70% (volume fraction)；pH 7.0.
The present embodiment with make a definite diagnosis carry aphthovirus Asial type ox as animal used as test, with aphthovirus Asial
Type is positive control, extracts sample RNA, carries out RT-PCR amplifications, and the Ago-Gel testing result of RT-PCR amplified productions is shown in
Fig. 2 (detection method is with embodiment 1).
The geneome RNA of different samples is extracted using the kit of the embodiment of the present invention 1, to the genome for extracting
RNA carries out concentration and purity testing, as a result see the table below.
Geneome RNA concentration and purity testing result that table kit of the present invention is extracted
Note：RNA concentration units are ng/ μ l；Absorbance ratio is absorbance ratios of the RNA at 260nm and 280nm
(260/280), judge the purity of RNA by absorbance ratio, as can be seen from the above table, absorbance 1.8～2.0 it
Between, illustrate that the RNA purity that extracts is preferable.
In table sample 1,2,3,4,5,6,7 be respectively using the kit extract from 100 μ l serum about 1.02 μ g, 1.09
μ g, 1.04 μ g, 1.09 μ g, 0.99 μ g, 1.09 μ g, 1.04 μ g genomes.
Experimental example
1st, it is used for detecting that foot and mouth disease virus is O-shaped and the kit specificity experiments of Asia1 type mixed infections
Carry that foot and mouth disease virus is O-shaped and the ox of Asia1 type mixed infections is as animal used as test to make a definite diagnosis, checking present invention inspection
The specificity of the O-shaped RT-PCR kit with Asia1 type mixed infections of foot and mouth disease virus is surveyed, is comprised the following steps：
(1) collection of sample
100 μ l of collection ox whole blood, add standby in the centrifuge tube without RNase pollution.
(2) extraction (lysate and flushing formula of liquid are with embodiment 1) of sample RNA
A () is in 100 μ l whole bloods of collection, plus 500 μ l of lysate, 12000rpm centrifugation 30s, isolates supernatant；
C () proceeds to supernatant in centrifuge tube, plus 500 μ l of absolute ethyl alcohol, is gone on RNA purification columns by several times, 12000rpm
Centrifugation 30s, the RNA for slightly being carried；
D () rinses RNA purification columns with 500 μ l of flushing liquor, 12000rpm is centrifuged 30s；
E RNA purification columns are gone to another centrifuge tube by (), plus 50 μ l of ultra-pure water, 12000rpm centrifugation 30s, obtain virus and
The RNA of tissue gene group, saves backup in -20 DEG C.
(3)RT-PCR
With sample RNA as template, RT-PCR amplifications are carried out, while with A types, c-type, SAT1 (South Africa I), SAT2 (South Africa II
Type) and SAT3 (III type of South Africa) sample for control, extract control sample RNA, RT-PCR expand, 25 μ l of reaction system：5×RT
5 μ l of Buffer, 12.5 μM of 5 μ l of dNTPs, 125 μM of upstream primer FMDOF and each 1 μ l of 125 μM of downstream primer FMDOR, 125 μM
The each 1 μ l of upstream primer FMDAsiaF and 125 μM of downstream primer FMDAsiaR, 0.5 μ l of 25U/ μ l Taq enzymes, 2.5U/ μ l RNases
1 μ l of inhibitor, 2.5 μM of 1 μ l of reverse transcriptase, 3.5 μ l and 5ng/ μ l RNA of ultra-pure water, 5 μ l.
RT-PCR amplification programs are：50 DEG C of 30min, 94 DEG C of 3min；94 DEG C of 40s, 55 DEG C of 45s, 72 DEG C of 30s, totally 35 are followed
Ring；72℃3min.
(4) detection of RT-PCR amplified productions
5 μ l and Loading Buffer of RT-PCR amplified productions, 5 μ l mixings are taken, the agarose for being added to containing EB 1.0% coagulates
In glue, the RT-PCR amplified productions and DL2000DNA Marker of control is simultaneously introduced, voltage is 120V, electrophoresis 35min, then
Observation result in gel imaging instrument (result is shown in Fig. 3).
