RU2727054C1 - Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction - Google Patents
Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction Download PDFInfo
- Publication number
- RU2727054C1 RU2727054C1 RU2020116322A RU2020116322A RU2727054C1 RU 2727054 C1 RU2727054 C1 RU 2727054C1 RU 2020116322 A RU2020116322 A RU 2020116322A RU 2020116322 A RU2020116322 A RU 2020116322A RU 2727054 C1 RU2727054 C1 RU 2727054C1
- Authority
- RU
- Russia
- Prior art keywords
- seq
- cov
- sars
- length
- primers
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
Description
Изобретение относится к биотехнологии, а именно к способу выявления кДНК вируса SARS-CoV-2 и может найти применение в медицине при лабораторной диагностике COVID-19. Вирус SARS-CoV-2 относится к группе коронавирусов и является возбудителем потенциально тяжелой острой респираторной инфекции COVID-19. Для лабораторной диагностики COVID-19 может быть использован иммунологический способ, основанный на выявлении антител к вирусу, описанный в статье [Li Z. et al. Development and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis // Journal of Medical Virology. - 2020.]. Способ обладает высокой специфичностью, но синтез антител в организме отстает от размножения вирусов, что часто не позволяет своевременно выявить заболевание. Другим надежным способом выявления вируса является способ секвенирования нового поколения (next generation sequencing, NGS), описанный в статье [Nasir J. A. et al. Rapid Design of a Bait Capture Platform for Culture-and Amplification-Free Next-Generation Sequencing of SARS-CoV-2. - 2020.]. Способ надежен, но приборы для его осуществления недостаточно распространены, что в условиях эпидемии делает его малоприменимым. Наиболее распространенным и удобным способом лабораторной диагностики COVID-19 является выявление кДНК вируса SARS-CoV-2 при помощи набора синтетических олигонуклеотидных праймеров и реакции ПЦР в реальном времени. Этот способ рекомендован центром по контролю и профилактике заболеваний США (CDC) и представлен на их сайте [https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-detection-instructions.html]. Именно его мы выбрали в качестве прототипа.The invention relates to biotechnology, namely to a method for detecting cDNA of the SARS-CoV-2 virus and can be used in medicine for laboratory diagnosis of COVID-19. The SARS-CoV-2 virus belongs to the group of coronaviruses and is the causative agent of the potentially severe acute respiratory infection COVID-19. For laboratory diagnosis of COVID-19, an immunological method based on the detection of antibodies to the virus, described in the article [Li Z. et al. Development and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis // Journal of Medical Virology. - 2020.]. The method has a high specificity, but the synthesis of antibodies in the body lags behind the multiplication of viruses, which often does not allow timely detection of the disease. Another reliable way to detect the virus is the next generation sequencing (NGS) method described in the article [Nasir J. A. et al. Rapid Design of a Bait Capture Platform for Culture-and Amplification-Free Next-Generation Sequencing of SARS-CoV-2. - 2020.]. The method is reliable, but the devices for its implementation are not widespread enough, which makes it of little use in an epidemic. The most common and convenient method for laboratory diagnosis of COVID-19 is the detection of SARS-CoV-2 virus cDNA using a set of synthetic oligonucleotide primers and a real-time PCR reaction. This method is recommended by the US Centers for Disease Control and Prevention (CDC) and is presented on their website [https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-detection-instructions.html]. We chose him as a prototype.
Способ предусматривает, что предварительно из образца биоматериала выделена тотальная РНК одним из рекомендованных наборов реактивов. Затем, с помощью рекомендованных китов, осуществляется синтез первой цепи кДНК методом обратной транскрипции. Непосредственное выявление кДНК вируса SARS-CoV-2 проводят с использованием набора синтетических праймеров и флуоресцентных зондов в реакции ПЦР в реальном времени. Способ позволяет быстро, в течение часа-полутора получить результат. При осуществлении способа ставятся положительный и отрицательный контроли, что позволяет снизить вероятность получения ложноположительного и ложноотрицательного результатов.The method provides that the total RNA is preliminarily isolated from the biomaterial sample with one of the recommended reagent kits. Then, using the recommended whales, the first strand of cDNA is synthesized by reverse transcription. Direct detection of SARS-CoV-2 virus cDNA is carried out using a set of synthetic primers and fluorescent probes in a real-time PCR reaction. The method allows you to quickly, within an hour and a half to get the result. When implementing the method, positive and negative controls are set, which reduces the likelihood of obtaining false positive and false negative results.
