RU2766344C1 - Method for detection and identification of coronaviruses in cattle - Google Patents
Method for detection and identification of coronaviruses in cattle Download PDFInfo
- Publication number
- RU2766344C1 RU2766344C1 RU2021120279A RU2021120279A RU2766344C1 RU 2766344 C1 RU2766344 C1 RU 2766344C1 RU 2021120279 A RU2021120279 A RU 2021120279A RU 2021120279 A RU2021120279 A RU 2021120279A RU 2766344 C1 RU2766344 C1 RU 2766344C1
- Authority
- RU
- Russia
- Prior art keywords
- bcov
- hcov
- samples
- cattle
- detection
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
Description
Изобретение относится к биотехнологии, а именно к генетической инженерии, и может быть использовано в ветеринарной вирусологии для диагностики инфекционных заболеваний сельскохозяйственных животных, в частности, коронавирусной инфекции крупного рогатого скота, а также для идентификации вирусов, выявленных у крупного рогатого скота.The invention relates to biotechnology, namely to genetic engineering, and can be used in veterinary virology for the diagnosis of infectious diseases of farm animals, in particular, cattle coronavirus infection, as well as for the identification of viruses found in cattle.
Возбудитель коронавирусной инфекции крупного рогатого скота (Bovine Coronavirus (BCoV)) является РНК-содержащим вирусом, относящимся к виду Betacoronavirus 1, роду Betacoronavirus семейства Coronaviridae [Taxonomy browser (Betacoronavirus 1). www.ncbi.nlm.nih.gov.]. Вирион имеет оболочку, диаметром 120 нм, а геном представлен одноцепочечной (+) РНК размером 27-32 Кб.The causative agent of coronavirus infection in cattle (Bovine Coronavirus (BCoV)) is an RNA-containing virus belonging to the species Betacoronavirus 1, the genus Betacoronavirus of the family Coronaviridae [Taxonomy browser (Betacoronavirus 1). www.ncbi.nlm.nih.gov.]. The virion has an envelope with a diameter of 120 nm, and the genome is represented by a single-stranded (+) RNA with a size of 27-32 Kb.
К виду Betacoronavirus 1 кроме BCoV относятся Canine respiratory coronavirus, Dromedary camel coronavirus HKU23, Equine coronavirus, Human coronavirus OC43 (HCoV-OC43), Porcine hemagglutinating encephalomyelitis virus, Yak coronavirus (https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=694003&lvl=3&lin=f&keep=l&srchmode=l&unlock). На основании изучения биологических, антигенных и генетических характеристик было предложено классифицировать эти вирусы как варианты по диапазону хозяев, а не как отдельные виды вирусов (Bovine-like coronaviruses in domestic and wild ruminants. Amer HM. Anim Health Res Rev. 2018 Dec; 19(2): 113-124).Betacoronavirus 1, in addition to BCoV, includes Canine respiratory coronavirus, Dromedary camel coronavirus HKU23, Equine coronavirus, Human coronavirus OC43 (HCoV-OC43), Porcine hemagglutinating encephalomyelitis virus, Yak coronavirus (https://www.ncbi.nlm.nih.gov/ Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=694003&lvl=3&lin=f&keep=l&srchmode=l&unlock). Based on the study of biological, antigenic and genetic characteristics, it has been proposed to classify these viruses as variants by host range, and not as separate types of viruses (Bovine-like coronaviruses in domestic and wild ruminants. Amer HM. Anim Health Res Rev. 2018 Dec; 19( 2): 113-124).
Геном вируса кодирует пять структурных белков: нуклеокапсид (N), трансмембранный белок (М), гемагглютининэстераза (НЕ), шип (S) и малые мембранные (Е) белки. Шип S состоит из двух субъединиц (S1 и S2) и играет важную роль во взаимодействии вируса с клеткой хозяина. Ген нуклеокапсида N представляет наиболее консервативную область генома и считается лучшей мишенью для обнаружения геномной РНК.The viral genome encodes five structural proteins: nucleocapsid (N), transmembrane protein (M), hemagglutinin esterase (HE), spike (S), and small membrane (E) proteins. The S spike consists of two subunits (S1 and S2) and plays an important role in the interaction of the virus with the host cell. The nucleocapsid N gene represents the most conserved region of the genome and is considered the best target for genomic RNA detection.