Agarose gel electrophoresis result shows that the RT-PCR amplified productions of inventive samples RNA are in RT-PCR amplified productions
There is band in 1350bp and 200bp, with expection be consistent, it was demonstrated that RT-PCR amplified productions of the present invention be foot and mouth disease virus O-shaped and
Asia1 type mixed infection purpose fragments.Meanwhile, the A types of control, c-type, SAT1 (South Africa I), SAT2 (south Africa II type) and SAT3
There is not specific band in (III type of South Africa) sample RT-PCR amplifications, illustrate that the RT-PCR kit of the present invention has good spy
The opposite sex.
2nd, it is used for detecting that foot and mouth disease virus is O-shaped and the kit sensitivity experiment of Asia1 type mixed infections
The RNA of extraction is taken 10 times of 1 μ g/ μ l works to be serially diluted, 1 μ g/ μ l, 100ng/ μ l, 10ng/ μ l, 1ng/ μ is taken respectively
L, 100pg/ μ l, 10pg/ μ l, 1pg/ μ l, 0.1pg/ μ l, 0.01pg/ μ l, 0.001pg/ μ l RNA carry out RT-PCR one-step method and enter
Row amplification, as a result shows that the foot and mouth disease virus of the present invention is O-shaped and is 0.1pg/ μ l with Asia1 type LDLs, this is than common
The sensitiveness (1pg/ μ l) of RT-PCR two-step methods be higher by 10 times.
SEQUENCE LISTING
<110>Animal Busbandry ＆. Veterinary Medicine Inst., Henan Prov. Academy of Agriculture
<120>A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method
And its application
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
tggcctcaaa gactctcg 18
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
caagctacag atcactttac 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
ctgggtttta caaacctgtg 20
<210> 4
<211> 19
<212> DNA
<213>Artificial sequence
<400> 4
ctctgacgtc acaattggc 19
Claims (10)
1. a kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, it is characterised in that described primer
Including primer pair FMDO and FMDAsia, wherein,
Primer pair FMDO：
Upstream primer FMDOF：5′-TGGCCTCAAAGACTCTCG-3′
Downstream primer FMDOR：5′-CAAGCTACAGATCACTTTAC-3′
Primer pair FMDAsia：
Upstream primer FMDAsiaF：5′-CTGGGTTTTACAAACCTGTG-3′
Downstream primer FMDAsiaR：5′-CTCTGACGTCACAATTGGC-3′.
2. a kind of for detecting that foot and mouth disease virus is O-shaped and the kit of Asia1 type mixed infections, it is characterised in that described examination
Agent box includes primer pair FMDO and FMDAsia, wherein,
Primer pair FMDO：
Upstream primer FMDOF：5′-TGGCCTCAAAGACTCTCG-3′
Downstream primer FMDOR：5′-CAAGCTACAGATCACTTTAC-3′
Primer pair FMDAsia：
Upstream primer FMDAsiaF：5′-CTGGGTTTTACAAACCTGTG-3′
Downstream primer FMDAsiaR：5′-CTCTGACGTCACAATTGGC-3′.
3. according to claim 2 for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus, which is special
Levy and be, described kit also includes 5 × RT Buffer, dNTPs, Taq enzyme, RNase inhibitor, reverse transcriptase, ultrapure
Water, lysate and flushing liquor.
4. according to claim 3 for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus, which is special
Levy and be, described kit also includes positive control and negative control.
5. according to claim 3 for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus, which is special
Levy and be, the group of described lysate is divided into：Oxyquinoline 3～5% (mass fraction), 3.2～5.2 μM of TCEP,
1.5～3.5 μM of phenyl isothiocyanate, PVP 1.3～3.5% (mass fraction), 0.3～0.5M of sodium chloride and
0.6～0.9M of sodium citrate.
6. according to claim 3 for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus, which is special
Levy and be, the group of described flushing liquor is divided into：10 μM of trishydroxymethylaminomethane, 1 μM of ethylenediamine tetra-acetic acid, ethanol 60～80%
(volume fraction)；pH 7.0.
