CN113444773A - Method and kit for detecting tick pathogen nucleic acid based on liquid chip - Google Patents

Abstract

The invention belongs to the technical field of tick detection, and particularly relates to a method and a kit for detecting tick pathogen nucleic acid based on a liquid chip, wherein the method for detecting tick-borne pathogens based on the liquid chip comprises the following steps: s1: designing a PCR primer, a Tag probe sequence and a double-combination probe sequence, wherein the PCR primer is used for amplifying 6 target gene fragments and 1 internal reference gene, and the Tag probe is a probe which is designed aiming at 6 target genes and internal reference genes and is modified by AminolinkerC12 at the 5' end and is used for marking fluorescent microspheres. The method and the kit for detecting tick pathogen nucleic acid based on the liquid-phase chip adopt the liquid-phase chip technology to carry out high-flux multiple detection on six types of common tick-borne pathogens, have the advantages of high detection speed, high sensitivity, full pathogen coverage and the like, and can be used as a favorable diagnostic tool for tick detection and evaluation of human and animal infection.

Description

Method and kit for detecting tick pathogen nucleic acid based on liquid chip

Technical Field

The invention relates to the technical field of tick detection, in particular to a method and a kit for detecting tick protozoon nucleic acid based on a liquid chip.

Background

Tick is the second largest infectious disease vector organism next to mosquitoes, can transmit various diseases of people and animals, and is extremely harmful. Tick-borne pathogens comprise bacteria, viruses, rickettsiae, spirochaete, parasites and the like, and have various pathogen types, but the existing tick-borne pathogens are limited in detection means and lack of related commercial detection kits. The existing non-diagnostic detection methods have the defects of low sensitivity, complex operation, certain subjectivity in result judgment and the like, and almost all adopt detection aiming at a single pathogen, so that the coverage is insufficient, and the detection is easy to miss.

The MASA liquid phase chip (multifunctional Suspension Array) technology is a high-throughput detection technology developed in the later 90 s of the 20 th century. The technology can realize high-capacity coding of the microspheres through a unique microsphere fluorescent coding technology, each microsphere has different characteristic fluorescent spectrums, and then each coding microsphere is covalently linked with capture molecules such as antigen/antibody or nucleic acid probe and the like aiming at a specific detection object. During reaction, each coding microsphere is mixed with a sample to be detected, target molecules in reaction suspension are specifically combined with capture molecules crosslinked on the surfaces of the microspheres, and detection reactions of up to 50 different detection targets can be simultaneously completed in one reaction hole. And finally, respectively identifying the fluorescent intensity of the microsphere code and the reporter molecule on the microsphere by two beams of laser on a matched instrument, thereby realizing qualitative or quantitative analysis of the detection index. The technology has the technical advantages of multi-index joint detection, strong compatibility, high accuracy, less required samples and the like, and is very suitable for detection application of pathogens.

Disclosure of Invention

This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.

To solve the above technical problem, according to an aspect of the present invention, the present invention provides the following technical solutions:

a method for detecting tick-borne pathogens based on a liquid-phase chip comprises the following steps:

s1: designing a PCR primer, a Tag probe sequence and a double-binding probe sequence, wherein the PCR primer is used for amplifying 6 target gene segments and 1 internal reference gene, the Tag probe is a probe which is designed aiming at 6 target genes and internal reference genes and is modified by Aminoliner C12 at the 5' tail end and is used for marking fluorescent microspheres, and the double-binding probe sequence is used for specifically hybridizing with an amplification product of the target gene segments amplified by the PCR primer and the Tag fluorescent microspheres;

performing biotin modification at the 5' end of PCR primers of a strand complementary to the probe, wherein the PCR primers comprise 7 pairs of primers, and the sequences of the 7 pairs of primers are as follows:

anaplama upstream primer: AGTCCGGRAGAGGATAGCG, respectively;

anaplasma downstream primer: Biotin-TTCGCACCTCAGYGTCAG;

borrelia upstream primer: TAATGCTTRTTGGAGAAAATGAC, respectively;

borrelia downstream primers: Biotin-GCAACYTCAGCCATACCT;

babesia upstream primer: CAAGAACGAAAGTTAGGGGMT, respectively;

babesia downstream primer: Biotin-TGATTTCTCTCAAGSTSCTG;

borreliaella upstream primer: CTTGTAGATGAGTCTGCGTCTTATTA, respectively;

borreliaella downstream primer: Biotin-CTCAGTTCCAGTGTGACCGWTC;

rickettsia upstream primer: ttgtgacgggraggtaacttgt;

the downstream primer of Ricketttsia: Biotin-ATTATCGGCAGGAGCATCAA;

