RU2740097C1 - Method for detecting a new type coronavirus infection agent genome (ncov19) in primates - Google Patents

Abstract

FIELD: veterinary virology.

SUBSTANCE: described is a method for detecting a genome of an agent of a new type of coronavirus infection (nCoV19). Method involves RNA extraction from biological material by choice: nasal, throat, nasopharyngeal swabs, nasopharyngeal aspirates, nasal washouts, sputum, bronchoalveolar lavage, sectional material, culture fluid samples, faecal extracts, fragments of abdominal organs taken from animals infected with coronavirus infection agent by sorption method. Further, cDNA synthesis on the RNA matrix by setup of single-step with the addition of internal and positive controls samples of the multiplex reverse transcription reaction and polymerase chain reaction – with 45 amplification cycles with real-time detection using oligonucleotide primers specific for the viral pathogen genome region, fluorescently labeled probe and control samples: an internal control sample in the form of a bacteriophage MS2 suspension with concentration of 5×10³ copies of nucleotide sequences per 1 mcl and a positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the coronavirus infection pathogen genome and a fragment of the bacteriophage MS2 genome taken in ratio 1:1. Then measuring the accumulation of the fluorescent signal through the channel for the specific signal and the Cy5/Red channel for the internal control signal and interpreting the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line – Threshold, if the curves of the fluorescent signal accumulation go out before 35th cycle, then the reaction result is considered to be positive, and if curves do not cross threshold line or cross it after 35 cycle, result of reaction is negative. According to the invention, the biological material is taken from primates infected with a novel coronavirus infection agent nCoV19, and for the positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the genome of the coronavirus infection agent of the new type nCoV19 and a fragment of the bacteriophage MS2 genome with the following nucleotide sequences: nCoV19-F 5'- GGAACTTCTCCTGCTAGA -3' – forward primer; nCoV19-R 5' – GCTGGTTCAATCTGTCAA -3' – reverse primer; nCoV19-P 5' -ROX- AAGCAAGAGCAGCATCACCGC -3' -BHQ2 – probe; MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3' – forward primer; MS2R, 5'-GTACGGGCGACCCCACGATGAC-3' – reverse primer; MS2P, Cy5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3'-BHQ2- probe. For a specific signal, the accumulation of the fluorescent signal is measured through a ROX/Orange channel. Invention extends the range of means of diagnosing coronavirus infection in primates, both in practice of veterinary service, and for scientific research.

EFFECT: invention extends functional capabilities and provides reliable diagnosis of new-type coronavirus infection (nCov19) in primates, in a method for detecting a genome of a coronavirus infection agent of a new type (nCov19) in primates.

1 cl, 4 tbl, 1 ex

Description

The invention relates to veterinary virology, namely to diagnostic tools for coronavirus infection in primates, both in the practice of the veterinary service and for scientific research.

Known studies of coronavirus infection of monkeys (dissertation and abstract "Coronavirus infection of monkeys" according to the Higher Attestation Commission of the Russian Federation 03.00.06, Candidate of Biological Sciences Goncharuk, Elena Ivanovna 1991 https://www.dissercat.com/content/koronavirusnaya-infektsiya-obezyan.

Monkeys, like animals, are the closest relatives of people and with their help unique opportunities are presented in the study of human pathology. Many researchers have convincingly proved that monkeys hardly differ from humans in their sensitivity to viruses. Moreover, they are the only animals in which infections proceed with the same manifestations as in humans. Diagnosis of coronavirus infection in primates was carried out using electron microscopy and ELISA, using the latter method, the antigenic relationship of isolates with human coronavirus was proved.

During the research, a high infection rate was established in monkeys of different species, age and sex. Most often, viruses were found in the intestines, pancreas, lungs, and less often in other organs. In addition, spontaneous coronavirus infection in monkeys is persistent, proceeding with respiratory and / or gastrointestinal tract damage, accompanied by periodic exacerbations, during which clinical manifestations of enterocolitis and / or pneumonia are observed. The death of animals occurs mainly from associated diseases, more often of a bacterial nature.

For research, virological methods were used, the main method for detecting the studied viruses is electron microscopic (EM), namely negative contrasting. Were also used immunological methods.

The disadvantage of the known technical solution is the insufficiently reliable diagnosis of coronavirus infection in primates.

