CN111206121A - Kit for detecting novel coronavirus orflab and S genes - Google Patents
Kit for detecting novel coronavirus orflab and S genes Download PDFInfo
- Publication number
- CN111206121A CN111206121A CN202010245062.4A CN202010245062A CN111206121A CN 111206121 A CN111206121 A CN 111206121A CN 202010245062 A CN202010245062 A CN 202010245062A CN 111206121 A CN111206121 A CN 111206121A
- Authority
- CN
- China
- Prior art keywords
- quality control
- kit
- orf1ab
- genes
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000711573 Coronaviridae Species 0.000 title claims abstract description 29
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 28
- 238000001514 detection method Methods 0.000 claims abstract description 23
- 238000003908 quality control method Methods 0.000 claims description 50
- 239000000523 sample Substances 0.000 claims description 30
- 238000003757 reverse transcription PCR Methods 0.000 claims description 28
- 239000000126 substance Substances 0.000 claims description 24
- 238000006243 chemical reaction Methods 0.000 claims description 23
- 102000004190 Enzymes Human genes 0.000 claims description 22
- 108090000790 Enzymes Proteins 0.000 claims description 22
- 101150010882 S gene Proteins 0.000 claims description 15
- 238000004458 analytical method Methods 0.000 claims description 15
- 239000012295 chemical reaction liquid Substances 0.000 claims description 13
- 239000013612 plasmid Substances 0.000 claims description 12
- 239000007850 fluorescent dye Substances 0.000 claims description 9
- 238000002360 preparation method Methods 0.000 claims description 7
- 102100034343 Integrase Human genes 0.000 claims description 6
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims description 6
- 239000003153 chemical reaction reagent Substances 0.000 claims description 6
- 239000000243 solution Substances 0.000 claims description 6
- 239000007853 buffer solution Substances 0.000 claims description 5
- 238000000034 method Methods 0.000 claims description 4
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 claims description 3
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 claims description 3
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L magnesium chloride Substances [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 claims description 3
- 229910001629 magnesium chloride Inorganic materials 0.000 claims description 3
- 238000003753 real-time PCR Methods 0.000 claims description 3
- 230000015572 biosynthetic process Effects 0.000 claims description 2
- 238000003786 synthesis reaction Methods 0.000 claims description 2
- 239000000872 buffer Substances 0.000 claims 1
- 230000004907 flux Effects 0.000 abstract description 3
- 230000003321 amplification Effects 0.000 description 17
- 238000003199 nucleic acid amplification method Methods 0.000 description 17
- 239000000463 material Substances 0.000 description 8
- 241000700605 Viruses Species 0.000 description 7
- 241001428935 Human coronavirus OC43 Species 0.000 description 5
- 241000709661 Enterovirus Species 0.000 description 4
- 241000711467 Human coronavirus 229E Species 0.000 description 4
- 241000482741 Human coronavirus NL63 Species 0.000 description 4
- 241000127282 Middle East respiratory syndrome-related coronavirus Species 0.000 description 4
- 230000000241 respiratory effect Effects 0.000 description 4
- 241001109669 Human coronavirus HKU1 Species 0.000 description 3
- 241000315672 SARS coronavirus Species 0.000 description 3
- 238000003745 diagnosis Methods 0.000 description 3
- 108020004707 nucleic acids Proteins 0.000 description 3
- 150000007523 nucleic acids Chemical class 0.000 description 3
- 102000039446 nucleic acids Human genes 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 241001678559 COVID-19 virus Species 0.000 description 2
- 102100032566 Carbonic anhydrase-related protein 10 Human genes 0.000 description 2
- 241000282412 Homo Species 0.000 description 2
- 101000867836 Homo sapiens Carbonic anhydrase-related protein 10 Proteins 0.000 description 2
- 241000701024 Human betaherpesvirus 5 Species 0.000 description 2
- 241000712079 Measles morbillivirus Species 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 241000725643 Respiratory syncytial virus Species 0.000 description 2
- 241000700584 Simplexvirus Species 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 241001493065 dsRNA viruses Species 0.000 description 2
- 238000010791 quenching Methods 0.000 description 2
- 230000000171 quenching effect Effects 0.000 description 2
- 241000701161 unidentified adenovirus Species 0.000 description 2
- 241000712461 unidentified influenza virus Species 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- 208000025721 COVID-19 Diseases 0.000 description 1
- 241000700588 Human alphaherpesvirus 1 Species 0.000 description 1
- 241000726041 Human respirovirus 1 Species 0.000 description 1
- 208000002606 Paramyxoviridae Infections Diseases 0.000 description 1
- 206010035664 Pneumonia Diseases 0.000 description 1
- 108091036407 Polyadenylation Proteins 0.000 description 1
- 241000251539 Vertebrata <Metazoa> Species 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000001079 digestive effect Effects 0.000 description 1
- 210000002249 digestive system Anatomy 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000001917 fluorescence detection Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 238000009533 lab test Methods 0.000 description 1
- 238000003771 laboratory diagnosis Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 210000000653 nervous system Anatomy 0.000 description 1
- 238000007899 nucleic acid hybridization Methods 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 238000004806 packaging method and process Methods 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000001308 synthesis method Methods 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting novel coronavirus orf1ab and S genes, and relates to the technical field of kit detection. The invention has high specificity, accuracy and detection efficiency, higher flux, simple and convenient operation, reduced cost and strong universality.