Инфекции BCoV связаны с диарейным синдромом у новорожденных телят, инфекциями дыхательных путей у молочных телят и откормочного скота, а также зимней дизентерией у взрослых животных. Несмотря на некоторые различия в гене шипа (S) между кишечными и респираторными изолятами, антигенные или генетические маркеры, позволяющие различать их между собой, до сих пор не выявлены.BCoV infections are associated with diarrheal syndrome in newborn calves, respiratory tract infections in dairy calves and fatteners, and winter dysentery in adult animals. Despite some differences in the spike gene (S) between intestinal and respiratory isolates, antigenic or genetic markers that allow them to be distinguished from each other have not yet been identified.
Геном BCoV на 98% совпадает с геномом штамма вируса HCoV-ОС43, выделенного от человека и вызывающего 10-15% всех сезонных респираторных инфекции у людей. Недавние исследования показали, что BCoV и HCoV-OC43 имеют общего предка, a HCoV-OC43 выделяли от крупного рогатого скота при респираторных болезнях, которые протекали в легкой форме. Также есть сообщения о выделении BCoV от человека при кишечной форме, от собак и лошадей - при респираторном заболевании (Lim, Y.X.; Ng, Y.L.; Tam, J.P.; Liu, D.X. Human Coronaviruses: A Review of Virus-Host Interactions. Diseases. 2016; 4: 26).The BCoV genome is 98% identical to the genome of the HCoV-OC43 virus strain isolated from humans and causing 10-15% of all seasonal respiratory infections in humans. Recent studies have shown that BCoV and HCoV-OC43 share a common ancestor, and HCoV-OC43 was isolated from cattle with mild respiratory disease. There are also reports of isolation of BCoV from humans in the intestinal form, from dogs and horses in respiratory disease (Lim, YX; Ng, YL; Tam, JP; Liu, DX Human Coronaviruses: A Review of Virus-Host Interactions. Diseases. 2016 ; 4:26).
Таким образом, при проведении диагностических мероприятий для определения этиологии вспышек респираторной инфекции у крупного рогатого скота в конкретном хозяйстве, помимо выявления BCoV, необходимо также идентифицировать HCoV-OC43, в короткие сроки, наиболее экономичным и эффективным способом. Однако существующие в настоящее время методы диагностики не позволяют этого сделать.Thus, when carrying out diagnostic measures to determine the etiology of outbreaks of respiratory infection in cattle in a particular farm, in addition to detecting BCoV, it is also necessary to identify HCoV-OC43, in a short time, in the most economical and effective way. However, the current diagnostic methods do not allow this.
Широко используется на практике иммунохроматографический тест для качественного выявления коронавируса крупного рогатого скота (D. Klein, A. Kern, G. Lapan, V. Benetka, K. Mostl, A. Hassl, W. Baumgartner. Evaluation of rapid assays for the detection of bovine coronavirus, rotavirus A and Cryptosporidium parvum in faecal samples of calves. Vet J. 2009 Dec; 182(3):484-6). При высокой специфичности (95,7%) этот метод обладает низкой эффективностью (65%), применяется только для выявления вируса в пробах кала и не способен идентифицировать различные генетические его варианты.The immunochromatographic test for the qualitative detection of coronavirus in cattle is widely used in practice (D. Klein, A. Kern, G. Lapan, V. Benetka, K. Mostl, A. Hassl, W. Baumgartner. Evaluation of rapid assays for the detection of bovine coronavirus, rotavirus A and Cryptosporidium parvum in faecal samples of calves Vet J. 2009 Dec; 182(3):484-6). With high specificity (95.7%), this method has low efficiency (65%), is used only to detect the virus in stool samples and is not able to identify its various genetic variants.
До настоящего времени основным способом выявления коронавирусов и их идентификации является выделение вируса в культуре клеток с последующим типированием с помощью специфических сывороток. Выделение BCoV в культуре клеток затруднено ввиду его чрезвычайной лабильности и возможно только на ранней стадии инфекции (Сюрин В.Н., Самуйленко А.Я., Соловьев Б.В., Фомина Н.В. Вирусные болезни животных. - М.: ВНИТИБП. - 1998. - 928 с.). Таким образом, основным недостатком выделения BCoV в культуре клеток и определения его варианта является длительность осуществления процедуры до одного и более месяца.Until now, the main way to detect coronaviruses and their identification is the isolation of the virus in cell culture, followed by typing using specific sera. Isolation of BCoV in cell culture is difficult due to its extreme lability and is possible only at an early stage of infection (Syurin V.N., Samuylenko A.Ya., Solovyov B.V., Fomina N.V. Viral diseases of animals. - M .: VNITIBP . - 1998. - 928 p.). Thus, the main disadvantage of isolating BCoV in cell culture and determining its variant is the duration of the procedure, up to one or more months.