Known methods for diagnosing pathogens of human or monkey infection and a kit for its implementation (RF patents, No. 2385945, 2385946, CL C12Q 1/68, 2010) in which DNA is isolated from clinical material or cell culture infected with pathogens isolated from clinical material, carry out multiplex PNR with primers, then electrophoretic analysis of amplification products and predict the forms of the causative agent of human or monkey infection. A common disadvantage of the known technical solutions is the lack of the possibility of diagnosing coronavirus infection in primates.

The closest in technical essence is a method (RF patent No. 2694558, C12Q 1/68, 2019 - prototype) for detecting the genome of the causative agent of coronavirus infection in animals using multiplex polymerase chain reaction (PCR) with fluorescence detection in real time, including RNA isolation from biological material of choice: swabs from the nose, throat, nasopharynx, nasopharyngeal aspirates, nasal washings, sputum, bronchoalveolar lavage, sectional material, culture fluid samples, fecal extracts, fragments of abdominal organs taken from animals infected with the causative agent of coronavirus infection by the sorption method , synthesis of cDNA on an RNA template by setting up a one-step multiplex reaction of reverse transcription and polymerase chain reaction with the addition of internal and positive controls of samples - with 45 amplification cycles with real-time detection using oligonucleo primers, fluorescently labeled probe and control samples: internal control sample in the form of a suspension of bacteriophage MS2 with a concentration of 5 × 10 ³ copies of nucleotide sequences per 1 μl and a positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the genome of the causative agent of coronavirus infection and a fragment genome of bacteriophage MS2 taken in a 1: 1 ratio, measurement of the fluorescence signal accumulation in the channel for a specific signal and the Cy5 / Red channel for the internal control signal and interpretation of the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line - Threshold, if the fluorescence accumulation curves signals go out up to 35 cycles, then the result of the reaction is considered positive, and if the curves do not cross the threshold line or cross it after 35 cycles, then the result of the reaction is negative. new type of coronavirus infection (nCovl9) diagnosis in primates.

The technical result is to expand the functionality and obtain a reliable diagnosis of a new type of coronavirus infection (nCovl9) in primates.

The technical result is achieved by the fact that in the method for detecting the genome of the causative agent of a new type of coronavirus infection (nCovl9) in primates, including the isolation of RNA from biological material of choice: swabs from the nose, throat, nasopharynx, nasopharyngeal aspirates, nasal washings, phlegm, bronchoalveolar lavage, sectional material, culture fluid samples, fecal extracts, fragments of abdominal organs taken from animals infected with the causative agent of coronavirus infection by the sorption method, the synthesis of cDNA on the RNA matrix by setting a one-step multiplex reaction of reverse transcription and polymerase chain reaction with the addition of internal and positive controls of samples - with carrying out 45 cycles of amplification with real-time detection using oligonucleotide primers, a fluorescently labeled probe, specific for a region of the genome of the viral pathogen, and control samples: an internal control sample in the form of a suspension of bacteriophage MS2 with ntsentratsiey 5 × ¹⁰ March copies of nucleotide sequences to 1 l and a positive control sample as a mixture of recombinant plasmid DNA containing a fragment of the genome of the pathogen coronavirus infection and a fragment of the genome of the bacteriophage MS2, taken in the ratio 1: 1, the measurement of the accumulation of the fluorescent signal on the channel for a particular signal and the Cy5 / Red channel for the internal control signal and the interpretation of the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line - Threshold, if the fluorescent signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line, or cross it after the 35th cycle, then the result of the reaction is negative, according to the invention, biological material is taken from primates infected with the causative agent of a new type of coronavirus infection nCoV19, and for a positive control sample, a mixture of recombinant plasmid DNA containing fractions a fragment of the genome of the causative agent of a new type of coronavirus infection nCoV19 and a fragment of the genome of bacteriophage MS2 with the following nucleotide sequences:

nCoV19-F 5'-GGAACTTCTCCTGCTAGA -3 '- forward primer

nCoV19-R 5'- GCTGGTTCAATCTGTCAA -3 '- reverse primer

nCoV19-P 5'-ROX- AAGCAAGAGCAGCATCACCGC -3 '-BHQ2 - probe

MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3 '- forward primer

MS2R, 5'-GTACGGGCGACCCCACGATGAC-3 '- reverse primer

MS2P, Cy5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3'-BHQ2 - probe, while for a specific signal the accumulation of the fluorescent signal is measured using the ROX / Orange channel.