7. a kind of as claimed in claim 3 it is used for detecting that foot and mouth disease virus to be O-shaped and the kit of Asia1 type mixed infections makes
With method, it is characterised in that comprise the following steps：
(1) collection of sample
(2) extraction of sample RNA
(3)RT-PCR
RT-PCR amplifications, 25 μ l of reaction system is carried out to sample RNA：5×RT Buffer 5μl、12.5μM dNTPs 5μl、
The each 1 μ l of 125 μM of upstream primer FMDOF and 125 μM of downstream primer FMDOR, 125 μM of upstream primer FMDAsiaF and 125 μM of downstreams
The each 1 μ l of primers F MDAsiaR, 0.5 μ l of 25U/ μ l Taq enzymes, 1 μ l of 2.5U/ μ l RNase inhibitors, 2.5 μM of 1 μ l of reverse transcriptase,
3.5 μ l and 5ng/ μ l RNA of ultra-pure water, 5 μ l；
RT-PCR amplification programs are：50 DEG C of 30min, 94 DEG C of 3min；94 DEG C of 40s, 55 DEG C of 45s, 72 DEG C of 30s, totally 35 circulations；72
℃3min；
(4) detection of RT-PCR amplified productions
Pcr amplification product is entered row agarose gel electrophoresis, and result is observed under gel imaging system.
8. the use for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus according to claim 7
Method, it is characterised in that the collection of described sample is divided into the collection of solid-like animal tissue or adopting for liquid animal tissue
Collection；Wherein,
The acquisition method of solid-like animal tissue is：Aseptic collection animal tissue pathological material of disease 0.1-100mg, loads and pollutes without RNase
Centrifuge tube in standby；
The collection of liquid animal tissue is divided into the collection of juice or the collection of blood, and the acquisition method of juice is：Use nose
Throat swab gathers nasopharynx liquid, loads standby in the centrifuge tube without RNase pollution；The acquisition method of blood is：Take whole blood, serum or
Blood plasma 10-100 μ l, add standby in the centrifuge tube without RNase pollution.
9. the use for detecting the O-shaped kit with Asia1 type mixed infections of foot and mouth disease virus according to claim 8
Method, it is characterised in that the extraction of described sample RNA, concrete grammar is：
(1) animal tissue of solid-like is first carried out milled processed, liquid animal tissue is directly used in extraction；
(2) after grinding in the animal tissue 20-100mg or liquid animal tissues 20-100 μ l of pasty state, plus lysate 500
μ l, 12000rpm are centrifuged 30s, isolate supernatant；
(3) supernatant is proceeded in centrifuge tube, plus 500 μ l of absolute ethyl alcohol, being gone on RNA purification columns by several times, 12000rpm is centrifuged
30s, the RNA for slightly being carried；
(4) RNA purification columns are rinsed with 500 μ l of flushing liquor, 12000rpm is centrifuged 30s；
(5) RNA purification columns are gone to another centrifuge tube, plus 50 μ l of ultra-pure water, 12000rpm centrifugation 30s, obtains virus and tissue
The RNA of genome, saves backup in -20 DEG C.
10. a kind of as described in any one of claim 2-6 for detecting that foot and mouth disease virus is O-shaped and Asia1 type mixed infections
Kit detection foot and mouth disease virus is O-shaped and Asia1 type mixed infections in terms of application.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610346028 | 2016-05-23 | ||
| CN201610346028X | 2016-05-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106498094A true CN106498094A (en) | 2017-03-15 |
Family
ID=58323360
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610977701.XA Pending CN106498094A (en) | 2016-05-23 | 2016-11-08 | A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106498094A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220436A (en) * | 2011-04-06 | 2011-10-19 | 珠海出入境检验检疫局检验检疫技术中心 | Method for detecting FMDV (Foot and Mouth Disease Virus) through real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) |
| CN102230029A (en) * | 2011-06-17 | 2011-11-02 | 河南省动物疫病预防控制中心 | Ternary RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and method of type O, type A and type Asial foot and mouth disease viruses |
| CN104195268A (en) * | 2014-09-15 | 2014-12-10 | 中国农业科学院兰州兽医研究所 | Reagent box for detecting aftosa A type, O type and Asia 1 type viruses and preparing method thereof |
| CN105112558A (en) * | 2015-08-06 | 2015-12-02 | 河南省动物疫病预防控制中心 | Foot and mouth disease viruses O, A and Asia I type ternary real time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit |
