RU2607025C1

RU2607025C1 - Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle

Info

Publication number: RU2607025C1
Application number: RU2016120164A
Authority: RU
Inventors: Светлана Владимировна Котенева; Ринат Амирович Максютов; Александр Гаврилович Глотов; Татьяна Ивановна Глотова; Александр Николаевич Сергеев; Александр Петрович Агафонов
Priority date: 2016-05-24
Filing date: 2016-05-24
Publication date: 2017-01-10

Abstract

FIELD: veterinary science.

SUBSTANCE: invention relates to veterinary virology and biotechnology, namely, to genetic engineering. There are offered synthetic oligonucleotide primers for identification of RNA atypical pestivirus of cattle and application method. Represented synthetic oligonucleotide primers have nucleotide sequences: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Disclosed method involves RNA recovery from embryonic sera samples and biological material, conducting reverse transcription and PCR with synthetic oligonucleotide primers, transfer of the amplification product on gel and evaluation the reaction. PCR is carried out in 1 round. In case of positive reaction enables synthesizing a fragment, corresponding to 320 p.n.

EFFECT: invention can be used in veterinary science for detection of possible contaminations of embryo serums, used for cultivation of cell cultures and production of biopreparations, atypical pestivirus of cattle, as well as for diagnosis of infectious diseases in farm animals, in particular infection caused by atypical pestivirus of cattle.

2 cl, 1 dwg, 3 tbl, 4 ex

Description

Изобретение относится к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии, и может быть использовано для выявления атипичного пестивируса крупного рогатого скота в образцах эмбриональных сывороток и пробах биоматериала, полученных от крупного рогатого скота.The invention relates to veterinary virology and biotechnology, namely to genetic engineering, and can be used to detect atypical cattle pestivirus in samples of fetal sera and samples of biomaterial obtained from cattle.

Атипичные пестивирусы - группа вирусов рода Pestivirus семейства Flaviviridae, выделенных от буйволов и крупного рогатого скота, а также из эмбриональной сыворотки, используемой для культивирования культур клеток, производства вакцин и пересадки эмбрионов. Штаммы вирусов, представленные цитопатогенным и нецитопатогенным биотипами, имеют в литературе различные названия: третий тип вируса вирусной диареи - болезни слизистых оболочек крупного рогатого скота, атипичный пестивирус (HoBi-like), пятый тип рода Pestivirus. Официальная классификация не принята.Atypical pestiviruses are a group of viruses of the genus Pestivirus of the Flaviviridae family, isolated from buffaloes and cattle, as well as from fetal serum used to cultivate cell cultures, produce vaccines and transfer embryos. Virus strains represented by cytopathogenic and non-cytopathogenic biotypes have different names in the literature: the third type of viral diarrhea virus - diseases of the mucous membranes of cattle, atypical pestivirus (HoBi-like), the fifth type of the genus Pestivirus. The official classification is not accepted.

Инфекция КРС, вызванная атипичным пестивирусом, имеет большое сходство с вирусной диареей - болезнью слизистых оболочек крупного рогатого скота (ВД-БС КРС) и проявляется в виде диареи, абортов, респираторного синдрома, персистентной инфекции.Cattle infection caused by atypical pestivirus is very similar to viral diarrhea - a disease of the mucous membranes of cattle (VD-BS cattle) and manifests itself in the form of diarrhea, abortion, respiratory syndrome, persistent infection.

До настоящего времени в России не разработаны способы выявления РНК атипичного пестивируса крупного рогатого скота и не проводится исследование эмбриональных сывороток, используемых для культивирования клеток и производства биопрепаратов.To date, Russia has not developed methods for detecting RNA of atypical cattle pestivirus and does not conduct research on embryonic sera used for cell cultivation and production of biological products.

