RU2586527C1 - Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction - Google Patents
Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction Download PDFInfo
- Publication number
- RU2586527C1 RU2586527C1 RU2015126127/10A RU2015126127A RU2586527C1 RU 2586527 C1 RU2586527 C1 RU 2586527C1 RU 2015126127/10 A RU2015126127/10 A RU 2015126127/10A RU 2015126127 A RU2015126127 A RU 2015126127A RU 2586527 C1 RU2586527 C1 RU 2586527C1
- Authority
- RU
- Russia
- Prior art keywords
- virus
- reaction
- polymerase chain
- reverse transcription
- chain reaction
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС), использующимся для выявления РНК вируса. Изобретение может быть использовано в ветеринарной вирусологии и генодиагностики.The invention relates to the field of molecular biology and gene diagnostics, in particular to synthetic primers complementary to the highly conserved region of the N gene of the porcine epizootic diarrhea virus (EMF) genome used to detect virus RNA. The invention can be used in veterinary virology and gene diagnostics.
Эпизоотическая (эпидемическая) диарея свиней (ЭДС) - остро протекающее, контагиозное заболевание свиней, характеризующееся изнурительной диареей, дегидратацией организма и высокой смертностью. Возбудителем ЭДС является РНК-содержащий вирус, принадлежащий порядку Nidovirale, семейству Coronaviridae, подсемейству Coronavirinae. На основе антигенных и генетических критериев вирус ЭДС вместе с коронавирусами человека NL63 и 229Е и несколькими коронавирусами летучих мышей принадлежат роду Alphacoronavirus [2, 5].Epizootic (epidemic) swine diarrhea (EMF) is an acute, contagious disease of pigs characterized by debilitating diarrhea, dehydration of the body and high mortality. The causative agent of EMF is an RNA-containing virus belonging to the order Nidovirale, family Coronaviridae, subfamily Coronavirinae. Based on antigenic and genetic criteria, the EMF virus together with human coronaviruses NL63 and 229E and several bat coronaviruses belong to the genus Alphacoronavirus [2, 5].
Заболеванию подвержены свиньи всех возрастных групп, но наибольшей восприимчивостью обладают новорожденные поросята до двухнедельного возраста, среди которых смертность достигает от 30 до 100%. С послеотъемного возраста летальный исход среди свиней составляет 1-3% [4].Pigs of all age groups are susceptible to the disease, but newborn piglets up to two weeks of age are most susceptible, among which mortality reaches from 30 to 100%. Since post-weaning age, the fatal outcome among pigs is 1-3% [4].
Высокая смертность поросят при заболевании эпизоотической диареей свиней обуславливают необходимость разработки экспресс-методов диагностики ЭДС с целью быстрого и своевременного принятия карантинных мер и профилактических мероприятий. Одним из таких методов является полимеразная цепная реакция (ПЦР), которая уже нашла широкое применение в диагностических исследованиях в ветеринарии.The high mortality of piglets with epizootic diarrhea of pigs necessitates the development of rapid methods for the diagnosis of EMF with the aim of quick and timely adoption of quarantine measures and preventive measures. One of these methods is polymerase chain reaction (PCR), which has already found wide application in diagnostic studies in veterinary medicine.
Известны несколько методов лабораторной диагностики ЭДС, такие как метод флюоресцирующих антител (МФА), прямая электронная микроскопия, реакция иммуноферментного анализа (ИФА). В сомнительных случаях ставят биопробу на безмолозивных поросятах. Однако в некоторых случаях применение этих методов не дает четких результатов, например при исследовании разложившихся патматериалов или объектов ветсаннадзора. Кроме того, перед постановкой реакции требуется предварительное приготовление суспензии органов, что достаточно трудоемко [1, 3].Several methods for laboratory diagnosis of EMF are known, such as the method of fluorescent antibodies (MFA), direct electron microscopy, enzyme-linked immunosorbent assay (ELISA). In doubtful cases, they put a bioassay on frost-free piglets. However, in some cases, the application of these methods does not give clear results, for example, when studying decomposed material or objects of veterinary surveillance. In addition, before setting up the reaction, preliminary preparation of a suspension of organs is required, which is rather laborious [1, 3].