Description
Technical Field
The invention belongs to the technical field of kit detection, and particularly relates to a kit for detecting novel coronavirus orf1ab and S genes.
Background
Coronaviruses belong to the order of nested viruses, the family of coronaviruses, the genus of coronaviruses, are RNA viruses with envelope and linear single-stranded positive strand genomes, and are a large group of viruses widely existing in nature. The 5 'end of the viral genome has a methylated cap structure, the 3' end has a poly (A) tail, the genome has the total length of about 27-32kb, and the virus is the largest genome among the currently known RNA viruses. Coronaviruses only infect vertebrates, are associated with a variety of diseases in humans and animals, and can cause diseases in the respiratory, digestive and nervous systems of humans and animals.
To date, a total of 7 human-infectable coronaviruses, HCoV-229E, HCoV-OC43, SARS-CoV, HCoV-NL63, HCoV-HKU1, MERS-CoV and 2019 novel coronaviruses (2019-nCoV). HCoV-229E and HCoV-NL63 belong to α genus coronavirus, and HCoV-OC43, SARS-CoV, HCoV-HKU1, MERS-CoV and 2019 novel coronaviruses (2019-nCoV) all belong to β genus coronavirus, wherein HCoV-OC43 and HCoV-HKU1 belong to A subgroup, SARS-CoV belongs to B subgroup, and MERS-CoV belongs to C subgroup, were found.
Laboratory tests for coronaviruses include viral nucleic acid testing, antigen and antibody testing, and virus isolation and identification as a "gold standard" for diagnosis of viral infection. Among them, Reverse Transcription-Polymerase chain Reaction (RT-PCR) is widely used in the etiology diagnosis of 2019-nCoV pneumonia due to its advantages of short period, easy standardization and the like. Coronaviruses have complex structures, and products for gene detection can cover 2-3 related genes to be beneficial to subsequent diagnosis, such as MERS-CoV laboratory diagnosis standard flow published by World Health Organization (WHO), namely, multiple targets are used as detection indexes to increase the accuracy of PCR detection.
The kit for detecting the orf1ab and the S gene of the novel coronavirus is high in specificity, accuracy and detection efficiency, high in flux, simple and convenient to operate, low in cost and high in universality.
Disclosure of Invention
The invention aims to provide a kit for detecting orf1ab and an S gene of a novel coronavirus, aiming at the defects of the existing kit for detecting the novel coronavirus.
The invention provides the following technical scheme:
a kit for detecting novel coronavirus orf1ab and S genes comprises RT-PCR reaction liquid, an RT-PCR reaction enzyme system, a positive quality control product and a negative quality control product, wherein the RT-PCR reaction liquid contains a PCR buffer solution, specific positive and reverse primers and an anisotropic fluorescent probe, and sequence information is shown in Table 1:
TABLE 1
Preferably, the positive quality control product consists of a recombinant plasmid containing orf1ab and an S gene target sequence,
the target sequence of orf1ab gene is:
TTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGA TAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGT TCAACCTCAATTAGAGATGGAACTTACACCAGTTGT
the S gene target sequence is:
AGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTA TCTTCAACCTAGGAC。
preferably, the PCR buffer solution consists of 30-60mmol/L Tris-HCl and 3-8mmol/L MgCl2And 150-350mmol/L KCl.
