RU2741887C1 - Test system for genome detection of a coronavirus infection agent of new type (ncov19) in primates - Google Patents

Abstract

FIELD: virology.

SUBSTANCE: invention refers to veterinary virology, namely to means of diagnosing coronavirus infection in primates. Described is a test system for detecting the novel genome of coronavirus infection (nCov19) in primates using a multiplexed polymerase chain reaction with real-time fluorescence detection, including a buffer for polymerase chain reaction. Test system is a mixture consisting of deoxynucleoside triphosphates, primers and fluorescent probes specific for coronavirus and for an internal control sample in form of suspension of bacteriophage MS2 with concentration of 5×10³ copies of nucleotide sequences per 1 mcl; mixture of enzymes from DNA polymerase with antibodies inhibiting enzyme activity, TAQ POLYMERASE and reverse transcriptase MMLV REVERSE TRANSCRIPTASE; a buffer for diluting RNA in the form of deionized water, an internal control sample, a negative control sample, positive control sample in form of a mixture of recombinant plasmid DNA containing a coronavirus infection genome fragment and a bacteriophage MS2 genome fragment taken in ratio 1:1, according to the invention, the mixture of recombinant plasmid DNA contains a fragment of the coronavirus infection genome of a new type (nCov19) and a fragment of the bacteriophage MS2 genome with the following nucleotide sequences: nCoV19-F 5’- GGAACTTCTCCTGCTAGA 3’ - forward primer, nCoV19-R 5’- GCTGGTTCAATCTGTCAA -3’ - reverse primer, nCoV19-P 5’-ROX- AAGCAAGAGCAGCATCACCGC -3’ -BHQ2 - probe, MS2F, 5’-TGGCACTACCCCTCTCCGTATTCAC-3’ - forward primer, MS2R, 5’-GTACGGGCGACCCCACGATGAC-3’ - reverse primer, MS2P, Cy5 5’-CACATCGATAGATCAAGGTGCCTACAAGC-3’-BHQ2 - probe.

EFFECT: invention broadens functional capabilities and reliability of diagnosis by RT-PCR in real time.

1 cl, 4 tbl

Description

The invention relates to veterinary virology, namely to diagnostic tools for coronavirus infection in primates, both in the practice of the veterinary service and for scientific research.

Known studies of coronavirus infection of monkeys (dissertation and abstract "Coronavirus infection of monkeys" according to the Higher Attestation Commission of the Russian Federation 03.00.06, Candidate of Biological Sciences Goncharuk, Elena Ivanovna 1991 https://www.dissercat.com/content/koronavirusnaya-infektsiya-obezyan.

Monkeys, like animals, are the closest relatives of people and with their help unique opportunities are presented in the study of human pathology. Many researchers have convincingly proved that monkeys hardly differ from humans in their sensitivity to viruses. Moreover, they are the only animals in which infections proceed with the same manifestations as in humans. Diagnosis of coronavirus infection in primates was carried out using electron microscopy and ELISA, using the latter method, the antigenic relationship of isolates with human coronavirus was proved.

During the research, a high infection rate was established in monkeys of different species, age and sex. Most often, viruses were found in the intestines, pancreas, lungs, and less often in other organs. In addition, spontaneous coronavirus infection of monkeys is persistent, occurring with respiratory and / or gastrointestinal tract damage, accompanied by periodic exacerbations, during which clinical manifestations of enterocolitis and / or pneumonia are observed. The death of animals occurs mainly from associated diseases, more often of a bacterial nature.

For research, virological methods were used, the main method for detecting the studied viruses is electron microscopic (EM), namely negative contrasting. Were also used immunological methods.

The disadvantage of the known technical solution is the insufficiently reliable diagnosis of coronavirus infection in primates.

Known methods for diagnosing pathogens of human or monkey infection and a kit for its implementation (RF patents, No. 2385945, 2385946, CL C12Q 1/68, 2010) in which kits for PCR diagnostics of pathogens of human or monkey infection are used, characterized by the fact that it contains primers, a thermostable enzyme Tag-polymerase, a buffer for setting up the reaction, a mixture of four deoxynucleotide triphosphates, a positive control, a negative control, wax and oil for PCR.

A common disadvantage of the known technical solutions is the lack of the possibility of diagnosing coronavirus infection in primates.

The closest in technical essence is a test system (RF patent No. 2694499, C12Q 1/68, 2019 - prototype) for detecting the genome of the causative agent of coronavirus infection in animals using multiplex polymerase chain reaction (PCR) with real-time fluorescence detection, which includes a buffer for PCR, a mixture for its implementation, consisting of deoxynucleoside triphosphates, primers and fluorescent probes specific for coronavirus and for an internal control sample; a mixture of enzymes from DNA polymerase with antibodies that inhibit the activity of the enzyme, TAQ POLYMERASE and MMLV REVERSE TRANSCRIPTASE reverse transcriptase. A mixture of recombinant plasmid DNA contains fragments of the coronavirus genome and a fragment of the genome of bacteriophage MS2.