Аналогом изобретения на Российском рынке может служить тест-система "ЭДС" для выявления вируса эпидемической диареи свиней методом полимеразной цепной реакции (ФБУН ЦЦНИИ Эпидемиологии Роспотребнадзора, г. Москва). В данной тест-системе используется стандартный Taq-man зонд. Преимуществом разработанного нами изобретения является использование зонда с внутренним гасителем флюоресценции, что позволяет увеличить чувствительность и специфичность реакции.An analogue of the invention on the Russian market can be the EMF test system for detecting the virus of epidemic diarrhea of pigs by the polymerase chain reaction method (FBSI Central Research Institute of Epidemiology of the Federal Service for Supervision of Human Rights and Human Welfare, Moscow). This test system uses the standard Taq-man probe. The advantage of our invention is the use of a probe with an internal fluorescence quencher, which allows to increase the sensitivity and specificity of the reaction.
Целью изобретения является разработка более специфичного, чувствительного экспресс-метода для выявления вируса ЭДС с помощью ОТ-ПЦР в режиме реального времени с использованием пары синтезированных олигонуклеотидных праймеров и TaqMan зонда, комплементарных к консервативной области гена N генома вируса, позволяющего амплифицировать фрагмент комплементарной ДНК размером 102 п. о.The aim of the invention is the development of a more specific, sensitive rapid method for detecting the EMF virus using RT-PCR in real time using a pair of synthesized oligonucleotide primers and a TaqMan probe, complementary to the conserved region of the N gene of the virus genome, which allows amplification of a fragment of complementary DNA size 102 by.
Для достижения поставленной цели были подобраны и синтезированы (ООО «Евроген», г. Москва) специфические праймеры и зонд для идентификации возбудителя ЭДС, которые используются для синтеза кДНК и постановки ПНР:To achieve this goal, specific primers and a probe were identified and synthesized (OOO Evrogen, Moscow) to identify the emf causative agent, which are used to synthesize cDNA and to formulate a PNR:
Способ обнаружения РНК вируса ЭДС в пробах органов, образцах крови инфицированных свиней включает предварительный этап денатурации РНК и отжига праймеров при 94°C в течение 5 мин с последующим синтезом кДНК при 42°C в течение 30 мин. Реакция ПЦР включает 40 циклов амплификации: 94°C - 10 с, 60°C - 15 с, 72°C - 15 с. Затем проводят оценку и учет результатов реакции.A method for detecting EMR virus RNA in samples of organs, blood samples of infected pigs includes a preliminary step of denaturing RNA and annealing the primers at 94 ° C for 5 minutes, followed by cDNA synthesis at 42 ° C for 30 minutes. The PCR reaction includes 40 amplification cycles: 94 ° C - 10 s, 60 ° C - 15 s, 72 ° C - 15 s. Then conduct an assessment and accounting of the results of the reaction.
Техническим результатом изобретения является общедоступность, безопасность, чувствительность, а также сокращение времени проведения диагностической работы с целью выявления генома вируса эпизоотической диареи свиней.The technical result of the invention is the accessibility, safety, sensitivity, as well as reducing the time of diagnostic work in order to identify the genome of the virus of pig epizootic diarrhea.
Сущность изобретения заключается в том, что выявление генома вируса ЭДС проводят методом полимеразной цепной реакции в режиме реального времени, предусматривающим амплификацию кДНК вируса и учет результатов реакции. При наличии в исследуемых образцах вируса ЭДС синтезируется ДНК-фрагмент длиной 102 п.о. Результат считается положительным при Ct>33.The essence of the invention lies in the fact that the identification of the genome of the EMF virus is carried out by polymerase chain reaction in real time, involving the amplification of the cDNA of the virus and taking into account the results of the reaction. If there is an EMF virus in the test samples, a DNA fragment of 102 bp is synthesized. The result is considered positive at Ct> 33.