Preferably, the RT-PCR reaction enzyme system consists of reverse transcriptase, Taq enzyme and dNTPs, wherein the dosage of the reverse transcriptase in each PCR reaction enzyme system is 1-3U, the dosage of the Taq enzyme is 2-5U, and the dosage of the dNTPs is 6-12 mmol.
Preferably, the S gene-specific fluorescent probe is labeled with VIC fluorophore at 5 'and with quencher BHQ1 at 3', and the orf1a gene-specific fluorescent probe is labeled with FAM fluorophore at 5 'and with quencher BHQ1 at 3'.
Preferably, the working concentration of each specific primer and probe in the kit is as shown in table 2:
TABLE 2
Preferably, the positive quality control material is a recombinant plasmid DNA containing orf1ab and the full length of the target S gene prepared by gene synthesis and having a concentration of 1 x 105copies mL。
Further, the negative quality control product is normal saline.
Based on the structure, the invention also provides a using method, which comprises the following steps:
s1, solution preparation: RT-PCR reaction liquid (850 mu L/tube), RT-PCR reaction enzyme system (150 mu L/tube), positive quality control substance (200 mu L/tube) and negative quality control substance (1000 mu L/tube);
s2, preparing a standard substance: ultraviolet spectrophotometer detects concentration of artificially constructed recombinant plasmid, calculates plasmid copy number, and uses DEPC H2O is respectively diluted to 1.0X 104copies/mL-1.0×102Preparing a standard substance from copies/mL;
s3, reagent preparation: taking 17 mu L of RT-PCR reaction liquid and 3 mu L of RT-PCR reaction enzyme system to be fully and evenly mixed for standby;
s4, sample adding: respectively adding 5 mu L of negative quality control substance, 5 mu L of positive quality control substance and 5 mu L of standard substance solution into the three PCR reaction tubes, tightly covering the tube caps, and placing the tube caps into a sample groove of an instrument;
s5, setting parameters by using an ABI Prism 7500 fluorescence quantitative PCR instrument: opening a Setup window, setting a negative quality control product, a positive quality control product and a sample to be detected according to a corresponding sequence, setting a sample Name in a Name column, selecting all sample setting holes, double-clicking, selecting an Add Detector and a Reporter as FAM and a Quencher as a none, selecting a Reporter as HEX and the Quencher as a none, selecting a none in a Pasive Reference, opening an instance window to set a cycle condition: 15 minutes at 50 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃, 45 seconds at 58 ℃ and 45 cycles, and after all the settings are finished, the file is stored and operated;
s6, result analysis: and after the reaction is finished, storing a detection data file, opening an Ampplot window under Results, selecting the position of the analyzed target sample, and changing the Baseline value into start: 3, stop: 10, and opens the manual setting Threshold: 1.5 +/-100000, opening a Graph settings window by double clicking the numerical value on the Rn coordinate, changing the Log in the Post Runsettings window into Linear, opening an Analysis preferences window after OK, and selecting an Analysis automatic Analysis result under an Analysis menu.
The invention has the beneficial effects that:
(1) the 2019-nCoV nucleic acid amplification level is detected, so that the 2019-nCoV infection state in a sample can be reflected, the method can be used for monitoring, prevention and control and clinical diagnosis of 2019-nCoV, and early diagnosis and treatment of 2019-nCoV are provided;
(2) special primers and probes are designed respectively aiming at the orf1ab and S gene specific sequences of 2019-nCoV, so that the specificity and accuracy of detection are ensured, the flux is high, the operation is simple and convenient, and the cost is reduced;
(3) the orf1ab and the S gene of 2019-nCoV can be detected simultaneously in one sample, the detection process only needs 1.5h, compared with 2 times of detection of one sample, the workload is greatly reduced, the detection efficiency is improved, and compared with the existing nucleic acid hybridization detection technology, the detection time is shortened by more than half;
(4) the positive and negative quality control products are adopted as the quality control of the reagent, so that the quality of the reagent can be strictly controlled;
(5) the reagent adopts a large packaging device of RT-PCR reaction liquid, primer probe mixed liquid and an RT-PCR reaction enzyme system, is suitable for various fluorescence detection devices, and has the characteristics of wider applicability and strong universality.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:
FIG. 1 shows the reaction conditions for PCR amplification in the present invention;
FIG. 2 is a graph showing the amplification curve of the negative quality control in the present invention;
FIG. 3 is a graph showing the amplification curve of the positive quality control in the present invention;
FIG. 4 is a graph showing the amplification profile of the standard of the present invention;
FIG. 5 is a graph showing the amplification curve of a specific sample in the present invention.