Известен способ секвенирования всего генома вируса. Для этого необходимо выделить вирус в культуре клеток, провести амплификацию с 6 парами праймеров (1F TGCATCCCGCTTCACTGATCTCTT, 1R CACCTACAGGCACAAACCTGTTAGTG, 2F GCACTTGATGATGA-TGCACGAACC, 2R GGTGGTTGGTAAAGC АС АТС ACT АСС, 3F GCCACGCTTTATTTCCCTTGG-GAGAT, 3R GAACACCACGTGTAGCTGCTAT-AC, 4F GAGGAGCAGGATGAAA-TTTACGCC, 4R ACATCCTGACCCT-CTTTACGCACA, 5F GACGTGTGTTGGAA-GCACGTCATTTG, 5R GTAAAAACACCTGCAGGTTGAGGC, 6F GTGCGAGTACCCA-CATACGATTTG, 6R CTGGGTGGTAACTTAACATGCTGG) для синтеза 6 перекрывающихся фрагментов генома вируса и провести их секвенирование (Genomic Characterization and Phylogenetic Classification of Bovine Coronaviruses Through Whole Genome Sequence Analysis. Suzuki T, Otake Y, Uchimoto S, Hasebe A, Goto Y. Viruses. 2020 Feb 6; 12 (2): 183).A known method of sequencing the entire genome of the virus. For this it is necessary to isolate the virus in cell culture, to carry out amplification with 6 pairs of primers (1F TGCATCCCGCTTCACTGATCTCTT, 1R CACCTACAGGCACAAACCTGTTAGTG, 2F GCACTTGATGATGA-TGCACGAACC, 2R GGTGGTTGGTAAAGC AC ATC ACT ACC, 3F GCCACGCTTTATTTCCCTTGG-GAGAT, 3R GAACACCACGTGTAGCTGCTAT-AC, 4F GAGGAGCAGGATGAAA-TTTACGCC, 4R ACATCCCTGACCCT-CTTTACGCACA, 5F GACGTGTGTTGGAA-GCACGTCATTTG, 5R GTAAAAACACCTGCAGGTTGAGGC, 6F GTGCGAGTACCCA-CATACGATTTG, 6R CTGGGTGGTAACTTAACATGCTGG) to synthesize 6 overlapping virus genome fragments and conduct their sequencing (Gentake Geece Characterization and Phylogenetic Onomic Classification of Bologo- menemic Y, Uchimoto S, Hasebe A, Goto Y. Viruses 2020 Feb 6;12 (2): 183).
Однако этот способ очень длительный, дорогостоящий и не подходит для рутинной лабораторной диагностики заболевания.However, this method is very long, expensive and not suitable for routine laboratory diagnosis of the disease.
Наиболее приемлемым с точки зрения описанных недостатков и принятым за прототип является способ, основанный на применении полу гнездовой ПЦР и последующего секвенирования ампликонов. Для обнаружения BCoV проводят полу гнездовую ОТ-ПЦР с использованием видоспецифических праймеров на ген, кодирующий протеин нуклеокапсида N. На первом этапе реакцию проводят с праймерами BCoV2 (5'AGAGCTCAAYCCAAGCAA ACTGY 3') и BCoV2 (5'AG CAGACCTTCCTGAGCCTTCAAT 3'), а на втором этапе с праймерами BCoV1l (5'AGAGCTCAAYCCAAGCAA ACTGY 3') и BCoV3 (5'TCAATRTCGGTGCC ATACTGGTCT 3') с последующим секвенированием ампликонов для определения их последовательности и построения филогенетического дерева. (Genetic diversity of BCoV in Brazilian cattle herds. de Mira Fernandes A, Brandao PE, Dos Santos Lima M, de Souza Nunes Martins M, da Silva TG, da Silva Cardoso Pinto V, de Paula LT, Vicente MES, Okuda LH, Pituco EM. Vet Med Sci. 2018 Apr 24; 4(3): 183-189).The most acceptable from the point of view of the described shortcomings and taken as a prototype is a method based on the use of semi-nested PCR and subsequent amplicon sequencing. To detect BCoV, semi-nested RT-PCR is performed using species-specific primers for the gene encoding the N nucleocapsid protein. the second stage with primers BCoV1l (5'AGAGCTCAAYCCAAGCAA ACTGY 3') and BCoV3 (5'TCAATRTCGGTGCC ATACTGGTCT 3'), followed by sequencing of the amplicons to determine their sequence and build a phylogenetic tree. (Genetic diversity of BCoV in Brazilian cattle herds. de Mira Fernandes A, Brandao PE, Dos Santos Lima M, de Souza Nunes Martins M, da Silva TG, da Silva Cardoso Pinto V, de Paula LT, Vicente MES, Okuda LH, Pituco EM Vet Med Sci 2018 Apr 24;4(3): 183-189).
