RU2360004C1 - Method of detecting microorganisms of genus salmonella - Google Patents

Abstract

FIELD: veterinary.

SUBSTANCE: invention relates to molecular biology and veterinary medicine and can be used for control of anti-epizootic measures in case of farm animal and poultry salmonellosis. Method includes: selection of biomaterial, DNA isolation, detecting genome DNA of Salmonella genus microorganism in PCR using specially selected primers; for detecting genome DNA of Salmonella genus microorganisms in PCR primers with the following nucleotide sequences are used: 5'-GAGCATATTCGTGGAGCAATG-3' and 5'-AATAACATCCTCAACTTCAGCAG-3 and fluorescent probe Taqman FAM-TGCTCGTAATTCGCCGCCATTGG-suppressor.

EFFECT: method ensures high sensitivity and specificity to microorganisms of genus Salmonella, which allows to detect presence of latter in investigated samples reliably and quantitatively.

2 cl, 4 tbl, 4 ex

Description

The invention relates to molecular biology and veterinary medicine and can be used to control the effectiveness of anti-epizootic measures in salmonellosis of farm animals and poultry.

A known method for detecting DNA of microorganisms of the genus Salmonella (application RU No. 97119187/13, class C12Q 1/68, op. 27.10.1999). To detect salmonella, a genomic polynucleotide locus is detected, which is determined by amplification with primers having the sequence: 5'-GAIIIIGCIGGIGA (T / C) GGIACIACIAC-3 '(SEQ ID 3) or 5' - (T / C) (T / G) I ( T / C) (T / G) ITCICC (A / G) AAICCIGGIGC (T / C) TT-3 '(SEQ ID 4), or primer sequences, mainly complementary to them.

However, this method is not intended for the quantitative determination of microorganisms of the genus Salmonella.

Closest to the claimed prototype method is a method for determining microorganisms of the genus Salmonella, including the selection of biomaterial, DNA isolation and identification of the genomic DNA of microorganisms of the genus Salmonella in PCR using specially selected primers. Genomic DNA of microorganisms of the genus Salmonella in water and in washes from carcasses of chickens is determined using the membrane filtration method of the sample and subsequent Real-time PCR using the fluorescent dye SYBR green I (Wolffs, Petra FG; Glencross, Kari; Thibaudeau, Remain; Griffiths, Mansel W. Direct Quantitation and Detection of Salmonellae in Biological Samples without Enrichment, Using Two-Step Filtration and Real-Time PCR. / Applied & Environmental Microbiology, Jun 2006, vol. 72 Issue 6 (EBSCO) 3896-3900). The known method is not intended to control the quantitative content of salmonella in cloacal swabs, intestinal contents and pathological material.

The disadvantages of this method are the limited functionality and low specificity associated with the likelihood of non-specific positive reactions due to the synthesis of non-specific amplicons.

The technical task of the proposed technical solution is to expand the functionality of the method and increase its specificity and sensitivity.

The stated technical problem is achieved by the proposed method, which consists in quantifying the genomic DNA of microorganisms of the genus Salmonella in poultry and / or farm animals subjected to one or another veterinary measure.

The proposed method is as follows.

As the studied material (sample), cloacal swabs or pathological material of farm birds are used. The selection of material is carried out by any method suitable for subsequent PCR formulation. DNA isolation is produced by any known method. For example, DNA is isolated from a suspension of intestinal contents by a silico-sorption method.

For PCR, the reaction is carried out on any real-time amplifier using a RAM channel with a given temperature regime.

Primers with the following nucleotide sequences are used in the reaction: 5'GAGCATATTCGTGGAGCAATG-3 '(Sm1), 5'-AATAACATCCTCAACTTCAGCAG-3 (Sm2) and a Taqman fluorescent probe FAM-TGCTCGTAATTCGCCGCCATTGG-absorber.

To quantify the reaction, controls are put in place with a known content of microorganisms in the sample, in an amount of at least 4 control points.

The reaction is taken into account by the conventional method using a real-time amplifier based on calibration curves obtained using standard samples with different contents of microorganisms in the sample. The method provides high sensitivity and specificity to microorganisms of the genus Salmonella, which allows reliable and quantitative determination of the presence of the latter in the studied samples.

The defining differences of the proposed method from the prototype are:

1. To identify the genomic DNA of Salmonella microorganisms in PCR, primers with the following nucleotide sequences are used: 5'GAGCATATTCGTGGAGCAATG-3 '(Sm1) and 5'-AATAACATCCTCAACTTCAGCAG-3 (Sm2), which allows to obtain a shorter amplicon (synthesized DNA fragment), providing increased efficiency of the reaction (PCR).

2. For the quantitative determination of the genomic DNA content of Salmonella microorganisms in PCR, a specific probe TGCTCGTAATTCGCCGCCATTGG (Sm3) is used, which reduces the negative effect of the background, allows you to increase the number of cycles and use higher concentrations of primers without fear of nonspecific reactions.

The invention is illustrated by the following examples of specific performance.