Detailed Description
Example 1
A kit for detecting novel coronavirus orf1ab and S genes comprises RT-PCR reaction liquid, an RT-PCR reaction enzyme system, a positive quality control product and a negative quality control product, wherein the RT-PCR reaction liquid contains a PCR buffer solution, specific positive and reverse primers and an anisotropic fluorescent probe, and sequence information is shown in Table 1:
TABLE 1
The positive quality control product consists of recombinant plasmids containing orf1ab and S gene target sequences, wherein the orf1ab gene target sequences are as follows:
TTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGA TAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGT TCAACCTCAATTAGAGATGGAACTTACACCAGTTGT
the S gene target sequence is:
AGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTA TCTTCAACCTAGGAC。
PCR buffer solution is prepared from 30-60mmol/L Tris-HCl and 3-8mmol/L MgCl2And 150-350mmol/L KCl. The RT-PCR reaction enzyme system consists of reverse transcriptase, Taq enzyme and dNTPs, wherein the dosage of the reverse transcriptase in each PCR reaction enzyme system is 1-3U, the dosage of the Taq enzyme is 2-5U, and the dosage of the dNTPs is 6-12 mmol.
The 5 'of the S gene specific fluorescent probe is marked with a VIC fluorescent group, the 3' is marked with a quenching group BHQ1, the 5 'of the orf1a gene specific fluorescent probe is marked with a FAM fluorescent group, and the 3' is marked with a quenching group BHQ 1.
The working concentration of each specific primer and probe in the kit is shown in table 2:
TABLE 2
The positive quality control material is recombinant plasmid DNA containing orf1ab and S gene purpose full length prepared by gene synthesis method, and has concentration of 1 x 105copies mL. The negative quality control product is normal saline.
In use, the solution preparation: RT-PCR reaction liquid (850 mu L/tube), RT-PCR reaction enzyme system (150 mu L/tube), positive quality control substance (200 mu L/tube) and negative quality control substance (1000 mu L/tube); preparation of a standard substance: ultraviolet spectrophotometer detects concentration of artificially constructed recombinant plasmid, calculates plasmid copy number, and uses DEPC H2O is respectively diluted to 1.0X 104copies/mL-1.0×102Preparing a standard substance from copies/mL; preparation of reagents: taking 17 mu L of RT-PCR reaction liquid and 3 mu L of RT-PCR reaction enzyme system to be fully and evenly mixed for standby; sample adding: respectively adding 5 mu L of negative quality control substance, 5 mu L of positive quality control substance and 5 mu L of standard substance solution into the three PCR reaction tubes, tightly covering the tube caps, and placing the tube caps into a sample groove of an instrument; setting parameters by using an ABI Prism 7500 fluorescence quantitative PCR instrument: opening a Setup window, setting a negative quality control product, a positive quality control product and a sample to be detected in a corresponding sequence, setting sample names in a Name column, selecting all set sample holes, double-clicking, selecting an Add Detector and a Reporter as FAM and a Quencher as none, and selecting a Reporter as HEX and Quencher is a none, the none is selected in the Pasive Reference, an event window is opened, and a loop condition is set: 15 minutes at 50 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃, 45 seconds at 58 ℃ and 45 cycles, as shown in fig. 1, the file is saved and run after all settings are completed; and (4) analyzing results: and after the reaction is finished, storing a detection data file, opening an Ampplot window under Results, selecting the position of the analyzed target sample, and changing the Baseline value into start: 3, stop: 10, and opens the manual setting Threshold: 1.5 +/-100000, opening a Graph Settings window by double clicking numerical values on Rn coordinates, changing Log in Post Run Settings into Linear, opening an Analysis preferences window after OK, and selecting an Analysis automatic Analysis result under an Analysis menu.