К недостаткам данного способа можно отнести то, что реакция проводится в электрофоретическом формате и требуется длительное время для постановки диагноза.The disadvantages of this method include the fact that the reaction is carried out in an electrophoretic format and it takes a long time to make a diagnosis.
Технической задачей изобретения являлась разработка высокоспецифичного и чувствительного способа на основе полимеразной цепной реакции (ПЦР) с использованием гибридизационно-флуоресцентной детекции в режиме реального времени, позволяющего выявлять и проводить типирование BCoV и HCoV-OC43 в пробах биологического материала различного происхождения.The technical objective of the invention was the development of a highly specific and sensitive method based on the polymerase chain reaction (PCR) using real-time hybridization-fluorescence detection, which allows the detection and typing of BCoV and HCoV-OC43 in samples of biological material of various origins.
Сущность изобретения заключается в том, что предложены синтетические олигонуклеотидные праймеры и зонды для выявления РНК BCoV и HCoV-OC43, согласно изобретению, синтетические олигонуклеотидные праймеры и зонды имеют нуклеотидные последовательности: SEQ ID NO: 1-7.The essence of the invention lies in the fact that proposed synthetic oligonucleotide primers and probes for detecting BCoV and HCoV-OC43 RNA, according to the invention, synthetic oligonucleotide primers and probes have nucleotide sequences: SEQ ID NO: 1-7.
Сущность изобретения заключается также в том, что в способе выявления и идентификация коронавирусов у крупного рогатого скота, включающем выделение РНК из проб образцов культур клеток, эмбриональных сывороток и проб биоматериала от крупного рогатого скота, проведение обратной транскрипции и полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией в режиме реального времени, согласно изобретения, используют синтетические олигонуклеотидные праймеры и зонды SEQ ID NO: 1 - 7, исследование каждой пробы проводят методом мультиплексной ПЦР для одновременного выявления штаммов и изолятов вируса BCoV и HCoV-OC43.The essence of the invention also lies in the fact that in a method for detecting and identifying coronaviruses in cattle, including the isolation of RNA from samples of cell culture samples, fetal sera and biomaterial samples from cattle, reverse transcription and polymerase chain reaction with hybridization-fluorescence detection in real time, according to the invention, synthetic oligonucleotide primers and probes SEQ ID NO: 1 - 7 are used, the study of each sample is carried out by multiplex PCR for the simultaneous detection of strains and isolates of the BCoV and HCoV-OC43 virus.
Изобретение иллюстрируется следующими примерами.The invention is illustrated by the following examples.
Пример 1. Получение синтетических олигонуклеотидных праймеровExample 1 Preparation of Synthetic Oligonucleotide Primers
Поиск новых синтетических олигонуклеотидных праймеров и зондов осуществляют на основе фрагментов гена нуклеокапсида N вариантов BCoV и HCoV-OC43, представленных в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), при помощи пакета программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров и зондов дополнительно тестируют на специфичность с помощью моделирования ПЦР в программе "Vector NTI Suite" с последовательностями генома других представителей семейства Coronaviridae.The search for new synthetic oligonucleotide primers and probes is based on the nucleocapsid gene fragments of N variants of BCoV and HCoV-OC43, presented in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), using software package "Lasergen". The obtained sequences of several pairs of primers and probes are additionally tested for specificity using PCR modeling in the "Vector NTI Suite" program with genome sequences of other members of the Coronaviridae family.
Окончательный выбор праймеров и зондов основывается на следующих критериях: высокий индекс сходства фрагмента и РНК различных штаммов BCoV и HCoV-OC43, высокая температура отжига (GC-метод), большая длина консенсусов. Данные праймеры и зонд должны быть комплементарны только специфическим вариантам.The final choice of primers and probes is based on the following criteria: high fragment and RNA similarity index of various BCoV and HCoV-OC43 strains, high annealing temperature (GC method), long consensus length. These primers and probe should only be complementary to specific variants.