За рубежом предложены следующие диагностические тесты для выявления телят, персистентно инфицированных атипичным пестивирусом: иммунофлуоресцентный анализ, метод иммуногистохимии, ОТ-ПЦР и реал-тайм ПЦР (Generation of Calves Persistently Infected with HoBi-Like Pestivirus and Comparison of Methods for Detection of These Persistent Infections / F.V. Bauermann, S.M. Falkenberg, B. Vander Ley, N. Decaro, B.W. Brodersen, A. Harmon, B. Hessman, E.F. Flores, J.F. Ridpath / Journal of Clinical Microbiology. - November 2014 Volume 52 Number 11 p. 3845-3852).Abroad, the following diagnostic tests are proposed for identifying calves persistently infected with atypical pestivirus: immunofluorescence analysis, immunohistochemistry, RT-PCR and real-time PCR / FV Bauermann, SM Falkenberg, B. Vander Ley, N. Decaro, BW Brodersen, A. Harmon, B. Hessman, EF Flores, JF Ridpath / Journal of Clinical Microbiology. - November 2014 Volume 52 Number 11 p. 3845-3852 )

Коммерческие наборы ИФА для обнаружения антител к вирусу ВД-БС КРС дают ложноотрицательный результат при тестировании проб сыворотки крови от телят, инфицированных HoBi-подобными вирусами, т.к. вследствие различий генома вирусов не выявляют его.Commercial ELISA kits for detecting antibodies to the VD-BS virus of cattle give a false negative result when testing blood serum samples from calves infected with HoBi-like viruses, because due to differences in the genome of viruses, it is not detected.

Наиболее приемлемым, с точки зрения описанных недостатков и принятым за прототип, является способ, основанный на ОТ-ПЦР для выявления РНК атипичного пестивируса при помощи специфических праймеров: SF1 5' - GACTAGTGGTGGCAGTGAGC - 3' и SR1 5' -GCAGCTTCCTACCCAGATGG - 3'.The most acceptable, from the point of view of the described disadvantages and adopted as a prototype, is a method based on RT-PCR for the detection of atypical pestivirus RNA using specific primers: SF1 5 '- GACTAGTGGTGGCAGTGAGC - 3' and SR1 5 '-GCAGCTTCCTACCCAGATGG - 3'.

В ходе реакции со штаммами и изолятами атипичного пестивируса синтезируется фрагмент размером 753 п.н. (Liu L. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA/cont-08 / Lihong Liu, Hongyan Xia, Claudia Baule, Sandor Belak // Arch. Virol. - 2009. - №154. - P. 1111-1116).During the reaction with strains and isolates of the atypical pestivirus, a fragment of 753 bp is synthesized. (Liu L. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA / cont-08 / Lihong Liu, Hongyan Xia, Claudia Baule, Sandor Belak // Arch. Virol. - 2009 .-- No. 154. - P. 1111-1116).

К недостаткам данного способа можно отнести отсутствие данных по чувствительности, так как авторы не привели их.The disadvantages of this method include the lack of sensitivity data, since the authors did not cite them.

Техническим результатом изобретения является разработка высокоспецифичного и чувствительного способа на основе ОТ-ПЦР, позволяющего выявлять РНК атипичного пестивируса в образцах эмбриональных сывороток и пробах биоматериала, полученных от крупного рогатого скота.The technical result of the invention is the development of a highly specific and sensitive method based on RT-PCR, which allows the detection of atypical pestivirus RNA in samples of fetal sera and samples of biomaterial obtained from cattle.

Указанный технический результат решается тем, что подобраны и синтезированы синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса в образцах эмбриональных сывороток и пробах биоматериала от крупного рогатого скота и согласно изобретению праймеры имеют нуклеотидные последовательности: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'.The specified technical result is solved by the fact that synthetic oligonucleotide primers were selected and synthesized to detect atypical pestivirus RNA in samples of embryonic sera and samples of biomaterial from cattle and according to the invention, the primers have the nucleotide sequences: SEQ ID NO: 1 - 5 'tttgcagccgagcgtag 3 ID NO: 2 - 5 'cctcctgcatactgtcacctt 3'.

Указанный технический результат решается также тем, что в способе выявления РНК атипичного пестивируса с помощью синтетических олигонуклеотидных праймеров в ОТ-ПЦР, включающем выделение РНК из образцов эмбриональных сывороток и проб биоматериала и проведение полимеразной цепной реакции, согласно изобретению используют синтетические олигонуклеотидные праймеры SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3', полимеразную цепную реакцию проводят в 1 раунд, и при получении фрагмента, соответствующего размеру 320 п.н., выявляют РНК атипичного пестивируса.The specified technical result is also solved by the fact that in the method for detecting RNA of atypical pestivirus using synthetic oligonucleotide primers in RT-PCR, including the isolation of RNA from samples of embryonic sera and biomaterial samples and polymerase chain reaction, synthetic oligonucleotide primers SEQ ID NO are used according to the invention: 1 - 5 'tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5 'cctcctgcatactgtcacctt 3', the polymerase chain reaction is carried out in 1 round, and upon receipt of a fragment corresponding to a size of 320 bp, atypical RNA is detected pestivirus.