And (3) displaying a detection result: the amplification curve of the negative quality control material is shown in FIG. 2, and the amplification curve of the negative quality control material does not show an S shape, which indicates that FAM and HEX channel fluorescent signals are negative; the amplification curve of the positive quality control product is shown in FIG. 3, the amplification curves of the FAM channel and the HEX channel are S-shaped, which indicates that the fluorescence signals of the FAM channel and the HEX channel are both positive; the negative quality control product and the positive quality control product both meet the quality control requirement of the kit, so the detection result of the sample to be detected is effective.
FIG. 4 is an amplification curve of the standard, where the amplification curves of FAM and HEX channels are S-shaped, and the amplification curves of FAM and HEX channels of the standard 100copies/mL are positive, indicating that the kit can detect a sample with a concentration of 100copies/mL at 1.0X 104copies/mL-1.0×102The copies/mL has good linear relation, and the sensitivity can reach 100copies/mL
Example 2
Positive samples of coronavirus (HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU13), influenza virus (H3N2, H1N1), respiratory Adenovirus (Adenoviral type5), respiratory syncytial virus (RSVA, RSVB), enterovirus (EV71, CA16, CA6 and CA10), parainfluenza virus type 1, rhinovirus, herpes simplex virus type 1, EB virus, human cytomegalovirus and measles virus are selected as specific samples in each 1 case, all samples are subjected to nucleic acid extraction, PCR amplification and result analysis steps are carried out according to example 1, and detection of negative quality control products and positive quality control products is carried out at the same time.
And (3) displaying a detection result: the amplification curve of the negative quality control material does not present an S-shaped curve, the amplification curve of the positive quality control material is obviously S-shaped, and both the negative quality control material and the positive quality control material meet the quality control requirements of the kit, so that the detection result of the sample to be detected is effective. The amplification curves of the specific samples are shown in FIG. 5, the FAM and HEX channels have no S-type amplification curves, which indicates that the FAM and HEX channels are negative, and the detection results of the samples to be detected show that the kit has no non-specific amplification on coronavirus (HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU13), influenza virus (H3N2 and H1N1), respiratory Adenovirus (Adenoviral type5), respiratory syncytial virus (RSVA/B), enterovirus (EV71, CA16, CA6 and CA10), parainfluenza virus 1, rhinovirus, herpes simplex virus (HSV-1), EB virus, human cytomegalovirus and measles virus.
The detection results of the respiratory pathogens in the test are negative, which indicates that the kit has better specificity, and the kit is feasible for detecting orf1ab and S genes of 2019-nCoV.
Although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (9)
1. A kit for detecting novel coronavirus orf1ab and S genes is characterized by comprising RT-PCR reaction liquid, an RT-PCR reaction enzyme system, a positive quality control product and a negative quality control product, wherein the RT-PCR reaction liquid contains a PCR buffer solution, specific positive and reverse primers and an anisotropic fluorescent probe, and sequence information is shown in Table 1:
TABLE 1
2. The kit for detecting orf1ab and S genes of a novel coronavirus according to claim 1, wherein the positive quality control substance consists of a recombinant plasmid containing the sequences of interest of orf1ab and S genes,
the target sequence of orf1ab gene is:
TTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGT
the S gene target sequence is:
AGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGAC。
3. the kit for detecting novel coronavirus orf1ab and S genes according to claim 2, wherein the PCR buffer consists of 30-60mmol/L Tris-HCl, 3-8mmol/L MgCl2And 150-350 mmol/LKCl.
4. The kit for detecting orf1ab and S genes of a novel coronavirus according to claim 2, wherein the RT-PCR reaction enzyme system consists of reverse transcriptase, Taq enzyme and dNTPs, and the amount of the reverse transcriptase is 1 to 3U, the amount of the Taq enzyme is 2 to 5U, and the dNTPs is 6 to 12mmol per one PCR reaction enzyme system.