Химический синтез праймеров и зондов осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров и зондов в маточном растворе определяют спектрометрическим методом.The chemical synthesis of primers and probes is carried out by the amidophosphite method on an ASM-102U automatic synthesizer. The concentration of synthetic oligonucleotide primers and probes in the mother liquor is determined by the spectrometric method.
Характеристики выбранных праймеров и зондов представлены в таблице 1.Characteristics of the selected primers and probes are presented in Table 1.
Таким образом, были выбраны синтетические олигонуклеотидные праймеры и зонды, комплементарные высоко консервативной области генома вирусов BCoV и HCoV-OC43 района гена протеина нуклеокапсида N.Thus, synthetic oligonucleotide primers and probes were chosen that are complementary to a highly conserved region of the BCoV and HCoV-OC43 genome of the nucleocapsid N protein gene.
Пример 2. Способ выявления РНК и типирования вариантов коронавируса крупного рогатого скотаExample 2 Method for RNA detection and typing of bovine coronavirus variants
Способ осуществляется в несколько этапов.The method is carried out in several stages.
Этап 1. Выделение РНК вируса
Выделение РНК осуществляют стандартным способом с использованием коммерческого набора «Рибо - сорб» производства ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора.Isolation of RNA is carried out in a standard way using a commercial kit "Ribo-Sorb" produced by Federal State Institution "Central Research Institute of Epidemiology" of Rospotrebnadzor.
Этап 2. Проведение реакции обратной транскрипции для получения кДНК.
Осуществляют стандартным способом с использованием коммерческого набора «Реверта-L» производства того же института.Carried out in a standard way using a commercial kit "Reverta-L" produced by the same institute.
В пробирку, содержащую 9,5 мкл реакционной смеси: буфер для ОТ (50 mM Tris-HCl [рН 8.3], 3 мМ MgCl2, 75 mM KCl, 10 мМ DTT), 0,1 мМ dNTP, 0,1 мкг праймера для ОТ) и 0,5 мкл ревертазы из набора «Реверта-L», добавляют 10 мкл РНК-пробы, осторожно перемешивают и помещают в термостат 37°С на 30 минут. Затем добавляют 20 мкл ДНК-буфера, тщательно перемешивают и используют для постановки ПЦР.To a tube containing 9.5 µl of the reaction mixture: RT buffer (50 mM Tris-HCl [pH 8.3], 3 mM MgCl2, 75 mM KCl, 10 mM DTT), 0.1 mM dNTP, 0.1 µg of primer for OT) and 0.5 µl of revertase from the Reverta-L kit, add 10 µl of the RNA sample, mix gently and place in a thermostat at 37°C for 30 minutes. Then add 20 µl of DNA buffer, mix thoroughly and use for PCR.
Этап 3. Постановка полимеразной цепной реакции
Полимеразная цепная реакция. Состав реакционной смеси: ПЦР-буфер (60 mM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 mM KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, по 0,2 мкг каждого праймера, по 0,1 мкг каждого зонда, 1.25 U Taq-ДНК-полимеразы, 5 мкл кДНК.polymerase chain reaction. Composition of the reaction mixture: PCR buffer (60 mM Tris-HCl [pH 8.5], 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptethanol, 0.1% Triton X-100), 0.2 mM dNTP, 0.2 µg of each primer, 0.1 µg of each probe, 1.25 U of Taq-DNA polymerase, 5 µl of cDNA.
Температурный режим проведения ПЦР: 95°С - 5 мин - 1 цикл; 95°С - 15 сек, 60°С - 60 сек - 55 циклов.Temperature regime for PCR: 95°C - 5 min - 1 cycle; 95°C - 15 sec, 60°C - 60 sec - 55 cycles.
Измерение флуоресценции осуществляют при температуре 60°С на канале FAM для BCoV и на канале ROX для HCoV-OC43. Положительными считают образцы со значением Ct не превышающим 45.Fluorescence measurement is carried out at 60° C. on the FAM channel for BCoV and on the ROX channel for HCoV-OC43. Samples with a Ct value not exceeding 45 are considered positive.