Способ заключается в следующем. Используют набор синтетических олигонуклеотидных праймеров и зондов следующего состава, указанного в Табл. 1.The method is as follows. Use a set of synthetic oligonucleotide primers and probes of the following composition, indicated in Table. 1.
Праймеры гомологичны трем локусам гена N вируса SARS-CoV-2, а также гену рибонуклеазы человека. Меченые зонды служат для регистрации реакции TaqMan ПЦР в реальном времени. Ставят пробы, в число которых входят исследуемый образец, отрицательный контроль (без наличия ДНК), положительный контроль (содержащий кДНК вируса) с ожидаемым значением порогового цикла. С пробами проводят реакцию ПЦР в реальном времени. О наличии вируса SARS-CoV-2 в исследуемой пробе судят по следующим критериям. Кривая амплификации с праймерами на рибонуклеазу человека в исследуемой пробе и положительном контроле должна пересекать пороговую линию до 35-го цикла, все отрицательные контроли со всеми праймерами не должны пересекать пороговую линию, положительный контроль и исследуемая проба с праймерами на гены вируса должны пересекать пороговую линию на ожидаемом цикле.The primers are homologous to three loci of the SARS-CoV-2 virus N gene and to the human ribonuclease gene. Labeled probes are used to record the TaqMan real-time PCR reaction. Samples are set, including the test sample, negative control (without the presence of DNA), positive control (containing viral cDNA) with the expected value of the threshold cycle. The samples are subjected to a real-time PCR reaction. The presence of the SARS-CoV-2 virus in the test sample is judged by the following criteria. The amplification curve with primers for human ribonuclease in the test sample and positive control should cross the threshold line before the 35th cycle, all negative controls with all primers should not cross the threshold line, the positive control and the test sample with primers for virus genes should cross the threshold line by expected cycle.
Этот способ быстрый (до 2-х часов) и производителен. Однако, на наш взгляд, обладает рядом недостатков. Праймеры на целевую молекулы сконструированы на один ген. Из-за склонности вируса к мутированию это может угрожать надежности способа. Размеры ампликонов в прототипе 71 п.н., 66 п.н. и 71 п.н. Их размер не дает возможности различать их по подвижности во время электрофореза в 1-1,5% агарозном геле. Впрочем, метод ПЦР в реальном времени, для которого был осуществлен дизайн праймеров и не рассчитан на определения размеров ПЦР-продукта. Он предназначен для определения числа копий целевой молекулы. Но для цели качественного выявления вируса в биологическом материале использование прибора для проведения ПЦР в реальном времени нам представляется избыточным. Достаточно более распространенных и менее требовательных простых термоциклеров. В условиях пандемии это может стать важным для масштабных анализов при лечебных и карантинных мероприятиях.This method is fast (up to 2 hours) and efficient. However, in our opinion, it has a number of disadvantages. Primers for the target molecule are designed for one gene. Due to the tendency of the virus to mutate, this can threaten the reliability of the method. The sizes of the amplicons in the prototype are 71 bp, 66 bp. and 71 bp. Their size makes it impossible to distinguish them by their mobility during electrophoresis in 1-1.5% agarose gel. However, the real-time PCR method, for which the primer design was carried out and was not designed to determine the size of the PCR product. It is designed to determine the copy number of a target molecule. But for the purpose of qualitative detection of the virus in biological material, the use of a real-time PCR device seems to us excessive. The more common and less demanding simple thermal cyclers are sufficient. In a pandemic, this can become important for large-scale analyzes during treatment and quarantine measures.
Задача нашего изобретения - сделать способ более доступным и точным. Поставленная цель достигается тем, что мы предлагаем использовать синтетические олигонуклеотидные праймеры следующих последовательностей:The aim of our invention is to make the method more accessible and accurate. This goal is achieved by the fact that we propose to use synthetic oligonucleotide primers of the following sequences:
SEQ ID NO: 1-5' cagtctgtaccgtctgcgg 3',SEQ ID NO: 1-5 'cagtctgtaccgtctgcgg 3',
SEQ ID NO: 2-5' cagtactagtgcctgtgccg 3'SEQ ID NO: 2-5 'cagtactagtgcctgtgccg 3'
SEQ ID NO: 3-5' ggtggaccctcagattcaactgg 3',SEQ ID NO: 3-5 'ggtggaccctcagattcaactgg 3',
SEQ ID NO: 4-5' ttttaccgtcaccaccacgaa 3'SEQ ID NO: 4-5 'ttttaccgtcaccaccacgaa 3'
SEQ ID NO: 5-5' cgcattggcatggaagtcac 3',SEQ ID NO: 5-5 'cgcattggcatggaagtcac 3',
SEQ ID NO: 6-5' tgtctctgcggtaaggcttg 3'.SEQ ID NO: 6-5 'tgtctctgcggtaaggcttg 3'.