The disadvantage of the known technical solution is the inability to obtain a reliable diagnosis of coronavirus infection in primates.

The technical result is to expand the functionality and obtain reliable diagnostics using RT - PCR in real time.

The technical result is achieved by the fact that in a test system for detecting the genome of the causative agent of a new type of coronavirus infection (nCov19) in primates using multiplex polymerase chain reaction with fluorescence detection in real time, including a buffer for carrying out the polymerase chain reaction, a mixture for its implementation, consisting of deoxynucleoside triphosphates, primers and fluorescent probes specific for coronavirus and for an internal control sample in the form of a suspension of bacteriophage MS2 with a concentration of 5 × 10 copies of nucleotide sequences per 1 μl; a mixture of enzymes from DNA polymerase with antibodies that inhibit the activity of the enzyme, TAQ POLYMERASE and MMLV REVERSE TRANSCRIPTASE reverse transcriptase; buffer for RNA dilution in the form of deionized water, internal control sample, negative control sample, positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the genome of coronavirus infection and a fragment of the genome of bacteriophage MS2, taken in a 1: 1 ratio, according to the invention, a mixture of recombinant plasmid DNA contains a fragment of the genome of a new type of coronavirus infection (nCov19) and a fragment of the genome of bacteriophage MS2 with the following nucleotide sequences:

- прямой праймер,

- direct primer,

- обратный праймер,

- reverse primer,

- зонд,

- probe,

- прямой праймер,

- direct primer,

- обратный праймер,

- reverse primer,

- зонд.

- probe.

The novelty of the proposed technical solution lies in the fact that in order to obtain a reliable diagnosis of a new type of coronavirus infection nCoV19 in primates, a test system is used using oligonucleotide primers of a fluorescently labeled probe, specific for a region of the genome of the nCoV19 genome, and different types of control for which various forms of material of the bacteriophage MS2 with a new nucleotide sequence, this is due to the fact that these nucleotide sequences are better combined with primers on nCoV19 and provide reliable diagnostics.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The claimed test system is recommended to be used in veterinary virology, namely, as a means of diagnosing a new type of coronavirus infection nCoV19 in primates, both in the practice of the veterinary service and for scientific research, which meets the criterion of "industrial applicability".

The use of the claimed nCoV19F and nCoV19R oligonucleotide primers of the nCoV19P fluorescently labeled probe provides specific detection of coronavirus RNA in primates.

The use of different types of control, for which different forms of the material of the bacteriophage MS2 are used: a suspension and a fragment of the genome with specific primers and a probe, of the bacteriophage MS2 is due to the fact that this allows you to control the correct progress of the reaction in each tube, and also controls the stage of RNA isolation from samples ...

Primers specific for the genome of the causative agent of a new type of coronavirus infection (nCov19) were selected based on the region of the nucleotide sequence of the N gene encoding the synthesis of the protein, the nucleocapsid phosphoprotein gene of the virus, which is an essential component of the virion of SARS-like coronaviruses belonging to the genus beta -coronaviruses of the Coronaviridae family of the order Nidovirales. Like other representatives of this genus, the genome of the new type of coronavirus (nCov19) is represented by single-stranded RNA (+), about 30,000 nucleotides in size.

To select the sequence and calculate the primary structure of oligonucleotide primers and probes, a comparative analysis of the nucleotide sequences of the N gene, which encodes the synthesis of the virus structural protein, nucleocapsid phosphoprotein, available in the GenBank and GISAID electronic databases, was carried out.

Using the "BioEdit 7.0" program, the nucleotide sequences of the N gene of the genome of viruses - representatives of the genera of beta-coronaviruses (A-H species) and alpha-coronaviruses - were aligned with the sequence of the N gene of the novel coronavirus genome (nCoV19) of the Wuhan-Hu-1 isolate, ((Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome, NCBI Reference Sequence, 29.903 bp linear RNA, 28274-29533 / gene = "N" / product = "nucleocapsid phosphoprotein") (access code NC 045512.2). the constructed alignment within the gene encoding the nucleocapsid phosphoprotein of the virus, a region between 28750 and 29050 nucleotides is selected, containing unique nucleotide sequences.

The Oligo 6.0 software was used to calculate the primary structures of oligonucleotide primers flanking the selected region of the genome. For the detection of amplification products, an oligonucleotide fluorescently labeled probe nCoV19-P, complementary to the region of the nucleotide sequence, limited by the positions of annealing of the primers nCov19-F and nCoV19-R, was selected. A bright rhodamine dye-ROX (carboxy-X-rhodamine) balanced by a quencher (Quencher-BHQ-2) at the 3'-end of the nucleotide probe was used as a fluorophore at the 5'-end. Using the program "Oligo 6.0", the main properties of the calculated oligonucleotides, which determined the possibility of their use in PCR, are described.