Пример 3. Оценка чувствительности и специфичности выявление РНК вариантов вирусов BCoV и HCoV-OC43 в пробах биологического материала, полученного от больных и инфицированных животных и референтных штаммахExample 3. Evaluation of sensitivity and specificity detection of RNA variants of BCoV and HCoV-OC43 viruses in samples of biological material obtained from sick and infected animals and reference strains
Для оценки контрольный штамм вируса BCoV «КМИЭВ-1» с титром 106,5 ТЦД50/см3 титруют методом 10-кратных разведений на физиологическом растворе до разведения 10-7 степени, каждое разведение подвергают исследованию в ПЦР.To assess the control strain of the BCoV virus "KMIEV-1" with a titer of 10 6.5 TCD50/cm 3 titrated by 10-fold dilutions in saline to a dilution of 10 -7 degree, each dilution is subjected to research in PCR.
Для исследования на наличие РНК вирусов BCoV и HCoV-OC43 используют пробы носовых выделений, смывы со слизистой носа, соскобы со слизистой трахеи, трахеальную и бронхиальную слизь, пробы легких и бронхов, пробы кала, пробы кишечника, лимфоидные органы, кровь.To test for the presence of RNA of BCoV and HCoV-OC43 viruses, samples of nasal secretions, swabs from the nasal mucosa, scrapings from the tracheal mucosa, tracheal and bronchial mucus, samples of the lungs and bronchi, stool samples, intestinal samples, lymphoid organs, blood are used.
Жидкости и пробы слизистых выделений, кала отбирают в объеме не менее 1 мл, из органов вырезают кусочки размером 1x1x1 см3.Liquids and samples of mucous secretions, feces are taken in a volume of at least 1 ml, pieces of 1x1x1 cm 3 in size are cut out from the organs.
Культуральную жидкость, пробы штаммов и изолятов BCoV, HCoV-ОС43, пробы носовых и глазных выделений, трахеальной и бронхиальной слизи, крови используют для выделения РНК без предварительной подготовки.Culture fluid, samples of strains and isolates of BCoV, HCoV-OC43, samples of nasal and eye secretions, tracheal and bronchial mucus, and blood are used for RNA isolation without prior preparation.
Из проб органов, тканей предварительно готовят 10% суспензии на стерильном физиологическом растворе, смесь переносят в пластиковые пробирки емкостью 1,5 мл, центрифугируют на центрифуге при 10x103 об/мин в течение 5 мин. Для выделения РНК используют 100 мкл осветленной надосадочной жидкости, полученной после центрифугирования.From samples of organs and tissues, a 10% suspension is preliminarily prepared in sterile saline, the mixture is transferred into plastic test tubes with a capacity of 1.5 ml, centrifuged in a centrifuge at 10x10 3 rpm for 5 minutes. For RNA isolation, 100 μl of the clarified supernatant obtained after centrifugation is used.
Густые пробы носовых выделений, слизи и кал разводят стерильным физиологическим раствором (примерно 1:5), тщательно перемешивают, центрифугируют при 10x103 об/мин в течение 5 мин и 100 мкл осветленной надосадочной жидкости используют для выделения РНК.Thick samples of nasal secretions, mucus and feces are diluted with sterile saline (approximately 1:5), mixed thoroughly, centrifuged at 10x10 3 rpm for 5 min and 100 μl of the clarified supernatant is used to isolate RNA.
Дальнейшая процедура согласно примеру 2 и 3.Further procedure according to example 2 and 3.
Чувствительность реакции при тестировании десятикратных разведений контрольного штамма BCoV «КМИЭВ-1» с заранее определенной концентрацией, равной 106,5ТЦД50/см3, составила 100,5ТЦД50/см3.The sensitivity of the reaction when testing tenfold dilutions of the control BCoV strain "KMIEV-1" with a predetermined concentration of 10 6.5 TCD50/cm 3 was 10 0.5 TCD50/cm 3 .
С использованием разработанного набора исследовали 1508 проб биоматериала от 116 животных. BCoV выявили в 178 пробах от 30 животных, что составило 11,8% от общего числа исследованных проб, а HCoV-OC43 в 12 пробах, что составило 0,8% от числа исследованных проб.Using the developed kit, 1508 biomaterial samples from 116 animals were studied. BCoV was detected in 178 samples from 30 animals, which accounted for 11.8% of the total number of samples examined, and HCoV-OC43 in 12 samples, which accounted for 0.8% of the number of samples studied.