Мы подобрали праймеры таким образом, чтобы реакция ПЦР могла быть осуществлена в простом термоциклере, а результат мог оценивается при проведении электрофоретического разделения ампликонов. Размер полученных ампликонов (158 п.н., 250 п.н. и 203 п.н.) дает четкие, хорошо различаемые по подвижности полосы на электрофореграмме, позволяет легко осуществлять фотодокументацию результатов. Размеры ампликонов позволяют надежно и специфично выявлять кДНК коронавируса SARS-CoV-2. Две пары праймеров (SEQ ID NO: 3 и SEQ ID NO: 4), (SEQ ID NO: 5 и SEQ ID NO: 6) отжигаются на гене N, а одна пара (SEQ ID NO: 1 и SEQ ID NO: 2) - на гене orf1ab. Для контроля на качество исследуемого материала мы используем праймеры к гену GAPDH человека (прямой - 5'-AGATCCCTCCAAAATCAAGTGG-3', обратный - 5'-GGCAGAGATGATGACCCTTTT-3'), с длиной ампликона 130 п.н. Этот ген обладает высокой экспрессией и часто используется для нормализации результатов по определению уровней транскрипции.We selected primers in such a way that the PCR reaction could be carried out in a simple thermal cycler, and the result could be assessed by electrophoretic separation of amplicons. The size of the obtained amplicons (158 bp, 250 bp and 203 bp) gives clear bands on the electrophoretogram that are well distinguishable by mobility, and makes it easy to document the results. The sizes of the amplicons allow for the reliable and specific detection of the cDNA of the SARS-CoV-2 coronavirus. Two pairs of primers (SEQ ID NO: 3 and SEQ ID NO: 4), (SEQ ID NO: 5 and SEQ ID NO: 6) are annealed on the N gene, and one pair (SEQ ID NO: 1 and SEQ ID NO: 2 ) - on the orf1ab gene. To control the quality of the test material, we use primers for the human GAPDH gene (forward - 5'-AGATCCCTCCAAAATCAAGTGG-3 ', reverse - 5'-GGCAGAGATGATGACCCTTTT-3'), with an amplicon length of 130 bp. This gene is highly expressed and is often used to normalize the results of determining the levels of transcription.
Заявленный способ реализуется следующим образом. Материалом исследования служит кДНК, полученная предварительно из биологического материала пациента путем выделения тотальной РНК и проведения реакции обратной транскрипции известными наборами реактивов. Олигонуклеотидные праймеры подобраны таким образом, чтобы отжиг мог быть осуществлен при 60°С, два ампликона синтезировались на гене N, а один -на гене orf1ab, длина ПЦР-продуктов находилась в диапазоне 150-250 п.н. В результате мы подобрали следующие олигонуклеотидные праймеры (Табл. 2).The claimed method is implemented as follows. The material for the study is cDNA obtained previously from the patient's biological material by isolating total RNA and carrying out a reverse transcription reaction using known sets of reagents. Oligonucleotide primers were selected so that annealing could be carried out at 60 ° C, two amplicons were synthesized on the N gene, and one on the orf1ab gene, the length of the PCR products was in the range 150-250 bp. As a result, we selected the following oligonucleotide primers (Table 2).