The nucleotide sequence of bacteriophage MS2 (Enterobacteria phage MS2 isolate ST4, complete genome, access code EF204940) was analyzed using the Oligo 6.0 software. Bacteriophage MS2 contains a single-stranded positively oriented RNA 3569 bases in size. As a result of analysis of the maturation protein within the gene, a region between 200 and 350 nucleotides containing unique nucleotide sequences was selected, and the primary structures of oligonucleotide primers flanking the selected genome region were calculated. For the detection of amplification products, an oligonucleotide fluorescently labeled probe MS2P11 complementary to the region of the nucleotide sequence limited by the positions of annealing of primers MS2F11 and MS2R11 was selected. Using the program "Oligo 6.0", the main properties of the calculated oligonucleotides, which determined the possibility of their use in PCR, are described. An example of using the test system to detect the genome of the causative agent of a new type of coronavirus infection (nCov19) in primates

For the study, the following biological material is used, taken from infected primates:

- Feces weighing 5 g are collected in a sterile plastic container.

- 1 cm ³ pieces are cut out of the intestinal tissue and placed in a sterile container. Next, the test material is processed.

Intestinal tissue samples with contents (up to 1 g) are homogenized using sterile porcelain mortars and pestles, then a 10% suspension is prepared in sterile saline solution. The suspension is transferred into a 1.5 ml tube and centrifuged at 9000 rpm for 1 min. An aliquot of the supernatant (0.1 ml) is used for the RNA extraction.

A 10% suspension is prepared from feces (1-5 g) in sterile saline solution. The suspension of faeces is decanted for 5-10 minutes. Take 1 ml of the supernatant and transfer to a clean 1.5 ml tube, centrifuge at 5000 rpm in a MiniSpin centrifuge, Eppendorf, for 5 min. The extraction of RNA from the clarified fecal extract is carried out as soon as possible.

For the study of respiratory coronavirus infection, use at choice: swabs from the nose, throat, nasopharynx, nasopharyngeal aspirates, nasal washings, sputum, bronchoalveolar lavage, section material, culture fluid samples.

• Discharge from the nasopharynx and trachea, swabs from the nasal mucosa, removed using a sterile probe, the probe is placed in a 1.5 ml plastic microtube with 0.5 ml of sterile saline / phosphate buffer / transport medium.

• Pharyngeal swabs are placed in a sterile container. Washes, smears are taken for research without preliminary preparation.

Sputum, viscous in consistency, is treated with reagents such as mucolysin in order to reduce the viscosity.

The analysis is carried out using a set of reagents "PCR-CORONAVIRUS (nCoV19) - FACTOR" (Instructions for the use of "PCR-CORONAVIRUS-primates-FACTOR", a set of reagents for detecting RNA coronavirus (nCoV19) of primates in biological material by reverse transcription and polymerase chain reaction with fluorescence detection in real time (RT-PCR-RT), TU 21 10.60-133-51062356-2017, http://www.vetfaktor.ru/) which consists of three stages (see table 1 and 2):

• NK extraction;

• carrying out RT-PCR RT with fluorescence detection in real time;

• consideration of the analysis results.

The RT-PCR RT reaction is carried out in one tube. Sample preparation for PCR

The total volume of the reaction mixture is 25 μl, the volume of the RNA sample is 10 μl. The successful completion of the reaction is monitored by the use of PCO nCoV19, ICO nCoV19 and RNA buffer.

RT-PCR buffer, nCoV19 PCR buffer; composition: 2.5x PCR buffer (potassium chloride, 100 mM, Tris-HCl, pH 8.8 100 mM, glycerol 1%, Tween-20 0.02%); magnesium chloride, 5 mM; deionized water.

Mixture for PCR, PCR-mixture nCoV19 composition: equimolar mixture of deoxynucleoside triphosphates (dNTP) at a concentration of 0.25 mM; deionized water, a mixture of primers and a fluorescent probe for corona-virus (forward and reverse primers nCoV19F and nCoV19R at a concentration of 0.2 μM, probe nCoV19P-ROX at a concentration of 0.1 μM, taken in a 1: 1: 0.5 ratio), a mixture of primers and a fluorescent probe on FCC (forward and reverse primers MS2F and MS2R at a concentration of 0.2 μM, probe MS2P-Cy5 at a concentration of 0.1 μM, taken in a 1: 1: 0.5 ratio).

Enzyme mixture, RT PCR ENZ, composition: DNA polymerase with antibodies that inhibit enzyme activity, TAQ POLYMERASE (5 U / μL), MMLV REVERSE TRANSCRIPTASE reverse transcriptase (100 U / μL).