Для подтверждения специфичности полученных фрагментов РНК определяли их нуклеотидную последовательность с использованием набора BigDye 3.1 (Applied Biosystems, США) с последующей очисткой на сефадексе G-50 superfine. Секвенирование ПЦР-фрагментов проводили по обеим цепям ДНК. Расшифровку первичных данных секвенирования (хроматограмм) проводили с помощью программы Sequencher v.4.0.5 (Gene Codes Corporation, США).To confirm the specificity of the obtained RNA fragments, their nucleotide sequence was determined using the BigDye 3.1 kit (Applied Biosystems, USA) followed by purification on Sephadex G-50 superfine. Sequencing of PCR fragments was carried out for both strands of DNA. The interpretation of primary sequencing data (chromatograms) was performed using the Sequencher v.4.0.5 program (Gene Codes Corporation, USA).
Анализ нуклеотидных последовательностей синтезируемых фрагментов проводили методами выравнивания с опубликованными последовательностями других штаммов короновируса крупного рогатого скота с помощью программы BioEdit 7.0.0. Построение дендрограмм проводили при помощи метода максимальной эволюции в программе MEGA 7. Для оценки достоверности топологии использовали бутстрэп-тест (1000 реплик) (Рисунок 1).Analysis of the nucleotide sequences of the synthesized fragments was carried out by alignment with the published sequences of other strains of bovine coronovirus using the BioEdit 7.0.0 program. The construction of dendrograms was carried out using the maximum evolution method in the MEGA 7 program. To assess the reliability of the topology, a bootstrap test (1000 replicas) was used (Figure 1).
Результаты секвенирования и филогенетического анализа показали принадлежность выявленных участков генома BCoV и HCoV-OC43 и подтвердили достоверность результатов, полученных с помощью разработанного нами метода.The results of sequencing and phylogenetic analysis showed that the identified regions of the genome belong to BCoV and HCoV-OC43 and confirmed the reliability of the results obtained using the method we developed.
Таким образом, предлагаемый способ обладает высокой чувствительностью, специфичностью и эффективностью при выявлении и идентификации BCoV и HCoV-OC43 в пробах биологического материала от животных.Thus, the proposed method has high sensitivity, specificity and efficiency in the detection and identification of BCoV and HCoV-OC43 in samples of biological material from animals.
Claims (2)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2021120279A RU2766344C1 (en) | 2021-07-08 | 2021-07-08 | Method for detection and identification of coronaviruses in cattle |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2021120279A RU2766344C1 (en) | 2021-07-08 | 2021-07-08 | Method for detection and identification of coronaviruses in cattle |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2766344C1 true RU2766344C1 (en) | 2022-03-15 |
Family
ID=80736513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2021120279A RU2766344C1 (en) | 2021-07-08 | 2021-07-08 | Method for detection and identification of coronaviruses in cattle |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2766344C1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2798286C1 (en) * | 2022-06-01 | 2023-06-21 | Федеральное государственное бюджетное учреждение науки Сибирский федеральный научный центр агробиотехнологий Российской академии наук (СФНЦА РАН) | METHOD OF DETECTING PATHOGENS OF RESPIRATORY INFECTIONS IN CATTLE: BPIV, BRSV, BHV-4, BCoV, BVDV-1, BVDV-2, BVDV-3 BASED ON MULTIPLEX POLYMERASE CHAIN REACTION (PCR) |
| CN117385100A (en) * | 2023-10-09 | 2024-01-12 | 华中农业大学 | Fluorescence quantitative PCR detection kit for canine respiratory coronavirus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2694558C1 (en) * | 2018-01-16 | 2019-07-16 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Method for genome detection of coronavirus infection causative agent in cattle |
-
2021
- 2021-07-08 RU RU2021120279A patent/RU2766344C1/en active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2694558C1 (en) * | 2018-01-16 | 2019-07-16 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Method for genome detection of coronavirus infection causative agent in cattle |
Non-Patent Citations (4)
| Title |
|---|
| DE MIRA FERNANDES A. et al. Genetic diversity of BCoV in Brazilian cattle herds, Vet Med Sci, 2018, Apr 24 (3), p. 183-189. * |