Существенным отличием заявляемого способа является то, что:A significant difference of the proposed method is that:
1. Данный способ позволяет определять наличие возбудителя у инфицированных животных на ранних сроках после заражения.1. This method allows you to determine the presence of the pathogen in infected animals in the early stages after infection.
2. Применение данного способа позволяет сократить трудозатраты и время исследования.2. The use of this method allows to reduce labor costs and research time.
Расчет первичной структуры олигонуклеотидных праймеров.Calculation of the primary structure of oligonucleotide primers.
Для идентификации вируса эпизоотической диареи свиней методом полимеразной цепной реакции необходимо было определить участок генома, нуклеотидная последовательность которого позволяла бы дифференцировать данный вирус от других представителей рода Coronavirus и Rotaviridae и одновременно являлась бы достаточно консервативной для различных штаммов и изолятов вируса ЭДС. Проанализировав данные литературы, мы пришли к выводу, что геномом, подходящим для идентификации ЭДС, является ген N.To identify the pig epizootic diarrhea virus by polymerase chain reaction, it was necessary to determine the genome region, the nucleotide sequence of which would differentiate this virus from other representatives of the genus Coronavirus and Rotaviridae and at the same time would be quite conservative for various strains and isolates of the EMF virus. After analyzing the literature data, we came to the conclusion that the N. genome is suitable for the identification of EMF.
Подбор праймеров осуществляли на основе анализа нуклеотидных последовательностей штаммов и изолятов возбудителя ЭДС, имеющихся в базе данных GeneBank [http://www.ncbi.nlm.nih.gov/genbank]. Множественное выравнивание и анализ последовательностей осуществляли с помощью компьютерной программы «BioEdit 6.0». Для расчета праймеров был выбран участок высококонсервативной области гена N (233 п.о. - 335 п.о). Расчет и анализ олигонкулеотидов проводили с использованием компьютерной программы «OLIGO 6.0». Для подбора и анализа праймеров использовали референтную последовательность гена N штамма CV777 вируса эпизоотической диареи свиней (Porcine epidemic diarrhea virus strain CV777 nucleocapsid protein (N) gene, complete cds. - DQ355221.1).The selection of primers was carried out on the basis of the analysis of the nucleotide sequences of the strains and isolates of the causative agent of EMF, available in the GeneBank database [http://www.ncbi.nlm.nih.gov/genbank]. Multiple alignment and sequence analysis was performed using the BioEdit 6.0 computer program. To calculate the primers, a region of the highly conserved region of the N gene was selected (233 bp - 335 bp). Calculation and analysis of oligonucleotides was carried out using the computer program "OLIGO 6.0". For selection and analysis of primers, the reference sequence of the N gene of strain CV777 of the pig epizootic diarrhea virus (Porcine epidemic diarrhea virus strain CV777 nucleocapsid protein (N) gene, complete cds. - DQ355221.1) was used.
Постановка реакции обратной транскрипции и ПЦР в режиме реального времени.Formulation of the reaction of reverse transcription and PCR in real time.
Проводят отжиг праймеров, для чего в предварительно промаркированные пробирки объемом 0,2 мл вносят по 8 мкл РНК, по 1 мкл каждого праймера и 5 мкл бидистиллированной воды.Primers are annealed, for which 8 μl of RNA, 1 μl of each primer and 5 μl of bidistilled water are added to pre-labeled 0.2 ml tubes.
Денатурацию РНК и отжиг праймеров проводят в амплификаторе при температуре 94°C в течение 5 минут.RNA denaturation and primer annealing are carried out in a thermocycler at a temperature of 94 ° C for 5 minutes.