The novelty of the proposed technical solution lies in the fact that in order to obtain a reliable diagnosis of coronavirus infection of a new type of nCoV19 in primates, oligonucleotide primers of a fluorescently labeled probe are used that are specific for a region of the genome of the nCoV19 coronavirus and different types of control for which different forms of MS2 bacteriophage material with a new nucleotide sequence are used. this is due to the fact that these nucleotide sequences are better combined with primers on nCoV19 and provide reliable diagnostics.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The inventive method is recommended to be used in veterinary virology, namely, as a means of diagnostics of a new type of coronavirus infection nCoV 19 in primates, both in the practice of the veterinary service and for scientific research, which meets the criterion of "industrial applicability".

The use of the claimed oligonucleotide primers nCoV19F and nCoV19R of the fluorescently labeled nCoV19P probe provides specific detection of the RNA of the new type of coronavirus nCoV19 in primates.

The use of new nucleotide sequences of bacteriophage MS2: to create control types of different forms of material: suspension and a fragment of the genome with specific primers and a probe, bacteriophage MS2 due to the fact that it allows you to control the correct progress of the reaction in each tube, and also controls the stage of RNA extraction from samples.

Primers specific to the genome of the causative agent of a new type of coronavirus infection (nCovl9) were selected based on the region of the nucleotide sequence of the N gene encoding the synthesis of the protein, the nucleocapsid phosphoprotein gene of the virus, which is an essential component of the virion of SARS-like rhodaviruses included in beta coronaviruses of the Coronaviridae family of the order Nidovirales. Like other representatives of this genus, the genome of the new type of coronavirus (nCovl9) is represented by single-stranded RNA (+), about 30,000 nucleotides in size.

To select the sequence and calculate the primary structure of oligonucleotide primers and probes, a comparative analysis of the nucleotide sequences of the N gene, which encodes the synthesis of the virus structural protein, nucleocapsid phosphoprotein, available in the GenBank and GISAID electronic databases, was carried out.

Using the "BioEdit 7.0" program, the nucleotide sequences of the N gene of the genome of viruses - representatives of the genera of beta-coronaviruses (A-H species) and alpha-coronaviruses - were aligned with the sequence of the N gene of the novel coronavirus genome (nCoV19) of the Wuhan-Hu-1 isolate, ((Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome, NCBI Reference Sequence, 29.903 bp linear RNA, 28274-29533 / gene = "N" / product ^∧ "nucleocapsid phosphoprotein") (access code NC_045512.2). analysis of the constructed alignment within the gene encoding the nucleocapsid phosphoprotein of the virus, a region between 28750 and 29050 nucleotides containing unique nucleotide sequences was selected. Using the Oligo 6.0 program, the primary structures of oligonucleotide primers flanking the selected region of the genome were calculated. -labeled probe nCoV19-P, complementary to the region of the nucleotide sequence limited by positions annealing the primers nCovl9-F and nCoV19-R. A bright rhodamine dye-ROX (carboxy-X-rhodamine) balanced by a quencher (Quencher-BHQ-2) at the 3'-end of the nucleotide probe was used as a fluorophore at the 5'-end. Using the program "Oligo 6.0", the main properties of the calculated oligonucleotides are described, which determined the possibility of their use in PNR.

Using the Oligo 6.0 program, the nucleotide sequence of the bacteriophage MS2 {Enterobacteria phage MS2 isolate ST4, complete genome, access code EF204940) was analyzed. Bacteriophage MS2 contains a single-stranded positively oriented RNA 3569 bases in size. As a result of analysis of the maturation protein within the gene, a region between 200 and 350 nucleotides containing unique nucleotide sequences was selected, and the primary structures of oligonucleotide primers flanking the selected region of the genome were calculated. For the detection of amplification products, an oligonucleotide fluorescently labeled probe MS2P11 complementary to the region of the nucleotide sequence limited by the positions of annealing of primers MS2F11 and MS2R11 was selected. Using the program "Oligo 6.0", the main properties of the calculated oligonucleotides, which determined the possibility of their use in PCR, are described.

An example of a specific application of the method for detecting the genome of the causative agent of a new type of coronavirus infection (nCovl9) in primates

For the study, the following biological material is used, taken from infected primates:

- Feces weighing 5 g are collected in a sterile plastic container.

- 1 cm ³ pieces are cut out of intestinal tissues and placed in a sterile container. Next, the test material is processed.