5. The kit for detecting novel coronavirus orf1ab and S genes according to claim 2, wherein the S gene-specific fluorescent probe is labeled with VIC fluorophore at 5 'and quencher BHQ1 at 3', and the orf1a gene-specific fluorescent probe is labeled with FAM fluorophore at 5 'and quencher BHQ1 at 3'.
6. The kit for detecting orf1ab and S genes of novel coronavirus according to claim 2, wherein the working concentration of each specific primer and probe in the kit is as shown in table 2:
TABLE 2
7. The kit for detecting orf1ab and S genes of a novel coronavirus according to claim 6, wherein the positive quality control substance is a full-length recombinant plasmid DNA containing the orf1ab and S genes of interest prepared by gene synthesis at a concentration of 1 x 105copies mL。
8. The kit for detecting novel coronavirus orf1ab and S genes according to claim 7, wherein the negative quality control substance is normal saline.
9. A method of using the kit for detecting orf1ab and S gene of the novel coronavirus according to claims 1 to 8, comprising the steps of:
s1, solution preparation: RT-PCR reaction liquid (850 mu L/tube), RT-PCR reaction enzyme system (150 mu L/tube), positive quality control substance (200 mu L/tube) and negative quality control substance (1000 mu L/tube);
s2, preparing a standard substance: ultraviolet spectrophotometer detects concentration of artificially constructed recombinant plasmid, calculates plasmid copy number, and uses DEPC H2O is respectively diluted to 1.0X 104copies/mL-1.0×102Preparing a standard substance from copies/mL;
s3, reagent preparation: taking 17 mu L of RT-PCR reaction liquid and 3 mu L of RT-PCR reaction enzyme system to be fully and evenly mixed for standby;
s4, sample adding: respectively adding 5 mu L of negative quality control substance, 5 mu L of positive quality control substance and 5 mu L of standard substance solution into the three PCR reaction tubes, tightly covering the tube caps, and placing the tube caps into a sample groove of an instrument;
s5, setting parameters by using an ABI Prism 7500 fluorescence quantitative PCR instrument: opening a Setup window, setting a negative quality control product, a positive quality control product and a sample to be detected according to a corresponding sequence, setting a sample Name in a Name column, selecting all sample setting holes, double-clicking, selecting an Add Detector and a Reporter as FAM and a Quencher as a none, selecting a Reporter as HEX and the Quencher as a none, selecting a none in a Pasive Reference, opening an instance window to set a cycle condition: 15 minutes at 50 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃, 45 seconds at 58 ℃ and 45 cycles, and after all the settings are finished, the file is stored and operated;
s6, result analysis: and after the reaction is finished, storing a detection data file, opening an Ampplot window under Results, selecting the position of the analyzed target sample, and changing the Baseline value into start: 3, stop: 10, and opens the manual setting Threshold: 1.5 +/-100000, opening a Graph settings window by double clicking the numerical value on the Rn coordinate, changing the Log in the Post Runsettings window into Linear, opening an Analysis preferences window after OK, and selecting an Analysis automatic Analysis result under an Analysis menu.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010245062.4A CN111206121A (en) | 2020-03-31 | 2020-03-31 | Kit for detecting novel coronavirus orflab and S genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010245062.4A CN111206121A (en) | 2020-03-31 | 2020-03-31 | Kit for detecting novel coronavirus orflab and S genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111206121A true CN111206121A (en) | 2020-05-29 |
Family
ID=70784647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010245062.4A Pending CN111206121A (en) | 2020-03-31 | 2020-03-31 | Kit for detecting novel coronavirus orflab and S genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111206121A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500771A (en) * | 2020-04-20 | 2020-08-07 | 上海国际旅行卫生保健中心(上海海关口岸门诊部) | Primer group and kit for detecting novel coronavirus SARS-CoV-2 |
| CN111733295A (en) * | 2020-07-31 | 2020-10-02 | 广州领上源生物科技有限公司 | Primer group and kit for detecting novel coronavirus |