Каждый исследуемый образец кДНК амплифицируют с каждой из трех пар праймеров. Кроме того, каждый образец амплифицируют с парой праймеров на ген GAPDH человека для того, чтобы убедиться в корректном выделении РНК из биологического материала и проведении реакции обратной транскрипции. Это позволит избежать ложноотрицательного результата. К каждой паре праймеров ставят отрицательный контроль, без матрицы, для исключения ложноположительных результатов за счет контаминации реактивов. После проведения ПЦР образцы наносят в 1,5% агарозный гель и проводят электрофорез в присутствии бромистого этидия. Позитивный результат выявления кДНК вируса SARS-CoV-2 следует, если амплификация исследуемого образца кДНК с парами праймеров (SEQ ID NO: 1 и SEQ ID NO: 2), (SEQ ID NO: 3 и SEQ ID NO: 4), (SEQ ID NO: 5 и SEQ ID NO: 6) приводит к синтезу ПЦР-продуктов длиной 158, 250 и 203 п.н. соответственно. При этом в пробах отрицательных контролей должны отсутствовать ПЦР-продукты этих размеров. Отрицательный результат выявления кДНК вируса SARS-CoV-2 следует, если амплификация исследуемого образца кДНК с парами праймеров (SEQ ID NO: 1 и SEQ ID NO: 2), (SEQ ID NO: 3 и SEQ ID NO: 4), (SEQ ID NO: 5 и SEQ ID NO: 6) не приводит к синтезу ПЦР-продуктов длиной 158, 250 и 203 п.н. соответственно. При этом в пробе с праймерами на ген GAPDH человека должен амплифицироваться ПЦР-продукт соответствующей длины.Each test cDNA sample is amplified with each of the three primer pairs. In addition, each sample is amplified with a pair of primers for the human GAPDH gene in order to ensure the correct isolation of RNA from the biological material and the reverse transcription reaction. This will avoid false negative results. A negative control, without a template, is placed for each pair of primers to exclude false positive results due to contamination of the reagents. After PCR, the samples are applied in 1.5% agarose gel and electrophoresis is performed in the presence of ethidium bromide. A positive result of the SARS-CoV-2 virus cDNA detection follows if the amplification of the cDNA sample under study with primer pairs (SEQ ID NO: 1 and SEQ ID NO: 2), (SEQ ID NO: 3 and SEQ ID NO: 4), (SEQ ID NO: 5 and SEQ ID NO: 6) leads to the synthesis of PCR products 158, 250 and 203 bp in length. respectively. At the same time, the samples of negative controls should not contain PCR products of these sizes. A negative result of SARS-CoV-2 cDNA detection follows if amplification of the cDNA sample under study with primer pairs (SEQ ID NO: 1 and SEQ ID NO: 2), (SEQ ID NO: 3 and SEQ ID NO: 4), (SEQ ID NO: 5 and SEQ ID NO: 6) does not lead to the synthesis of PCR products 158, 250 and 203 bp in length. respectively. In this case, in a sample with primers for the human GAPDH gene, a PCR product of the corresponding length should be amplified.
Изобретение иллюстрируется следующими примерами конкретного выполнения способа.The invention is illustrated by the following examples of specific implementation of the method.
Пример 1.Example 1.
У больной П. из цельной крови была выделена тотальная РНК. После проведения реакции обратной транскрипции образец направлен для выявления кДНК вируса SARS-CoV-2. От момента завершения синтеза первой цепи кДНК до постановки реакции ПЦР образец хранили на льду.Patient P. had total RNA isolated from whole blood. After the reverse transcription reaction, the sample is sent to detect the cDNA of the SARS-CoV-2 virus. From the moment the synthesis of the first strand of cDNA was completed until the PCR reaction was initiated, the sample was stored on ice.
Поставили полимеразную цепную реакцию в пробах следующего состава (Табл. 3).Set the polymerase chain reaction in the samples of the following composition (Table 3).
Режим амплификации: 95°С - 5 мин, (95°С - 10 сек, 60°С - 30 сек) х 40, 72°С - 10 мин. После амплификации образцы в объеме 5 мкл нанесли в лунки 1,5% агарозного геля с бромидом этидия и провели электрофорез. Схема нанесения образцов в лунки геля приведена в таблице 4.Amplification mode: 95 ° С - 5 min, (95 ° С - 10 sec, 60 ° С - 30 sec) x 40, 72 ° С - 10 min. After amplification, samples in a volume of 5 μl were applied to the wells of 1.5% agarose gel with ethidium bromide and electrophoresis was performed. The scheme for applying samples to the wells of the gel is shown in Table 4.
По окончании электрофореза гель поместили в трансиллюминатор и сфотографировали.At the end of electrophoresis, the gel was placed in a transilluminator and photographed.