В отдельной пробирке готовят общую реакционную смесь на N образцов, в число которых входят положительный контроль (с водным раствором РНК вируса ЭДС) и отрицательный контроль (с бидистиллированной водой). Реактивы вносят в последовательности, приведенной в таблице. Фермент добавляют в последнюю очередь.In a separate test tube, a general reaction mixture is prepared for N samples, which include a positive control (with an aqueous solution of the EMF virus RNA) and a negative control (with bidistilled water). Reagents are added in the sequence shown in the table. The enzyme is added last.
Пробы инкубируют при температуре 42°C 30 минут в амплификаторе. После окончания инкубации кДНК используют для дальнейшего анализа или хранят при -20°C 2 недели.Samples are incubated at 42 ° C for 30 minutes in a thermocycler. After incubation, cDNA is used for further analysis or stored at -20 ° C for 2 weeks.
В отдельной пробирке объемом 0,2 мл готовят общую реакционную смесь на N образцов, в число которых входят положительный и отрицательный контроли. Реактивы вносят в последовательности, приведенной в таблице. Фермент добавляют в последнюю очередь.In a separate 0.2 ml tube, a total reaction mixture was prepared for N samples, which included the positive and negative controls. Reagents are added in the sequence shown in the table. The enzyme is added last.
В реакции ПЦР используют 5 мкл кДНК, полученной в ходе реакции обратной транскрипции.In the PCR reaction using 5 μl of cDNA obtained during the reverse transcription reaction.
Синтетические олигонуклеотидные праймеры были проверены на специфичность и чувствительность. Установлено, что тест-система не амплифицирует кДНК других бактерий и вирусов. Тест-система показала диагностическую специфичность и чувствительность на уровне 100%.Synthetic oligonucleotide primers were tested for specificity and sensitivity. It was found that the test system does not amplify the cDNA of other bacteria and viruses. The test system showed diagnostic specificity and sensitivity at 100%.
Примеры конкретного выполненияCase Studies
Пример 1Example 1
Выявление фрагментов генома вируса ЭДС включает в себя следующие этапы.Identification of fragments of the genome of the EMF virus includes the following steps.
Выделение РНК из вируссодержащего материала (методами нуклеосорбции или с использованием коммерческих наборов).Isolation of RNA from virus-containing material (by nucleosorption methods or using commercial kits).
Проведение реакции обратной транскрипции. На N количество образцов изготовляют реакционную смесь для обратной транскрипции согласно таблице 2. Обратная транскрипция проводится в течение 30 минут при температуре 42°C.Conducting a reverse transcription reaction. For N, the number of samples produced reaction mixture for reverse transcription according to table 2. Reverse transcription is carried out for 30 minutes at a temperature of 42 ° C.
Продукт реакции обратной транскрипции используется как матрица в реакции ПЦР в режиме реального времени.The product of the reverse transcription reaction is used as a matrix in real-time PCR reaction.
Постановка ПЦР в режиме реального времени. На N количество образцов изготовляют реакционную смесь согласно таблице 3. Амплификация и детекция флюоресценции производятся согласно температурным режимам, указанным в таблице 4.Real-time PCR setup. For N, the number of samples produce the reaction mixture according to table 3. Amplification and detection of fluorescence is carried out according to the temperature conditions specified in table 4.
Учет результатов амплификации. Образец считается положительным на наличие генома вируса ЭДС при значении Ct<33. Образцы, не пересекающие пороговую линию, и образцы со значением Ct>33 считаются отрицательными.Accounting for the results of amplification. The sample is considered positive for the presence of the EMF virus genome with a Ct value of <33. Samples that do not cross the threshold line and samples with a Ct value> 33 are considered negative.
Источники информацииInformation sources
1. DeBouck, P. The diagnosis of coronavirus-like agent (CVLA) diarrhea in suckling pigs. / DeBouck P., Callebaut P., Pensaert M. // Curr. Top. Vet. Med. Anim. Sci. - 1981a. - V. 13. - P. 59-61.1. DeBouck, P. The diagnosis of coronavirus-like agent (CVLA) diarrhea in suckling pigs. / DeBouck P., Callebaut P., Pensaert M. // Curr. Top Vet. Med. Anim. Sci. - 1981a. - V. 13. - P. 59-61.