| CN112210623A (en) * | 2020-09-10 | 2021-01-12 | 合肥金域医学检验实验室有限公司 | Quality control system for rapidly screening SARS-CoV-2 virus nucleic acid |
| CN113493856A (en) * | 2020-04-02 | 2021-10-12 | 宁波海尔施基因科技有限公司 | Multiple RT-PCR kit, method and primer group for coronavirus detection and typing |
| US11214843B2 (en) | 2020-02-18 | 2022-01-04 | Life Technologies Corporation | Compositions, kits and methods for detection of viral sequences |
-
2020
- 2020-03-31 CN CN202010245062.4A patent/CN111206121A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| DANIEL K W CHU等: "Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia", 《CLINICAL CHEMISTRY》 * |
| VICTOR M CORMAN等: "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR", 《EUROSURVEILLANCE》 * |
| WEILIE CHEN等: "Detectable 2019-nCoV viral RNA in blood is a strong indicator for the further clinical severity", 《EMERGING MICROBES & INFECTIONS 》 * |
| WENDONG HAO等: "Clinical diagnostic value of CT imaging in COVID-19 with multiple negative RT-PCR testing", 《TRAVEL MED INFECT DIS》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11214843B2 (en) | 2020-02-18 | 2022-01-04 | Life Technologies Corporation | Compositions, kits and methods for detection of viral sequences |
| US12065707B2 (en) | 2020-02-18 | 2024-08-20 | Life Technologies Corporation | Compositions, kits and methods for detection of viral sequences |
| CN113493856A (en) * | 2020-04-02 | 2021-10-12 | 宁波海尔施基因科技有限公司 | Multiple RT-PCR kit, method and primer group for coronavirus detection and typing |
| CN113493856B (en) * | 2020-04-02 | 2024-04-16 | 宁波海尔施基因科技股份有限公司 | Multiplex RT-PCR kit, method and primer set for coronavirus detection typing |
| CN111500771A (en) * | 2020-04-20 | 2020-08-07 | 上海国际旅行卫生保健中心(上海海关口岸门诊部) | Primer group and kit for detecting novel coronavirus SARS-CoV-2 |
| CN111500771B (en) * | 2020-04-20 | 2021-03-23 | 上海国际旅行卫生保健中心(上海海关口岸门诊部) | Primer group and kit for detecting novel coronavirus SARS-CoV-2 |
| CN111733295A (en) * | 2020-07-31 | 2020-10-02 | 广州领上源生物科技有限公司 | Primer group and kit for detecting novel coronavirus |
| CN112210623A (en) * | 2020-09-10 | 2021-01-12 | 合肥金域医学检验实验室有限公司 | Quality control system for rapidly screening SARS-CoV-2 virus nucleic acid |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110468237B (en) | Primer probe mixed solution and kit for detecting middle east respiratory syndrome coronavirus | |
| CN111206121A (en) | Kit for detecting novel coronavirus orflab and S genes | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110273027B (en) | Nucleic acid typing detection kit and detection method for norovirus GII, GII and GIV | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN112553373A (en) | Kit and detection method for quickly detecting novel coronavirus 2019-nCoV nucleic acid | |
| CN107245531B (en) | Diarrhea pathogen multiple gene detection system and kit and application thereof | |
| CN113943836B (en) | Compositions, kits, methods and uses for detecting pathogens causing respiratory tract infections and identifying pathogen species | |
| CN114107574A (en) | Kit and method for detecting novel coronavirus and Omicron mutant strain thereof | |
| CN112011650B (en) | Chinese bee sacbrood virus RT-RPA detection primer, probe and kit | |
| CN110714098A (en) | Composition and kit for detecting feline calicivirus and feline infectious peritonitis virus and application of composition and kit | |
| CN112176109A (en) | Influenza A and B virus nucleic acid detection kit and use method thereof | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN107083446B (en) | Diarrhea pathogenic bacteria multiple gene detection system and kit and application thereof | |
| CN102251061A (en) | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN112226539A (en) | Norovirus nucleic acid detection kit | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN115261511A (en) | Composition, kit, method and use for detecting SARS-CoV-2 | |
| CN111549175B (en) | Novel multi-fluorescence RT-PCR detection reagent for detecting port input 2019 coronavirus | |
| CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
| CN113122660A (en) | Primer probe combination and kit for detecting pathogen nucleic acid of human herpesvirus and application of primer probe combination and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200529 |
|
| RJ01 | Rejection of invention patent application after publication |