Изобретение иллюстрируется следующими примерами.The invention is illustrated by the following examples.

Пример 1. Получение синтетических олигонуклеотидных праймеровExample 1. Obtaining synthetic oligonucleotide primers

Для расчета олигонуклеотидных праймеров проводили выравнивание известных нуклеотидных последовательностей штаммов BVDV-1, BVDV-2, BVDV-3 (атипичный пестивирус), а также последовательности других близкородственных вирусов с помощью программы ClustalW (Thompson et al., 1994). Для BVDV-3 были найдены несколько видоспецифичных районов, внутри каждого из них с помощью программы Oligo v. 6.31 были подобраны олигонуклеотидные праймеры, обеспечивающие специфическую амплификацию РНК вируса.To calculate oligonucleotide primers, known nucleotide sequences of strains BVDV-1, BVDV-2, BVDV-3 (atypical pestivirus), and also sequences of other closely related viruses were aligned using the ClustalW program (Thompson et al., 1994). Several species-specific areas were found for BVDV-3, within each of them using the Oligo v. 6.31 were selected oligonucleotide primers that provide specific amplification of the RNA of the virus.

Окончательный выбор праймеров основывается на следующих критериях: высокий индекс сходства фрагмента и РНК различных штаммов атипичного пестивируса, высокая температура отжига (GC-метод), большая длина консенсусов, отсутствие гетеродуплексов.The final selection of primers is based on the following criteria: high similarity index of the fragment and RNA of various atypical pestivirus strains, high annealing temperature (GC-method), long consensus lengths, and the absence of heteroduplexes.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.The chemical synthesis of primers is carried out by the amidophosphite method on an ASM-102U automatic synthesizer. The concentration of synthetic oligonucleotide primers in the mother liquor is determined by spectrometric method.

Таким образом, были выбраны синтетические олигонуклеотидные праймеры, комплементарные позициям 9202-9218 и 9501-9521 генома штамма D32/00_'HoBi' атипичного пестивируса КРС (АВ871953.1):Thus, synthetic oligonucleotide primers were selected that are complementary to positions 9202-9218 and 9501-9521 of the genome of strain D32 / 00_'HoBi 'of atypical cattle pestivirus (AB871953.1):

SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3',SEQ ID NO: 1 - 5 'tttgcagccgagcgtag 3',

SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'SEQ ID NO: 2 - 5 'cctcctgcatactgtcacctt 3'

Пример 2. Способ выявления РНК атипичного пестивируса с помощью синтетических олигонуклеотидных праймеров в ОТ-ПЦР в образцах коммерческих эмбриональных сывороток и пробах биоматериала от крупного рогатого скотаExample 2. A method for detecting atypical pestivirus RNA using synthetic oligonucleotide primers in RT-PCR in samples of commercial embryonic sera and samples of biomaterial from cattle

Способ осуществляется в несколько этапов.The method is carried out in several stages.

Этап 1. Выделение РНК атипичного пестивируса КРСStage 1. RNA isolation of atypical cattle pestivirus

Выделение РНК вируса осуществляют стандартным способом с использованием коммерческого набора «Рибо - сорб» производства ФБУН ЦНИИЭ Роспотребнадзора.Isolation of the RNA of the virus is carried out in a standard way using the commercial Ribo-Sorb kit manufactured by the Federal State Institution of Research and Education of the Federal Service for Supervision of Consumer Rights Protection and Human Welfare.

Этап 2. Проведение реакции обратной транскрипции для получения кДНКStep 2. Conducting a reverse transcription reaction to obtain cDNA

Осуществляют стандартным способом с использованием коммерческого набора «Реверта-L» того же производителя.It is carried out in a standard way using a commercial Revert-L kit of the same manufacturer.