TBEV upstream primer: GGGCGGTTCTTGTTCTCC, respectively;

TBEV downstream primer: Biotin-ACACATCACCTCCTTGTCAGACT;

beta-globin upstream primer: GGCTGCCTATCAGAAAGTGGTG, respectively;

beta-globin downstream primer: Biotin-AGGCAGAATCCAGATGCTCAAG;

the Tag probe sequence is as follows (5, -3'):

Anaplasma-T：NH2C12-TGATTGTAGTATGTATTGATAAAG；

Borrelia-T：NH2C12-GATTGTAAGATTTGATAAAGTGTA；

Babesia-T：NH2C12-GATTTGAAGATTATTGGTAATGTA；

Borreliella-T：NH2C12-GATTGATTATTGTGATTTGAATTG；

Rickettsia-T：NH2C12-GATTTGATTGTAAAAGATTGTTGA；

TBEV-T：NH2C12-ATTGGTAAATTGGTAAATGAATTG；

β-globin-T：NH2C12-GTAAGTAATGAATGTAAAAGGATT；

the double-binding probe sequence is as follows (5, -3'):

Anaplasma-P：CTTTATCAATACATACTACAATCA AGGAGGAACACCAGTGGCGAAG；

Borrelia-P：TACACTTTATCAAATCTTACAATC TGGGAAGAAGCACCAACAGATTATG；

Babesia-P：TACATTACCAATAATCTTCAAATC TAGKGATTGGAGGTCGTCRKT；

Borreliella-P：CAATTCAAATCACAATAATCAAT CCCTACCAAGRCRATGATAAGTAACCG；

Rickettsia-P：TCAACAATCTTTTACAATCAAATC AACTTGTTGCCTGTTACTATTACTGY；

TBEV-P：CAATTCATTTACCAATTTACCAATCCCTGAGCCACCATCACCCAGACACAGAT；

β-globin-P：AATCCTTTTACATTCATTACTTAC GCCCACAAGTATCACTAAGCTCGC；

s2: preparing a liquid phase chip: coupling the fluorescent coding microspheres with the Tag probes in the step S1 and the double-binding probes in the step S1 to obtain a liquid-phase chip;

s3: and (3) amplifying the target gene by using the PCR primer in the step S1 to obtain an amplification product, hybridizing the amplification product with the fluorescent reporter molecule and the liquid chip obtained in the step S2 to obtain a hybridization product, and reading a detection result by using a liquid chip detector.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the step S3 specifically includes:

(1) dispersing the mixed Tag fluorescent microspheres in a detection buffer solution;

(2) taking the PCR amplification product obtained in the step S1, uniformly mixing the PCR amplification product with the system, sealing the container mouth for containing the reaction system, incubating at 95 ℃ for 2min, transferring to the environment at 55 ℃, and continuing to incubate for 10 min;

(3) after incubation, 5 mu L of SA-PE is added to close the container mouth again, and the container is placed in a NovaHT sample adding plate for machine detection after incubation for 5min at 55 ℃.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the step S3 is performed under light-shielding conditions.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the detection buffer comprises 31 parts by volume of tetramethylammonium chloride buffer, 10 parts by volume of TE solution, and 4 parts by volume of 10% w/vPEG8000 aqueous solution.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the preparation component proportion and the preparation method of the tetramethylammonium chloride buffer solution are as follows:

225 parts by volume of 5mol/L tetramethylammonium chloride aqueous solution, 1.88 parts by volume of 20% (w/v) sarcosyl double distilled aqueous solution, 18.75 parts by volume of pH8.0, 1mol/L Tris-HCl solution, 3.0 parts by volume of 0.5mol/L EDTA solution, and 1.37 parts by volume of double distilled water were mixed and dissolved in a water bath at 68 ℃ and stored at room temperature.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the preparation component proportion and the preparation method of the TE solution are as follows:

mixing 1 part by volume of Tris-HCl solution with pH8.0 and 1mol/L, 0.2 part by volume of EDTA solution with pH8.0 and 0.5mol/L and 100 parts by volume of double distilled water.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: in the hybridization reaction system of step S3, the molecular ratio of Tag to double-binding probe is 1: 1.5.