2. Gonzales, J.M. A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. / Gonzales J.M., Gomez-Puertas P., Cavanagh D., Gorbalenya A.E., Enjuanes L. // Arch. Virol. - 2003. - V. 148. - P. 2207-2235.2. Gonzales, J. M. A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. / Gonzales J.M., Gomez-Puertas P., Cavanagh D., Gorbalenya A.E., Enjuanes L. // Arch. Virol. - 2003. - V. 148. - P. 2207-2235.
3. Guscetti, F. Immunohistochemical detection of porcine epidemic diarrhea virus compared to other methods. / Guscetti F, Bernasconi C, Tobler K, Van Reeth K, Pospischil A, Ackermann M. // Clin. Diagn. Lab. Immunol. 1998. 5:412-414.3. Guscetti, F. Immunohistochemical detection of porcine epidemic diarrhea virus compared to other methods. / Guscetti F, Bernasconi C, Tobler K, Van Reeth K, Pospischil A, Ackermann M. // Clin. Diagn. Lab. Immunol. 1998.5: 412-414.
4. Pensaert, M. Porcine epidemic diarrhea. / Pensaert M. // In: B.E. Straw et al. Diseases of Swine (9th Ed., Blackwell, Ames, 2006), P.367-372.4. Pensaert, M. Porcine epidemic diarrhea. / Pensaert M. // In: B.E. Straw et al. Diseases of Swine (9th Ed., Blackwell, Ames, 2006), P.367-372.
5. Sanchez, C.M. Antigenic homology among coronaviruses related to transmissible gastroenteritis virus/ / Sanchez С.М., Jimenez G., Laviada M.D., Correa I., Sune C., Bullido M.J., Gebauer F., Srnerdou C., Callebaut P., Escribano J.M., Enjuanes L. // Virology. - 1990. - V. 174. - P. 410-417.5. Sanchez, C.M. Antigenic homology among coronaviruses related to transmissible gastroenteritis virus / / Sanchez S.M., Jimenez G., Laviada MD, Correa I., Sune C., Bullido MJ, Gebauer F., Srnerdou C., Callebaut P., Escribano JM, Enjuanes L. // Virology. - 1990. - V. 174. - P. 410-417.
Claims (2)
Fw 5′ ACCAGCAAATTGGGTACTG 3′
Rw 5′ CCTGTTCCGAGGTAGTAGAA 3′
Ζ 5′ FAM-CCGTGGT(RTQ1)GAGCGAATTGAACAACC 3′1. Synthetic oligonucleotide primers and Taq-Man probe complementary to the highly conserved region of the N gene of the pig epizootic diarrhea virus genome used to detect EMF virus RNA having the following nucleotide composition:
Fw 5 ′ ACCAGCAAATTGGGTACTG 3 ′
Rw 5 ′ CCTGTTCCGAGGTAGTAGAA 3 ′
Ζ 5 ′ FAM-CCGTGGT (RTQ1) GAGCGAATTGAACAACC 3 ′
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2015126127/10A RU2586527C1 (en) | 2015-06-30 | 2015-06-30 | Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2015126127/10A RU2586527C1 (en) | 2015-06-30 | 2015-06-30 | Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2586527C1 true RU2586527C1 (en) | 2016-06-10 |
Family
ID=56115464
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2015126127/10A RU2586527C1 (en) | 2015-06-30 | 2015-06-30 | Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2586527C1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2730000C1 (en) * | 2019-09-23 | 2020-08-13 | Общество С Ограниченной Ответственностью "Апто-Фарм" | Dosage form of dna-aptamer |
CN114672595A (en) * | 2022-04-08 | 2022-06-28 | 山东傲农种猪有限公司 | Porcine viral diarrhea detection primer combination, detection kit and application |
-
2015
- 2015-06-30 RU RU2015126127/10A patent/RU2586527C1/en not_active IP Right Cessation
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2730000C1 (en) * | 2019-09-23 | 2020-08-13 | Общество С Ограниченной Ответственностью "Апто-Фарм" | Dosage form of dna-aptamer |
CN114672595A (en) * | 2022-04-08 | 2022-06-28 | 山东傲农种猪有限公司 | Porcine viral diarrhea detection primer combination, detection kit and application |
CN114672595B (en) * | 2022-04-08 | 2023-09-19 | 山东傲农种猪有限公司 | Porcine viral diarrhea detection primer combination, detection kit and application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Baxi et al. | A one-step multiplex real-time RT-PCR for detection and typing of bovine viral diarrhea viruses | |