В пробирку, содержащую 9,5 мкл реакционной смеси: буфер для ОТ (50 mM Tris-HCl [рН 8.3], 3 мМ MgCl2, 75 mM KCl, 10 мМ DTT), 0,1 мМ dNTP, 0,1 мкг праймера для ОТ) и 0,5 мкл ревертазы из набора «Реверта-L», добавляют 10 мкл РНК-пробы, осторожно перемешивают и помещают в термостат 37°С на 30 минут. Затем добавляют 20 мкл ДНК-буфера, тщательно перемешивают и используют для постановки ПЦР.To a tube containing 9.5 μl of the reaction mixture: RT buffer (50 mM Tris-HCl [pH 8.3], 3 mM MgCl2, 75 mM KCl, 10 mM DTT), 0.1 mM dNTP, 0.1 μg primer for OT) and 0.5 μl of the reverse revertase from the Revert-L kit, add 10 μl of the RNA sample, mix gently and place in a 37 ° C thermostat for 30 minutes. Then add 20 μl of DNA buffer, mix thoroughly and use for PCR.

Этап 3. Амплификация участка кДНК атипичного пестивирусаStage 3. Amplification of the cDNA site of atypical pestivirus

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров в реакционной смеси; температура отжига праймеров.The amplification conditions were optimized by the following parameters: the concentration of magnesium ions in the reaction mixture; the concentration of primers in the reaction mixture; primer annealing temperature.

Оптимизированный состав реакционной смеси включал следующие компоненты: ПЦР-буфер (60 mM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 mM KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, по 0,1 мкг каждого праймера, 1.25 U Taq-ДНК-полимеразы, 5 мкл кДНК.The optimized composition of the reaction mixture included the following components: PCR buffer (60 mM Tris-HCl [pH 8.5], 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptanol, 0.1% Triton X-100), 0, 2 mM dNTP, 0.1 μg of each primer, 1.25 U Taq DNA polymerase, 5 μl of cDNA.

Температурный режим проведения ПЦР: 95°С - 5 мин - 1 цикл; 95°С - 45 сек, 60°С - 45 сек, 72°С - 1 мин - 40 циклов; 72°С - 5 мин - 1 цикл.The temperature regime of PCR: 95 ° C - 5 min - 1 cycle; 95 ° С - 45 sec, 60 ° С - 45 sec, 72 ° С - 1 min - 40 cycles; 72 ° C - 5 min - 1 cycle.

Этап 4. Определение размера продуктов ПЦРStep 4. Sizing PCR Products

Продукты ПЦР анализируют методом электрофореза в 2%-ном агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике. Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».PCR products are analyzed by electrophoresis in a 2% agarose gel in standard Tris-borate buffer (pH 8.0) by a standard method. The results of electrophoresis are taken into account when viewing the gel in ultraviolet light with a wavelength of 254 nm on a Transilluminator instrument.

Используют маркер молекулярного веса 100 п.н. Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру фрагмента в 320 нуклеотидных пар.A molecular weight marker of 100 bp was used. The PCR result is considered positive if the PCR product corresponds to a fragment size of 320 nucleotide pairs.

Пример 3. Определение чувствительности и специфичности ПЦР по заявленному способуExample 3. Determination of the sensitivity and specificity of PCR according to the claimed method

Методом молекулярной трансформации компетентных бактериальных клеток Escherichia coli плазмидой pDrive, содержащей специфические ДНК вставки, для контроля амплификации получают положительный контрольный образец (ПКО).By the method of molecular transformation of competent bacterial cells of Escherichia coli with plasmid pDrive containing specific DNA inserts, a positive control sample (PSC) is obtained to control amplification.

Концентрацию плазмидной ДНК определяют с использованием набора реагентов Quant-iT dsDNA, HS (Invitrogen, США) и флуориметра QUBIT (Invitrogen, США). Концентрация плазмидной ДНК составляет 0,333 мкг/мкл, что в пересчете на количество копий соответствует 7,4*10¹⁰ копий/мкл.The concentration of plasmid DNA was determined using a set of reagents Quant-iT dsDNA, HS (Invitrogen, USA) and a QUBIT fluorimeter (Invitrogen, USA). The concentration of plasmid DNA is 0.333 μg / μl, which in terms of the number of copies corresponds to 7.4 * 10 ¹⁰ copies / μl.

Для определения чувствительности реакции готовят 10-кратные разведения ПКО и каждое разведение подвергают исследованию в ПЦР.To determine the sensitivity of the reaction, 10-fold dilutions of FFP are prepared and each dilution is subjected to PCR analysis.