As a preferable scheme of the method for detecting tick-borne pathogens based on the liquid-phase chip, the method comprises the following steps: the preparation method of the fluorescent coding microsphere with the Tag probe of the step S1 comprises the following steps:

uniformly mixing the fluorescence-encoded microspheres with 0.1M of 2-N-morpholinoethanesulfonic acid solution with the pH value of 4.5 to obtain a coupling system; and then adding a Tag probe and dichloroethane into the coupling system, and carrying out a light-shielding reaction to obtain the Tag fluorescent coding microspheres.

A method for detecting tick-borne pathogen nucleic acid based on a liquid chip and a kit,

compared with the prior art:

1. the invention combines a multiplex PCR technology and a flow lattice apparatus (NovaHT) technology, and designs a primer group capable of simultaneously detecting 6 tick-borne pathogens. And performing multiplex PCR by using the primer group to obtain a target amplification product, hybridizing the amplification product, the fluorescent coding microspheres and streptavidin-phycoerythrin, and reading MFI values by using a flow-type dot-matrix analyzer so as to distinguish different types of pathogens. The method has the advantages of high speed, high efficiency, strong specificity, high sensitivity, good repeatability and the like, and can be applied to epidemiology investigation and early warning of tick-borne pathogens.

2. The conventional detection method for tick-borne diseases at present is single item detection, and can not detect various pathogens at one time, compared with the traditional detection method, the method provided by the invention can be used for simultaneously detecting various different target molecules in the same sample, realizing high-throughput detection, and flexibly increasing detection items according to the increase of pathogens; meanwhile, the sample dosage is small, the operation is simple, the detection efficiency is high, and the detection cost can be greatly reduced.

3. The PCR product is captured by the specific microsphere probe, the result judgment is performed by using the fragment length of the PCR product better than that of the traditional multiple detection method, and the detection specificity is stronger.

4. The flow-type dot matrix instrument (NovaHT) utilizes a biotin-avidin system to amplify signals, the affinity of the biotin-avidin system is 1015L/moL which is more than 104 times higher than that of a simple antibody, so that the detection result is more sensitive, less interfered by the environment and high in stability; the detection sensitivity of the method is 1-2 orders of magnitude higher than that of the common PCR.

5. The flow-type dot-matrix instrument utilizes the reaction of microspheres in solution, overcomes the influence of surface tension, space effect and the like on reaction kinetics when a membrane chip is detected by macromolecules, greatly improves the repeatability of sample detection, and has reliable and stable detection results: the repeatability of detection can reach more than 90% and the linear range is wide.

6. The invention has high flexibility, and can detect the types of pathogens by addition and subtraction on the basis of the requirement.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the present invention will be described in detail with reference to the accompanying drawings and detailed embodiments, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise. Wherein:

FIG. 1 is a schematic diagram of hybridization detection of a liquid chip according to the present invention;

FIG. 2 is a schematic diagram of the sensitivity test of the anaplama primer of the present invention;

FIG. 3 is a schematic diagram of the sensitivity test of the Babesia primer of the present invention;

FIG. 4 is a schematic representation of the Borrelia primer sensitivity test of the present invention;

FIG. 5 is a schematic diagram of the Borreliaella primer sensitivity test of the present invention;

FIG. 6 is a schematic diagram of the sensitivity test of the Rickettsia primer of the present invention;

FIG. 7 is a diagram showing the sensitivity test of the TBEV primer of the invention.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described herein, and it will be apparent to those of ordinary skill in the art that the present invention may be practiced without departing from the spirit and scope of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

Next, the present invention will be described in detail with reference to the drawings, and in the detailed description of the embodiments of the present invention, the cross-sectional views illustrating the structure of the device are not enlarged partially according to the general scale for convenience of illustration, and the drawings are only examples, which should not limit the scope of the present invention. In addition, the three-dimensional dimensions of length, width and depth should be included in the actual fabrication.