Intestinal tissue samples with contents (up to 1 g) are homogenized using sterile porcelain mortars and pestles, then a 10% suspension is prepared in sterile saline solution. The suspension is transferred into a 1.5 ml tube and centrifuged at 9000 rpm for 1 min. An aliquot of the supernatant (0.1 ml) is used for the RNA extraction.

A 10% suspension is prepared from feces (1-5 g) in sterile saline solution. The suspension of faeces is decanted for 5-10 minutes. Take 1 ml of the supernatant liquid and transfer to a clean 1.5 ml tube, centrifuge at 5000 rpm in a MiniSpin centrifuge, Eppendorf, for 5 min. The extraction of RNA from the clarified fecal extract is carried out as soon as possible.

For the study of respiratory coronavirus infection, use at choice: swabs from the nose, throat, nasopharynx, nasopharyngeal aspirates, nasal washings, sputum, bronchoalveolar lavage, section material, culture fluid samples.

Discharge from the nasopharynx and trachea, swabs from the nasal mucosa are removed using a sterile probe, the probe is placed in a 1.5 ml plastic microtube with 0.5 ml of sterile saline / phosphate buffer / transport medium.

Pharyngeal swabs are placed in a sterile container. Washes, smears are taken for research without preliminary preparation.

Sputum, viscous in consistency, is treated with reagents such as mucolysin in order to reduce the viscosity.

The analysis is carried out using a set of reagents "PCR-CORONAVIRUS (nCoV19) - FACTOR" (Instructions for the use of "PCR-CORONAVIRUS-primates-FACTOR", a set of reagents for detecting RNA coronavirus (nCoV19) of primates in biological material by reverse transcription and polymerase chain reaction with fluorescence detection in real time (RT-PCR-RT), TU 21 10.60-133-51062356-2017,

http://www.vetfaktor.ru/) which consists of three stages (see table 1 and 2):

extraction of NA;

RT-PCR RT with fluorescence detection in real time;

accounting of analysis results.

The RT-PCR RT reaction is carried out in one tube.

Sample preparation for PCR

The total volume of the reaction mixture is 25 μl, the volume of the RNA sample is 10 μl.

The successful completion of the reaction is monitored by the use of PCO nCoV19, ICO nCoV19 and RNA buffer.

RT-PCR buffer, nCoV19 PCR buffer; composition: 2.5x PCR buffer (potassium chloride, 100 mM, Tris-HC1, pH 8.8 100 mM, glycerol 1%, Tween-20 0.02%); magnesium chloride, 5 mM; deionized water.

Mixture for PCR, PCR-mixture nCoV19 composition: equimolar mixture of deoxynucleoside triphosphates (dNTP) at a concentration of 0.25 mM; deionized water, a mixture of primers and a fluorescent probe for corona-virus (forward and reverse primers nCoV19F and nCoV19R at a concentration of 0.2 μM, probe nCoV19P-ROX at a concentration of 0.1 μM, taken in a 1: 1: 0.5 ratio), a mixture of primers and a fluorescent probe on FCC (forward and reverse primers MS2F and MS2R at a concentration of 0.2 μM, probe MS2P-Cy5 at a concentration of 0.1 μM, taken in a 1: 1: 0.5 ratio).

Enzyme mixture, RT PCR ENZ, composition: DNA polymerase with antibodies that inhibit enzyme activity, TAQ POLYMERASE (5 U / μL), MMLV REVERSE TRANSCRIPTASE reverse transcriptase (100 U / μL).

RNA dilution buffer, RNA buffer, composition: deionized water.

Internal control sample, VKO nCoV19; composition: suspension of bacteriophage MS2 (5 × 10 ³ / ml)

- Negative control sample, OKO (TE buffer); composition: TE buffer (10 mM Tris-HC1, 0.5 mM EDTA, pH 8.0)

- Positive control sample, PKO nCoV19; composition: a mixture of recombinant plasmid DNA containing a fragment of the genome of the nCoV19 virus and a fragment of the genome of the bacteriophage MS2, taken in a 1: 1 ratio.

In a separate tube, mix the components of the kit for each reaction: - 10 μl - PIR BUFFER nCoV19

5 μl - PCR MIX nCoV19

- 0.75 μl RT PCR ENZ.

Select the required number of tubes for the amplification of the NK of the investigated and control samples. They add 15 μl of the prepared reaction mixture.