За аналитическую чувствительность принимают последнее разведение ПКО, с которым результат ПЦР-анализа интерпретировался как положительный.For analytical sensitivity, the last dilution of FFP is taken, with which the result of PCR analysis was interpreted as positive.

Чувствительность разработанной ПЦР составила 7,4*10^-1 копий/мкл.The sensitivity of the developed PCR was 7.4 * 10 ^-1 copies / μl.

Результаты опытов по определению чувствительности ПЦР представлены в таблице 1.The results of experiments to determine the sensitivity of PCR are presented in table 1.

Результаты опытов по определению специфичности реакции по заявленному способу представлены в таблице 2.The results of experiments to determine the specificity of the reaction according to the claimed method are presented in table 2.

Таким образом, предлагаемый способ обладает высокой чувствительностью (7,4*10^-1 копий/мкл) и специфичностью при выявлении РНК атипичного пестивируса.Thus, the proposed method has high sensitivity (7.4 * 10 ^-1 copies / μl) and specificity in the detection of atypical pestivirus RNA.

Пример 4. Выявление РНК атипичного пестивируса КРС в образцах эмбриональных сывороток крупного рогатого скота и пробах биологического материала, полученного от больных и инфицированных животных.Example 4. The detection of RNA of atypical pestivirus cattle in samples of fetal serum of cattle and samples of biological material obtained from sick and infected animals.

Исследованию на атипичный пестивирус подвергают образцы коммерческих эмбриональных сывороток КРС, используемых для культивирования культур клеток и производства биопрепаратов в ветеринарии, и пробы сывороток крови, лимфатических узлов, селезенки, легких от КРС с подозрениями на инфицирование пестивирусами.Samples of commercial fetal cattle serum used for culturing cell cultures and production of biological products in veterinary medicine and samples of blood serum, lymph nodes, spleen, lung from cattle with suspected infection with pestiviruses are tested for atypical pestivirus.

Пробы сывороток крови отбирают в объеме не менее 1 мл, из органов и тканей вырезают кусочки размером 1×1×1 см³.Serum samples are taken in a volume of at least 1 ml, pieces 1 × 1 × 1 cm ³ are cut from organs and tissues.

Образцы эмбриональных сывороток и сывороток крови от больных животных используют для выделения РНК без предварительной подготовки.Samples of fetal sera and blood sera from diseased animals are used to isolate RNA without prior preparation.

Пробы органов и тканей перед исследованием растирают в отдельных фарфоровых ступках со стерильным песком пестиком, добавляют 5-10 мл стерильного физиологического раствора и тщательно перемешивают. Смесь переносят в пластиковые пробирки емкостью 1,5 мл, центрифугируют при 10×10³ об/мин в течение 5 минут. Для выделения РНК используют 100 мкл осветленной надосадочной жидкости.Samples of organs and tissues before testing are ground in separate porcelain mortars with sterile pestle sand, add 5-10 ml of sterile physiological saline and mix thoroughly. The mixture is transferred into plastic tubes with a capacity of 1.5 ml, centrifuged at 10 × 10 ³ rpm for 5 minutes. 100 μl of clarified supernatant are used to isolate RNA.

Дальнейшая процедура согласно примеру 1.The further procedure according to example 1.

Всего предлагаемым способом было исследовано 18 образцов эмбриональных сывороток, 460 проб сыворотки крови и 112 проб внутренних органов КРС.In total, the proposed method examined 18 samples of embryonic sera, 460 samples of blood serum and 112 samples of internal organs of cattle.

Результаты опытов по определению эффективности реакции при исследовании эмбриональных сывороток крупного рогатого скота по заявленному способу представлены в таблице 3.The results of experiments to determine the effectiveness of the reaction in the study of embryonic serum of cattle by the claimed method are presented in table 3.

По заявленному способу количество положительных проб эмбриональных сывороток составило 38,89%.According to the claimed method, the number of positive samples of embryonic sera was 38.89%.