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

Example 1

One, liquid phase chip preparation

40u1 (1X 105) Novastar magnetic fluorescent microspheres with surface carboxyl modified, which are developed by Wuhan New Enchangaceae virus disease engineering technology Limited, are taken out, centrifuged at 12000rpm for 2min, the supernatant is discarded, 5u10.1M MES solution (2- (N-morpholino) ethanesulfonic acid) with pH of 4.5 is added into the precipitate, and the mixture is mixed evenly to obtain the coupling system. The Tag probe solution was diluted to 0.1mM and lul was added to the coupled system. Then 2.5u1 l0mg/ml EDC (dichloroethane) was added, mixed well and left for 30min in the dark. 2.5u1 l0mg/ml EDC was added again, mixed well and left for 30min in the dark. Washed once with 0.2m1 vol% 0.02% Tween-20 and 0.1% by mass/vol sodium dodecyl sulfate) solution, and finally resuspended in 10u11 XTE (pH8.0, the composition of matter therein is lM Tris-HCl, 1 mL; 0.5mM EDTA, 0.2mL, and 100mL of double distilled water) to obtain fluorescent microspheres coupled with the Tag probe.

The fluorescent microspheres coupled with the Tag probes are uniformly mixed, the number of the microspheres (the number of the microspheres per microliter is converted after the number of 4 large squares at four corners is counted) is counted by using a hemocytometer, and the microspheres are stored at 4 ℃ in a dark place. And mixing the 6 fluorescent microspheres coupled with the Tag probes, diluting the mixture by using 1.5 times of TMAC buffer solution to ensure that the concentration of each microsphere is 100 per u1 respectively to obtain a liquid phase chip to be subjected to hybridization detection.

Wherein, the preparation method of 1.5 times TMAC buffer solution, namely tetramethylammonium chloride aqueous solution, comprises the following steps of preparing 250mL reagent:

5mol/L TMAC (tetramethylammonium chloride), 225 mL;

20% (w/v) sarkosyl (sarcosyl), 1.88 mL;

1mol/L Tris-HCl，pH 8.0，18.75mL；

0.5mol/L EDTA，pH 8.0，3.0mL；

double distilled water, 1.37 mL;

subpackaging and storing in a refrigerator at 4 ℃.

Hybridization in TMAC is beneficial for true positive hybridization to confirm correct pairing of nucleotide sequences, allows hybridization temperature to vary only with oligonucleotide length, and can effectively reject false positive results of GC-rich sequences.

Wherein the 20% (w/v) Sarkosyl solution is prepared by Sarkosyl 20g, double distilled water 100mL, and can be completely dissolved in 68 deg.C water bath without high pressure and stored at room temperature.

Second, sample detection

1. PCR amplification

Detecting 8 samples, and performing PCR amplification on each sample to be detected:

1) ensuring that a PCR reaction establishment area and a pipettor are clean and pollution-free;

2) taking out the PCR amplification reagent stored at-20 ℃ and placing the PCR amplification reagent on a refrigeratable pore plate or ice;

3) the PCR system Master Mix was prepared according to the following table, and 1 more reaction than the required amount was recommended. For example: the samples tested in the experiment required 9 reactions, calculated as 10 reactions considering the consumption in the split charging process;

TABLE 1 preparation of Master Mix for PCR reaction System

4) Flick Master Mix, instantaneous centrifugation;

5) taking 15 mu L Master Mix, putting the Master Mix into a refrigeratable pore plate or a PCR reaction tube precooled on ice, covering a tube cover tightly, and then putting the tube cover on the ice again;

6) transferring the PCR reaction tube added with the Master Mix in the step 5 and a refrigeratable pore plate or ice to a template sample adding area together to ensure that the template sample adding area, a pipettor and the like are free of pollution;

7) taking out a nucleic acid sample to be detected, flicking and uniformly mixing the sample, and carrying out instantaneous centrifugation;

8) adding 5 mu L of sample into a corresponding PCR reaction tube, uniformly mixing the sample, and performing instantaneous centrifugation to ensure that the liquid is sunk into the bottom of the tube;

9) placing the well-mixed PCR reaction tube on a fluorescent quantitative PCR instrument, and operating a PCR program;

TABLE 2PCR cycling conditions

10) After the reaction is finished, the fluorescent quantitative result is analyzed, the product can be stored at the temperature of 20 ℃ below zero for a short time, and the product can be transferred to a refrigerator at the temperature of 80 ℃ below zero for a long time. 2. Hybridization assay

Ensure the detection zone and the pipettor are clean and pollution-free.

And taking out the mixed Tag microspheres and the detection buffer solution at the temperature of 2-8 ℃, and placing the mixed Tag microspheres and the detection buffer solution on a light-proof pipe frame in a detection area.