Oura et al. | Virological diagnosis of African swine fever—comparative study of available tests | |
US20080280296A1 (en) | Method for detection of foot-and-mouth disease virus with chromatographic strip test | |
RU2506317C2 (en) | Method for detection of intestinal viruses in clinical samples of real-time multiplex pcr and list of sequencies for implementing it | |
Ma et al. | Point‐of‐care diagnostic assay for rapid detection of porcine deltacoronavirus using the recombinase polymerase amplification method | |
WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
CN106435023B (en) | Taqman real-time fluorescence PCR kit for detecting porcine umbilical cord blood porcine transmissible gastroenteritis virus and application thereof | |
Wang et al. | Real-time RPA assay for rapid detection and differentiation of wild-type pseudorabies and gE-deleted vaccine viruses | |
Lee et al. | Detection and differentiation of Schmallenberg, Akabane and Aino viruses by one-step multiplex reverse-transcriptase quantitative PCR assay | |
Postel et al. | Development of a new LAMP assay for the detection of CSFV strains from Cuba: a proof-of-concept study | |
Zeng et al. | Development of a real time loop-mediated isothermal amplification method for detection of Senecavirus a | |
Wang et al. | Visual detection of porcine epidemic diarrhea virus using a novel reverse transcription polymerase spiral reaction method | |
Li et al. | Development of a recombinase-aided amplification combined with lateral flow dipstick assay for the rapid detection of the African swine fever virus | |
Hou et al. | Rapid detection of bovine viral diarrhea virus using recombinase polymerase amplification combined with lateral flow dipstick assays in bulk milk/Brzo otkrivanje uzrocnika virusnog proljeva goveda u mlijeku iz spremnika pomocu kombinacije metoda umnozene rekombinazne polimeraze i test-traka za" lateral flow" analizu | |
RU2586527C1 (en) | Oligonucleotide primers and fluorescent probe and method for detection of epidemic diarrhea virus genome by reverse transcription - polymerase chain reaction | |
Tong et al. | Rapid detection of Decapod iridescent virus 1 (DIV1) by recombinase polymerase amplification | |
RU2761496C2 (en) | Method for identification of the porcine reproductive and respiratory syndrome virus based on real-time pcr | |
Szentiks et al. | Polar bear encephalitis: establishment of a comprehensive next-generation pathogen analysis pipeline for captive and free-living wildlife | |
Antas et al. | Porcine enteric coronavirus infections in wild boar in Poland–a pilot study | |
Liu et al. | Development of reverse transcription loop-mediated isothermal amplification for rapid detection of Batai virus in cattle and mosquitoes | |
Tran et al. | Evaluation of an automated insulated isothermal polymerase chain reaction system for rapid and reliable, on-site detection of African swine fever virus | |
Liu et al. | Development of a droplet digital PCR assay for detection of group A porcine rotavirus | |
CN106521029A (en) | Multiple RT-PCR detection kit for identifying PRRSV (Porcine Reproductive and Respiratory Syndrome) | |
Geng et al. | Specific detection of bovine coronavirus N protein with TaqMan probe qRT-PCR | |
Zhao et al. | Development of a multiplex qRT-PCR assay for detection of classical swine fever virus, African swine fever virus, and Erysipelothrix rhusiopathiae |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20180701 |