| CN105506176A (en) * | 2015-11-26 | 2016-04-20 | 洛阳莱普生信息科技有限公司 | Foot and mouth disease virus O-type, A-type, AsiaI-type triple real-time fluorescent RT-PCR detection kit |
-
2016
- 2016-11-08 CN CN201610977701.XA patent/CN106498094A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220436A (en) * | 2011-04-06 | 2011-10-19 | 珠海出入境检验检疫局检验检疫技术中心 | Method for detecting FMDV (Foot and Mouth Disease Virus) through real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) |
| CN102230029A (en) * | 2011-06-17 | 2011-11-02 | 河南省动物疫病预防控制中心 | Ternary RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and method of type O, type A and type Asial foot and mouth disease viruses |
| CN104195268A (en) * | 2014-09-15 | 2014-12-10 | 中国农业科学院兰州兽医研究所 | Reagent box for detecting aftosa A type, O type and Asia 1 type viruses and preparing method thereof |
| CN105112558A (en) * | 2015-08-06 | 2015-12-02 | 河南省动物疫病预防控制中心 | Foot and mouth disease viruses O, A and Asia I type ternary real time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit |
| CN105506176A (en) * | 2015-11-26 | 2016-04-20 | 洛阳莱普生信息科技有限公司 | Foot and mouth disease virus O-type, A-type, AsiaI-type triple real-time fluorescent RT-PCR detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 曹丽娟等: "O型口蹄疫病毒3D基因荧光定量PCR方法的建立及应用", 《中国畜牧兽医》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Halpin et al. | Isolation of Hendra virus from pteropid bats: a natural reservoir of Hendra virus | |
| Greiser-Wilke et al. | Diagnostic methods for detection of Classical swine fever virus—status quo and new developments | |
| CN103160615A (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN104726614A (en) | Detection primer, kit and detection method of infectious bovine rhinotracheitis virus | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| KR101064866B1 (en) | Primers capable of simultaneous detecting bovine coronavirus, bovine rotavirus and bovine viral diarrhea virus, and simultaneous detection method of diarrhea viruses in ruminants, including cattle, using the same | |
| CN108034741A (en) | A kind of two-pressure humidity generator nest-type PRC specific primer and detection kit and nested PCR detection method | |
| CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN106350609A (en) | Reagent and detection method for detecting vesicular stomatitis virus, and applications | |
| CN105779659A (en) | Primer and kit used for detecting foot-and-mouth disease virus type O as well as using method and application of kit | |
| CN105925727A (en) | Primer and kit for detecting foot and mouth disease virus type A and type O mixed infection and use method and application of kit | |
| CN107974514A (en) | A kind of reagent, detection method and application for pig A type Senecan viral diagnosis | |
| US11098380B2 (en) | Reagent and method for rapid detection of porcine adenovirus | |
| Hemida et al. | Foot-and-mouth disease virus O/ME-SA/Ind 2001 lineage outbreak in vaccinated Holstein Friesian cattle in Saudi Arabia in 2016 | |
| CN106498094A (en) | A kind of for detecting that foot and mouth disease virus is O-shaped and the primer of Asia1 type mixed infections, kit, using method and its application | |
| CN100363502C (en) | Spiroplasma pathogenic microorganism PCR fast checking technique | |
| CN108950084A (en) | It is a kind of for detecting the primer sets and kit of Porcine epidemic diarrhea virus and pig astrovirus | |
| CN100567506C (en) | A kind of H5 subtype avian influenza virus detection kit and application thereof | |
| CN105779658A (en) | Primer and kit used for detecting mixed infection with foot-and-mouth disease virus types O, A and Asia1 as well as using method and application of kit | |
| CN108950072A (en) | A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method | |
| CN101525671B (en) | Highly pathogenic porcine reproductive and respiratory syndrome virus detection reagent kit and application thereof | |
| CN102808038A (en) | Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof | |
| CN103602760B (en) | Method for detecting Newcastle disease viruses through real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) by using virus-like particle interior label | |
| CN105950784A (en) | Primer and kit for detecting foot and mouth disease virus type Asia1, and using method and application of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170315 |