The mixed microsphere solution was prepared as shown in the following table, with 1 more than the required reaction amount being recommended. For example: the samples tested in the experiment required 9 hybridization reactions, calculated as 10 reactions in terms of consumption during dispensing.

TABLE 3 solution preparation

Mixing the Tag microspheres, shaking by vortex, and mixing for 15-30 sec.

The shaken mixed Tag microspheres are added to the detection buffer.

The mixed microsphere solution was mixed by vortexing, and 51. mu.L of each mixed microsphere solution was added to an 8-tube.

The PCR product was removed at 4 ℃ and placed on a refrigeratable well plate in the detection zone.

And (3) whirling, shaking and mixing the PCR product uniformly, and performing instantaneous centrifugation.

And adding 5 mu L of PCR product into the corresponding detection reagent reaction hole, and blowing and mixing the PCR product and the detection reagent by a pipette.

Sticking a membrane easy to puncture, placing the reaction tube in a PCR instrument, setting the denaturation at 95 ℃ for 2min, and then incubating at 59 ℃ for 10 min.

After incubation, the easily-punctured membrane is directly punctured by a gun head, 5 mu L of SA-PE is added to stick the easily-punctured membrane again, incubation is carried out for 5min in a dark place at 59 ℃, and the eight connecting tubes are placed in a NovaHT sample adding plate for machine loading detection.

TABLE 4 schematic table of liquid phase chip detection results

Remarking: the fluorescence number is more than 50000 and less than 10000.

While the invention has been described above with reference to an embodiment, various modifications may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the various features of the disclosed embodiments of the invention may be used in any combination, provided that no structural conflict exists, and the combinations are not exhaustively described in this specification merely for the sake of brevity and resource conservation. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.

Claims (9)

1. A method for detecting tick-borne pathogens based on a liquid-phase chip is characterized by comprising the following steps:

s1: designing a PCR primer, a Tag probe sequence and a double-binding probe sequence, wherein the PCR primer is used for amplifying 6 target gene segments and 1 internal reference gene, the Tag probe is a probe which is designed aiming at 6 target genes and internal reference genes and is modified by Aminoliner C12 at the 5' tail end and is used for marking fluorescent microspheres, and the double-binding probe sequence is used for specifically hybridizing with an amplification product of the target gene segments amplified by the PCR primer and the Tag fluorescent microspheres;

performing biotin modification at the 5' end of PCR primers of a strand complementary to the probe, wherein the PCR primers comprise 7 pairs of primers, and the sequences of the 7 pairs of primers are as follows:

anaplama upstream primer: AGTCCGGRAGAGGATAGCG, respectively;

anaplasma downstream primer: Biotin-TTCGCACCTCAGYGTCAG;

borrelia upstream primer: TAATGCTTRTTGGAGAAAATGAC, respectively;

borrelia downstream primers: Biotin-GCAACYTCAGCCATACCT;

babesia upstream primer: CAAGAACGAAAGTTAGGGGMT, respectively;

babesia downstream primer: Biotin-TGATTTCTCTCAAGSTSCTG;

borreliaella upstream primer: CTTGTAGATGAGTCTGCGTCTTATTA, respectively;

borreliaella downstream primer: Biotin-CTCAGTTCCAGTGTGACCGWTC;

rickettsia upstream primer: ttgtgacgggraggtaacttgt;

the downstream primer of Ricketttsia: Biotin-ATTATCGGCAGGAGCATCAA;

TBEV upstream primer: GGGCGGTTCTTGTTCTCC, respectively;

TBEV downstream primer: Biotin-ACACATCACCTCCTTGTCAGACT;

beta-globin upstream primer: GGCTGCCTATCAGAAAGTGGTG, respectively;

beta-globin downstream primer: Biotin-AGGCAGAATCCAGATGCTCAAG;

the Tag probe sequence is as follows (5, -3'):

Anaplasma-T：NH2C12-TGATTGTAGTATGTATTGATAAAG；

Borrelia-T：NH2C12-GATTGTAAGATTTGATAAAGTGTA；

Babesia-T：NH2C12-GATTTGAAGATTATTGGTAATGTA；

Borreliella-T：NH2C12-GATTGATTATTGTGATTTGAATTG；

Rickettsia-T：NH2C12-GATTTGATTGTAAAAGATTGTTGA；

TBEV-T：NH2C12-ATTGGTAAATTGGTAAATGAATTG；

β-globin-T：NH2C12-GTAAGTAATGAATGTAAAAGGATT；

the double-binding probe sequence is as follows (5, -3'):