На электрофореграмме (Фиг. 1) мы наблюдали наличие ПЦР-продуктов соответствующих длин в лунках 1, 3, 5, 7. И одновременно отсутствие ПЦР-продуктов в лунках с отрицательным контролем - 2, 4, 6 и 8. На основании этого мы сделали вывод о наличии в организме П. коронавируса SARS-CoV-2. В дальнейшем на основании клинических и лабораторных показателей П. был поставлен диагноз COVID-19.On the electrophoretogram (Fig. 1), we observed the presence of PCR products of the corresponding lengths in
Пример 2. У пациента С. с симптомами ОРЗ и находящегося в карантине взят образец эпителия мазком из ротоглотки. Из биоматериала была выделена тотальная РНК. После проведения реакции обратной транскрипции образец направлен для выявления кДНК вируса SARS-CoV-2. Провели полимеразную цепную реакцию, электрофорез образцов и фотографирование геля, как описано в примере 1.Example 2. Patient S. with symptoms of acute respiratory infections and being in quarantine took a sample of the epithelium with a swab from the oropharynx. Total RNA was isolated from the biomaterial. After the reverse transcription reaction, the sample is sent to detect the cDNA of the SARS-CoV-2 virus. Conducted polymerase chain reaction, electrophoresis of the samples and photographing the gel, as described in example 1.
На электрофореграмме (Фиг. 2) мы не наблюдали амплификации фрагментов целевой молекулы. Тем не менее праймеры на ген GAPDH человека дали ПЦР-продукт соответствующей длины. Это значит, что процедуры выделения РНК из биоматериала и синтеза кДНК проведены корректно, но вируса SARS-CoV-2 в биоматериале не выявлено. Впоследствии С. был отпущен из карантина, у него на обнаружен COVID-19.On the electrophoretogram (Fig. 2), we did not observe the amplification of fragments of the target molecule. Nevertheless, primers for the human GAPDH gene produced a PCR product of the appropriate length. This means that the procedures for the isolation of RNA from the biomaterial and the synthesis of cDNA were carried out correctly, but the SARS-CoV-2 virus was not detected in the biomaterial. Subsequently, S. was released from quarantine, and he was diagnosed with COVID-19.
Таким образом, способ позволяет выявлять и идентифицировать наличие вируса SARS-CoV-2 в биологическом материале по наличию и длине ампликонов.Thus, the method makes it possible to detect and identify the presence of the SARS-CoV-2 virus in biological material by the presence and length of amplicons.
--->--->
Перечень последовательностейSequence listing
<---<---
Claims (8)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020116322A RU2727054C1 (en) | 2020-04-24 | 2020-04-24 | Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020116322A RU2727054C1 (en) | 2020-04-24 | 2020-04-24 | Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2727054C1 true RU2727054C1 (en) | 2020-07-17 |
Family
ID=71616757
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2020116322A RU2727054C1 (en) | 2020-04-24 | 2020-04-24 | Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2727054C1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733295A (en) * | 2020-07-31 | 2020-10-02 | 广州领上源生物科技有限公司 | Primer group and kit for detecting novel coronavirus |
| CN112111602A (en) * | 2020-08-13 | 2020-12-22 | 安徽微分基因科技有限公司 | Kit and method for detecting COVID-19 virus by combination of nested isothermal amplification and gene editing |
| RU2762759C1 (en) * | 2021-06-30 | 2021-12-22 | Федеральное бюджетное учреждение науки «Центральный научно-исследовательский институт эпидемиологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора) | METHOD FOR SAMPLE PREPARATION OF SARS-CoV-2 CORONAVIRUS ISOLATES AND OLIGONUCLEOTIDE PRIMERS FOR ITS IMPLEMENTATION |
| WO2022029157A3 (en) * | 2020-08-06 | 2022-06-09 | F. Hoffmann-La Roche Ag | Compositions and methods for the detection of severe acute respiratory syndrome coronavirus 2 (sars-2), influenza a, and influenza b |
| RU2795939C2 (en) * | 2022-08-12 | 2023-05-15 | Закрытое Акционерное Общество (ЗАО) "ЭКОлаб" | Reagent kit for detection of sars-cov-2 virus rna by real-timr polymerase chain reaction |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2504585C1 (en) * | 2012-10-22 | 2014-01-20 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Set of oligodesoxyribonycleotide primers and fluorescent-marked probe for identification of rna of human coronavirus associated with severe sharp respiratory syndrome |
| CN105018644B (en) * | 2015-07-17 | 2018-05-29 | 江苏省疾病预防控制中心 | A kind of respiratory pathogen detection kit |
| RU2670148C2 (en) * | 2013-02-14 | 2018-10-18 | Дзе Риджентс Оф Дзе Юниверсити Оф Колорадо | Methods for predicting risk of interstitial pneumonia |
-
2020