| DE MIRA FERNANDES A. et al. Genetic diversity of BCoV in Brazilian cattle herds, Vet Med Sci, 2018, Apr 24 (3), p. 183-189. SUZUKI T. et al. Genomic characterization and Phylogenetic classification of Bovine coronaviruses through whole genome sequence analysis, Viruses, 2020 Feb 6, 12 (2), p.183. КУДРЯВЦЕВ В.А. Использование ПЦР и секвенирования для выявления и анализа генома коронавируса крупного рогатого скота, автореферат диссертации, Владимир, 2004, весь документ. * |
| SUZUKI T. et al. Genomic characterization and Phylogenetic classification of Bovine coronaviruses through whole genome sequence analysis, Viruses, 2020 Feb 6, 12 (2), p.183. * |
| КУДРЯВЦЕВ В.А. Использование ПЦР и секвенирования для выявления и анализа генома коронавируса крупного рогатого скота, авто диссертации, Владимир, 2004, весь документ. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2798286C1 (en) * | 2022-06-01 | 2023-06-21 | Федеральное государственное бюджетное учреждение науки Сибирский федеральный научный центр агробиотехнологий Российской академии наук (СФНЦА РАН) | METHOD OF DETECTING PATHOGENS OF RESPIRATORY INFECTIONS IN CATTLE: BPIV, BRSV, BHV-4, BCoV, BVDV-1, BVDV-2, BVDV-3 BASED ON MULTIPLEX POLYMERASE CHAIN REACTION (PCR) |
| CN117385100A (en) * | 2023-10-09 | 2024-01-12 | 华中农业大学 | Fluorescence quantitative PCR detection kit for canine respiratory coronavirus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Michaud et al. | Long-term storage at tropical temperature of dried-blood filter papers for detection and genotyping of RNA and DNA viruses by direct PCR | |
| Ambagala et al. | Field‐Deployable Reverse Transcription‐Insulated Isothermal PCR (RT‐ii PCR) Assay for Rapid and Sensitive Detection of Foot‐and‐Mouth Disease Virus | |
| Zhu et al. | Rapid and sensitive detection of bovine coronavirus and group a bovine rotavirus from fecal samples by using one-step duplex RT-PCR assay | |
| Zhang et al. | An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood | |
| Reid et al. | Utility of automated real-time RT-PCR for the detection of foot-and-mouth disease virus excreted in milk | |
| Bulut et al. | High prevalence of bovine viral diarrhea virus-1 in sheep abortion samples with pestivirus infection in Turkey. | |
| RU2766344C1 (en) | Method for detection and identification of coronaviruses in cattle | |
| CN106350607B (en) | Taqman real-time fluorescence PCR kit for detecting porcine epidemic diarrhea virus wild strain in porcine umbilical cord blood and application thereof | |
| KR101064866B1 (en) | Primers capable of simultaneous detecting bovine coronavirus, bovine rotavirus and bovine viral diarrhea virus, and simultaneous detection method of diarrhea viruses in ruminants, including cattle, using the same | |
| Yilmaz | Investigation of rotavirus infection in calves with diarrhea in northeast Turkey | |
| Elbaz et al. | Molecular investigation on the presence of canine parvovirus in Egypt | |
| CN103757137B (en) | Common primer nucleic acid amplification method for detecting three pig viruses synchronously and kit | |
| Mazlan et al. | The positive expression of genotype VII Newcastle disease virus (Malaysian isolate) in Japanese quails (Coturnix coturnix japonica) | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle | |
| CN114703179A (en) | RT-RAA-LFD primer pair, probe, test strip, kit for detecting PDCoV and application thereof | |
| Ularamu et al. | Genetic characterization of bovine viral diarrhoea (BVD) viruses: confirmation of the presence of BVD genotype 2 in Africa | |
| Ndiana et al. | Detection and Genetic Characterization of Canine Adenoviruses, Circoviruses, and Novel Cycloviruses from Wild Carnivores in Italy | |
| RU2698662C1 (en) | Test system for detecting rna of agent of arteritis virus in horses | |
| CN106435022A (en) | A type and O type foot and mouth disease virus specific primer and kit | |
| M Salem et al. | Molecular and serological identification of foot-and-mouth disease virus serotypes in cattle of Basrah province | |
| Saeed et al. | First report of Bovine Viral Diarrhea Virus antigen from pneumonic cattle in Sudan. | |
| Afify et al. | First detection of emerging HoBi-like Pestivirus (BVD-3) among some persistently infected dairy cattle herds in Egypt | |
| Cheggag et al. | Diagnosis of clinical cases of infectious bursal disease using a modified rapid taq man-MGB real-time RT-PCR assay | |
| RU2756924C2 (en) | Method for early pcr diagnostics of the aleutian mink disease virus carnivore amdoparvovirus | |
| CN113699219B (en) | Nested PCR (polymerase chain reaction) primer group for simultaneously detecting mycoplasma hyopneumoniae and chlamydia suis and application thereof |