Anaplasma-P：CTTTATCAATACATACTACAATCA AGGAGGAACACCAGTGGCGAAG；

Borrelia-P：TACACTTTATCAAATCTTACAATC TGGGAAGAAGCACCAACAGATTATG；

Babesia-P：TACATTACCAATAATCTTCAAATC TAGKGATTGGAGGTCGTCRKT；

Borreliella-P：CAATTCAAATCACAATAATCAAT CCCTACCAAGRCRATGATAAGTAACCG；

Rickettsia-P：TCAACAATCTTTTACAATCAAATC AACTTGTTGCCTGTTACTATTACTGY；

TBEV-P：CAATTCATTTACCAATTTACCAATCCCTGAGCCACCATCACCCAGACACAGAT；

β-globin-P：AATCCTTTTACATTCATTACTTACGCCCACAAGTATCACTAAGCTCGC；

s2: preparing a liquid phase chip: coupling the fluorescent coding microspheres with the Tag probes in the step S1 and the double-binding probes in the step S1 to obtain a liquid-phase chip;

s3: and (3) amplifying the target gene by using the PCR primer in the step S1 to obtain an amplification product, hybridizing the amplification product with the fluorescent reporter molecule and the liquid chip obtained in the step S2 to obtain a hybridization product, and reading a detection result by using a liquid chip detector.

2. The method for detecting tick-borne pathogens based on liquid-phase chip according to claim 1, wherein the step S3 specifically comprises:

(1) dispersing the mixed Tag fluorescent microspheres in a detection buffer solution;

(2) taking the PCR amplification product obtained in the step S1, uniformly mixing the PCR amplification product with the system, sealing the container mouth for containing the reaction system, incubating at 95 ℃ for 2min, transferring to the environment at 55 ℃, and continuing to incubate for 10 min;

(3) after incubation, 5 mu L of SA-PE is added to close the container mouth again, and the container is placed in a NovaHT sample adding plate for machine detection after incubation for 5min at 55 ℃.

3. The method for detecting tick-borne pathogens based on liquid phase chip according to claim 1, wherein the step S3 is performed under the condition of being protected from light.

4. The method for detecting tick-borne pathogens based on liquid phase chip according to claim 2, wherein the detection buffer comprises 31 parts by volume of tetramethylammonium chloride buffer, 10 parts by volume of TE solution, and 4 parts by volume of 10% w/vPEG8000 aqueous solution.

5. The method for detecting tick-borne pathogens based on a liquid chip according to claim 4, wherein the tetramethylammonium chloride buffer solution is prepared by the following components in proportion and according to a preparation method:

225 parts by volume of 5mol/L tetramethylammonium chloride aqueous solution, 1.88 parts by volume of 20% (w/v) sarcosyl double distilled aqueous solution, 18.75 parts by volume of pH8.0, 1mol/L Tris-HCl solution, 3.0 parts by volume of 0.5mol/L EDTA solution, and 1.37 parts by volume of double distilled water were mixed and dissolved in a water bath at 68 ℃ and stored at room temperature.

6. The method for detecting tick-borne pathogens based on liquid-phase chip according to claim 4, wherein the TE solution is prepared according to the following component proportions:

mixing 1 part by volume of Tris-HCl solution with pH8.0 and 1mol/L, 0.2 part by volume of EDTA solution with pH8.0 and 0.5mol/L and 100 parts by volume of double distilled water.

7. The method for detecting tick-borne pathogens based on liquid phase chip according to claims 2-6, wherein the molecular ratio of Tag to double-binding probe in the hybridization reaction system of step S3 is 1: 1.5.

8. The method for detecting tick-borne pathogens based on liquid phase chip according to claim 1, wherein the preparation method of the fluorescent coding microsphere with the Tag probe of step S1 comprises the following steps:

uniformly mixing the fluorescence-encoded microspheres with 0.1M of 2-N-morpholinoethanesulfonic acid solution with the pH value of 4.5 to obtain a coupling system; and then adding a Tag probe and dichloroethane into the coupling system, and carrying out a light-shielding reaction to obtain the Tag fluorescent coding microspheres.

9. A method and a kit for detecting tick pathogen nucleic acid based on a liquid chip are characterized by comprising the PCR primer of claim 1, the double-binding probe of claim 1 and fluorescent coding microspheres marked by the Tag probe of claim 1.

Images