Для подтверждения специфичности полученных фрагментов РНК определяли их нуклеотидную последовательность с использованием набора BigDye 3.1 (Applied Biosystems, США) с последующей очисткой на сефадексе G-50 superfine. Секвенирование ПЦР-фрагментов проводили по обеим цепям ДНК. Расшифровку первичных данных секвенирования (хроматограмм) проводили с помощью программы Sequencher v. 4.0.5 (Gene Codes Corporation, США).To confirm the specificity of the obtained RNA fragments, their nucleotide sequence was determined using the BigDye 3.1 kit (Applied Biosystems, USA), followed by purification on Sephadex G-50 superfine. Sequencing of PCR fragments was performed on both DNA strands. The decoding of the primary sequencing data (chromatograms) was carried out using Sequencher v. 4.0.5 (Gene Codes Corporation, USA).

Анализ нуклеотидных последовательностей синтезируемых фрагментов проводили методами выравнивания с опубликованными последовательностями других штаммов BVDV-3 (в частности, BVDV3_D32/00 и BVDV3_Th/04_Khonkaen) с помощью программы ClustalW (Thompson et al., 1994).The analysis of the nucleotide sequences of the synthesized fragments was carried out by alignment methods with published sequences of other strains of BVDV-3 (in particular, BVDV3_D32 / 00 and BVDV3_Th / 04_Khonkaen) using the ClustalW program (Thompson et al., 1994).

Дендрограммы были построены без укоренения методом ближайшего соседа (NJ - Neighbor Joining) при использовании 2-параметровой модели Кимуры в программе MEGA v. 4 (Tamura et al., 2007). Для оценки достоверности топологии использовался бутстрэп-тест (1000 репликаций) (Felsenstein, 1985). Результаты филогенетического анализа показали, что все семь проанализированных образцов группируются с ВД-КРС-3 штамм D32/00 (Бразильская группа).Dendrograms were constructed without rooting by the Neighbor Joining method (NJ - Neighbor Joining) using the 2-parameter Kimura model in the MEGA v program. 4 (Tamura et al., 2007). To assess the reliability of the topology, a bootstrap test (1000 replications) was used (Felsenstein, 1985). The results of phylogenetic analysis showed that all seven analyzed samples are grouped with VD-KRS-3 strain D32 / 00 (Brazilian group).

На фигуре представлена дендрограмма: 9 штаммов ВД-КРС-3, построенная на основе нуклеотидных последовательностей с позициями 9219-9500 относительно атипичного пестивируса штамм D32/00, с использованием метода ближайшего соседа (NJ) при использовании 2-параметровой модели Кимуры в программе MEGA v. 4. В узлах ветвей показаны коэффициенты поддержки бутстрэп-теста (для 1000 псевдореплик). На каждой ветке обозначено название соответствующего штамма атипичного пестивируса.The figure shows the dendrogram: 9 strains of VD-KRS-3, constructed on the basis of nucleotide sequences with positions 9219-9500 relative to the atypical pestivirus strain D32 / 00, using the nearest neighbor method (NJ) using the 2-parameter Kimura model in the MEGA v program . 4. The branches of the branches show the support factors for the bootstrap test (for 1000 pseudo-replicas). On each branch the name of the corresponding strain of atypical pestivirus is indicated.

Результаты исследования проб сыворотки крови и биоматериала от животных в ПЦР на атипичный пестивирус были отрицательны.The results of the study of samples of blood serum and biomaterial from animals in PCR for atypical pestivirus were negative.

Таким образом, предлагаемый способ обладает высокой чувствительностью (7,4*10^-1 копий/мкл), специфичностью и эффективностью при выявлении РНК атипичного пестивируса в образцах эмбриональных сывороток крупного рогатого скота.Thus, the proposed method has high sensitivity (7.4 * 10 ^-1 copies / μl), specificity and effectiveness in detecting atypical pestivirus RNA in samples of cattle embryonic sera.

Claims

1. Synthetic oligonucleotide primers for detecting RNA of atypical cattle pestivirus, characterized in that the primers have nucleotide sequences: SEQ ID NO: 1 - 5 'tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5 'cctcctgcatactgtcacctt 3.

2. A method for detecting atypical cattle pestivirus RNA using synthetic oligonucleotide primers in a polymerase chain reaction, comprising isolating RNA from samples of samples of fetal serum and biomaterial from cattle and carrying out a polymerase chain reaction, characterized in that synthetic oligonucleotide primers SEQ are used NO: 1 - 5 'tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5 'cctcctgcatactgtcacctt 3', polymerase chain reaction is carried out in 1 round, upon receipt of a fragment corresponding to a size of 320 bp, diagnostician the presence of atypical cattle pestivirus.