- 2020-04-24 RU RU2020116322A patent/RU2727054C1/en active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2504585C1 (en) * | 2012-10-22 | 2014-01-20 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Set of oligodesoxyribonycleotide primers and fluorescent-marked probe for identification of rna of human coronavirus associated with severe sharp respiratory syndrome |
| RU2670148C2 (en) * | 2013-02-14 | 2018-10-18 | Дзе Риджентс Оф Дзе Юниверсити Оф Колорадо | Methods for predicting risk of interstitial pneumonia |
| CN105018644B (en) * | 2015-07-17 | 2018-05-29 | 江苏省疾病预防控制中心 | A kind of respiratory pathogen detection kit |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733295A (en) * | 2020-07-31 | 2020-10-02 | 广州领上源生物科技有限公司 | Primer group and kit for detecting novel coronavirus |
| WO2022029157A3 (en) * | 2020-08-06 | 2022-06-09 | F. Hoffmann-La Roche Ag | Compositions and methods for the detection of severe acute respiratory syndrome coronavirus 2 (sars-2), influenza a, and influenza b |
| CN112111602A (en) * | 2020-08-13 | 2020-12-22 | 安徽微分基因科技有限公司 | Kit and method for detecting COVID-19 virus by combination of nested isothermal amplification and gene editing |
| RU2762759C1 (en) * | 2021-06-30 | 2021-12-22 | Федеральное бюджетное учреждение науки «Центральный научно-исследовательский институт эпидемиологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора) | METHOD FOR SAMPLE PREPARATION OF SARS-CoV-2 CORONAVIRUS ISOLATES AND OLIGONUCLEOTIDE PRIMERS FOR ITS IMPLEMENTATION |
| RU2795939C2 (en) * | 2022-08-12 | 2023-05-15 | Закрытое Акционерное Общество (ЗАО) "ЭКОлаб" | Reagent kit for detection of sars-cov-2 virus rna by real-timr polymerase chain reaction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2727054C1 (en) | Method for detecting cdna of sars-cov-2 coronavirus using synthetic oligonucleotide primers in polymerase chain reaction | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| US11149322B2 (en) | Methods and compositions for human papillomaviruses and sexually transmitted infections detection, identification and quantification | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| AU2020343336A1 (en) | Systems, methods, and compositions for the rapid early-detection of host RNA biomarkers of infection and early identification of COVID-19 coronavirus infection in humans | |
| Mota et al. | Recombinase polymerase amplification in the molecular diagnosis of microbiological targets and its applications | |
| CN110438260B (en) | African swine fever virus nucleic acid test strip detection kit | |
| WO2013189306A1 (en) | Methods and compositions for assessing copy number of target polynecleotides | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN109762910B (en) | Primer and kit for simultaneously detecting two types of echinococcosis | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| WO2022013761A1 (en) | System and method for screening patients infected with severe acute respiratory syndrome coronavirus 2 | |
| RU2644233C2 (en) | Method for leukosis diagnosis in cattle | |
| KR101196930B1 (en) | Primer and probe for detection of human papilloma virus and method for detecting human papilloma virus using the same | |
| KR101768955B1 (en) | Primer set for diagnosing Ebola virus and uses thereof | |
| RU2795939C2 (en) | Reagent kit for detection of sars-cov-2 virus rna by real-timr polymerase chain reaction | |
| RU2700254C1 (en) | Test system for detecting dna of rhinotracheitis virus (bovine herpes virus 1, bohv-1) in cattle | |
| RU2726432C1 (en) | Test system for determining dna of nodular dermatitis virus (lsdv) in biological material of animals by pcr with electrophoretic detection of amplification products in agarose gel | |
| RU2762759C1 (en) | METHOD FOR SAMPLE PREPARATION OF SARS-CoV-2 CORONAVIRUS ISOLATES AND OLIGONUCLEOTIDE PRIMERS FOR ITS IMPLEMENTATION | |
| CN114085929B (en) | Kit for detecting African swine fever virus wild strain and vaccine strain | |
| CN113637774B (en) | Amplification primer for detecting echinococcosis by ddPCR (polymerase chain reaction), and construction method and application thereof | |
| RU2700450C1 (en) | Test system for detecting provirus dna of bovine leukosis virus (blv) | |
| RU2700449C1 (en) | Method for detecting dna of rhinotracheitis virus (bovine herpes virus 1, bohv-1) in cattle | |
| RU2778855C1 (en) | Set of oligonucleotide primers and fluorescently labeled probes for the identification of human coronavirus sars-cov-2 rna by isothermal pcr with real-time hybridization-fluorescence detection | |
| RU2731716C1 (en) | Kit for differentiating cattle pestiviruses and method for differentiating cattle pestiviruses |