RNA dilution buffer, RNA buffer, composition: deionized water.

Internal control sample, VKO nCoV19; composition: suspension of bacteriophage MS2 (5 × 10 ³ / ml)

- Negative control sample, OKO (TE buffer); composition: TE buffer (10 mM Tris-HCl, 0.5 mM EDTA, pH 8.0)

- Positive control sample, PKO nCoV19; composition: a mixture of recombinant plasmid DNA containing a fragment of the genome of the nCoV19 virus and a fragment of the genome of the bacteriophage MS2, taken in a 1: 1 ratio.

In a separate test tube, mix the components of the kit based on each reaction:

10 μl PCR BUFFER nCoV19

5 μl PCR MIX nCoV19

0.75 μl RT PCR ENZ.

Select the required number of tubes for the amplification of the NK of the investigated and control samples. They add 15 μl of the prepared reaction mixture.

Using filter tips into prepared tubes add:

a) in a tube of negative control PCR (K-) 10 μl of RNA buffer;

b) in a number of test tubes for investigated samples - add 10 μl of NK of the corresponding sample, including sample VK-) to each;

c) in a test tube with a positive control PCR (K +) 10 μl of PCR nCoV19.

Carrying out RT-PCR reaction with fluorescence detection

The parameters of the temperature-time mode of amplification on the "Rotor-Gene Q", "DT-96" and "CFX96" devices are shown in Table 3.

Place the tubes prepared for PCR into the wells of the thermocycler.

Interpreting Analysis Results

Obtained data - fluorescent signal accumulation curves are analyzed using the software of the used device for carrying out PCR in "real time" mode in accordance with the manufacturer's instructions for the device.

The results of RT-PCR were taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the value of the threshold cycle "Ct> for the sample under study).

The result is considered reliable if the positive and negative controls for amplification and extraction of NA were correctly passed in accordance with Table 4.

The appearance of any Ct value in the table of results for negative control of the VK- extraction stage on the ROX / Orange channel and for negative control of the K- PCR stage on any of the channels indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as to take measures to identify and eliminate the source of contamination.

Samples for which Ct value is absent or exceeds cycle 35 in the Cy5 / Red channel (while Ct value is also absent in the ROX / Orange channel) require a second study from the HHCR stage. A delay in the values of the threshold cycles for the samples under study on the Cy5 / Red channel indicates the presence of inhibitors in the samples or errors in the setting of the RT-PCR reaction. It is required to conduct a study starting from the NK extraction stage.

The sample is considered positive, primate coronavirus RNA is present if there is an increase in the specific signal on the ROX / Orange channel, while the Ct values of the control samples are within the normal range (see Table 4). If the Ct value for a test sample through the ROX / Orange channel is determined later than 35 cycles with correct passage of positive and negative controls, it is considered controversial and is re-examined from the stage of NA isolation. If a similar result is observed during repeated setting (there is an increase in the specific signal on the ROX / Orange channel), the sample is considered positive.

A sample is considered negative (there is no primate coronavirus RNA) if the Ct value is not determined (no increase in the specific signal is observed) on the ROX / Orange channel, while the Ct values on the Cy5 / Red channel and Ct values of the control samples are within the normal range (Table 4).

Claims (7)

A test system for detecting the genome of the causative agent of a new type of coronavirus infection (nCov19) in primates using multiplex polymerase chain reaction with fluorescence detection in real time, including a buffer for carrying out the polymerase chain reaction, a mixture for its implementation, consisting of deoxynucleoside triphosphates, primers and fluorescent probes specific for coronavirus and for an internal control sample in the form of a suspension of bacteriophage MS2 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl; a mixture of enzymes from DNA polymerase with antibodies that inhibit the activity of the enzyme, TAQ POLYMERASE and MMLV REVERSE TRANSCRIPTASE reverse transcriptase; buffer for RNA dilution in the form of deionized water, internal control sample, negative control sample, positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the genome of coronavirus infection and a fragment of the genome of bacteriophage MS2, taken in a 1: 1 ratio, characterized in that the mixture recombinant plasmid DNA contains a fragment of the genome of a new type of coronavirus infection (nCov19) and a fragment of the genome of bacteriophage MS2 with the following nucleotide sequences: nCoV19-F 5'-GGAACTTCTCCTGCTAGA-3 '- forward primer, nCoV19-R 5'-GCTGGTTCAATCTGTCAA -3 '- reverse primer, nCoV19-P 5'-ROX- AAGCAAGAGCAGCATCACCGC -3'-BHQ2 - probe, MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3 '- forward primer, MS2R, 5'-GTACGGGCGACCCCACGATGAC-3 '- reverse primer, MS2P, Cy5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3'-BHQ2 - probe.