Using filter tips into prepared tubes add:

a) in a tube of negative control PCR (K-) 10 μl of RNA buffer;

b) in a number of test tubes for investigated samples - add 10 μl of NK of the corresponding sample, including sample VK-) to each;

c) in a test tube with a positive control PCR (K +) 10 μl of PCR nCoV19.

Carrying out RT-PCR reaction with fluorescence detection

The parameters of the temperature-time mode of amplification on the "Rotor-Gene Q", "DT-96" and "CFX96" devices are shown in Table 3.

Place the tubes prepared for PCR into the wells of the thermocycler.

Interpreting Analysis Results

Obtained data - fluorescent signal accumulation curves are analyzed using the software of the used device for carrying out PCR in "real time" mode in accordance with the manufacturer's instructions for the device.

The results of RT-PCR were taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the value of the threshold cycle "Ct> for the sample under study).

The result is considered reliable if the positive and negative controls for amplification and extraction of NA were correctly passed in accordance with Table 4.

The appearance of any Ct value in the table of results for negative control of the VK- extraction stage on the ROX / Orange channel and for negative control of the K- PCR stage on any of the channels indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as to take measures to identify and eliminate the source of contamination.

Samples for which Ct value is absent or exceeds cycle 35 in the Cy5 / Red channel (while Ct value is also absent in the ROX / Orange channel) require a second study from the HHCR stage. A delay in the values of the threshold cycles for the samples under study on the Cy5 / Red channel indicates the presence of inhibitors in the samples or errors in the setting of the RT-PCR reaction. It is required to conduct a study starting from the NK extraction stage.

A sample is considered positive (primate coronavirus RNA is present) if there is an increase in the specific signal on the ROX / Orange channel, while the Ct values of the control samples are within the normal range (see Table 3). If the Ct value for a test sample through the ROX / Orange channel is determined later than 35 cycles with correct passage of positive and negative controls, it is considered controversial and is re-examined from the stage of NA isolation. If a similar result is observed during repeated setting (there is an increase in the specific signal on the ROX / Orange channel), the sample is considered positive.

A sample is considered negative (there is no primate coronavirus RNA) if the Ct value is not determined (no increase in the specific signal is observed) on the ROX / Orange channel, while the Ct values on the Cy5 / Red channel and Ct values of the control samples are within the normal range (Table 4).

Claims (7)

A method for detecting the genome of the causative agent of a new type of coronavirus infection (nCovl9) in primates, including the isolation of RNA from biological material of choice: swabs from the nose, throat, nasopharynx, nasopharyngeal aspirates, nasal washings, sputum, bronchoalveolar lavage, sectional material, culture fluid samples, extracts feces, fragments of abdominal organs, taken from animals infected with the causative agent of coronavirus infection by the sorption method, synthesis of cDNA on an RNA template by setting up a one-stage multiplex reverse transcription reaction and polymerase chain reaction with the addition of internal and positive controls of samples - with 45 amplification cycles with detection in real-time using oligonucleotide primers, fluorescently labeled probe and control samples specific for the region of the genome of the viral pathogen, and control samples: an internal control sample in the form of a suspension of bacteriophage MS2 with a concentration of 5 × 10 ³ copies of nucleotide sequences 1 μL and a positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the genome of the causative agent of coronavirus infection and a fragment of the genome of bacteriophage MS2 taken in a 1: 1 ratio, measurement of the accumulation of fluorescent signal by the channel for the specific signal and the Cy5 / Red channel for the signal internal control and interpretation of the results based on the presence or absence of intersection of the fluorescence curve with the threshold line - Threshold, if the curves of the accumulation of the fluorescent signal go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after 35th cycle, then the result of the reaction is negative, characterized in that the biological material is taken from primates infected with the causative agent of the new type of coronavirus infection nCoV19, and for a positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the genome of the causative agent of coronavirus infection is used ction of the new type nCoV19 and a fragment of the genome of bacteriophage MS2 with the following nucleotide sequences: nCoV19-F 5 '- GGAACTTCTCCTGCTAGA -3' - forward primer nCoV19-R 5'- GCTGGTTCAATCTGTCAA -3 '- reverse primer nCoV19-P 5 '-ROX- AAGCAAGAGCAGCATCACCGC -3' -BHQ2 - probe MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3 '- forward primer MS2R, 5 '-GTACGGGCGACCCCACGATGAC-3' - reverse primer MS2P, Cy5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3'-BHQ2 - probe, while the accumulation of fluorescent signal is measured by the ROX / Orange channel for a specific signal.