Example 1

In a bird with suspected salmonellosis, samples of internal organs (liver) were taken in an amount of 100 mg.

DNA was isolated by the traditional silico-sorption method.

For PCR, the reaction was carried out with the following temperature conditions (table 1):

Table 1. Stage Temperature ° C Number of cycles Time min one 2 3 four one 95 one pause 2 95 one 3 3 95 48 0.2 63 48 0.5

PCR was performed in a final volume of 25 μl containing 67 mM Tris-HCl (pH 8.9), 16 mM ammonium sulfate; 2.4 mM MgCl ₂ ; 0.01% Tween 20; 0.2 mM dNTP; 0.5 tKM solutions of oligonucleotide primers with the following nucleotide sequences: 5'GAGCATATTCGTGGAGCAATG-3 '(Sm1), 5'-AATAACATCCTCAACTTCAGCAG-3 (Sm2), as well as with a Taqman Sm3 DNA probe FAM-TGCTCGTAATTGCC. To quantify the reaction, controls were set with a known content of microorganisms in the sample in an amount of at least 4 control points.

The reaction is taken into account by the conventional method using a real-time Miniopticon amplifier based on calibration curves obtained using standard samples with different microorganisms in the sample. As a result of the analysis, it was determined that the concentration of salmonella in the samples varied from 6 million genomic equivalents in a sample in a bird with bright pathological changes, to 450 genomic equivalents in a sample in a bird who died from another disease.

Example 2

To assess the effectiveness of poultry antibiotic prophylaxis against salmonellosis, several groups of 8-10 day old chickens were selected from a poultry farm unsuccessful for salmonellosis. From cesspools were selected 10 samples from the group, which were tested for the presence of genomic DNA of microorganisms of the genus Salmonella by the claimed method. Next, the studied groups of birds were treated with various antibiotics, after which the samples from the cloaca were re-selected and also tested for the presence of genomic DNA of microorganisms of the genus Salmonella by the claimed method. Genomic DNA was isolated as follows. Disposable sterile swabs were applied to the contents of the cloaca. Scrapings were washed off swabs with 0.5 ml of 4M guanidinisothiocyanate solution. 300 μl of the wash was transferred into Eppendorf tubes, mixed thoroughly, incubated at 56 ° C for 5 minutes and centrifuged at 4 thousand rpm for 3 minutes. The supernatant was transferred to other tubes and 50 μl of sorbent DNA (silica) was added thereto. Samples were thoroughly mixed, incubated for 5 minutes, vortexed and centrifuged at 5 thousand rpm for 1 minute. The supernatant was drained, the sorbent was washed with washing buffer, DNA was eluted with 50 μl of TE buffer at 56 ° C.

The results of the study are presented in table 2.

Table 2. Group antibiotic Sample sizes PCR results for salmonella,% infection one 2 3 four one Before processing 10 twenty 2 Before processing 10 thirty 3 Before processing 10 twenty four Before processing 10 twenty one Clubactin 10 0 2 Enroxil 10 0 3 Enroxil 10 10 four Egoscine 10 10

Analysis of the table shows that infection of chickens with salmonella is from 0 to 30%, in addition, various antibiotics are to varying degrees effective when used in vivo. In such a situation, the use of PCR as a criterion for the effectiveness of antibiotic therapy allows you to take into account the whole complex of factors that determines the effectiveness of a particular preventive measure, in particular antibiotic therapy (for example, an antibiotic effective against a pure culture of salmonella may be ineffective in an organism infected with salmonella due to for the provocation of dysbiosis, poor absorption, enzymatic inactivation, etc.).

Example 3

In order to confirm the specificity of the PCR used, this reaction was performed with the genomic DNA of various microorganisms and viruses that may be present in the bird organism. The results of the study are presented in table 3.

Table 3 Track number Type of microorganism Presence of amplicon specific for microorganisms of the genus Salmonella one Pseudomonas auregenosa - 2 Staphilococcus aureus - 3 Serratia marcescens - four E.coli ATCC 25922 - 5 A test that is positive for salmonella in microbiological studies + 6 Listeria monocitogenes - 7 Yersinia pseudotuberculosis - 8 Salmonella cholerasuis + 9 E.coli (field isolate) - 10 E.coli O157 H7 - eleven Sample, containing salmonella according to the results of microbiological and PCR studies. 12 A test that is positive for salmonella in microbiological studies + 13 Salmonella tiphimurium +

From table 3 it is seen that the inventive method has sufficient specificity for the determination of microorganisms of the genus Salmonella.

Example 4

To assess the sensitivity of the method, a series of ten-fold dilutions of S. Tiphimurium culture was carried out with an initial concentration of 1 × 10 ⁸ colony forming units (CFU / ml). After that, with each dilution, PCR was performed using the proposed method.

Table 4. The concentration of the microorganism of the genus Salmonella in the sample, CFU / sample The PCR results of the proposed method The number of salmonella in the samples (genomic equivalents in the sample) one 2 100,000 Positively 100,000 10,000 Positively 10,000 1000 Positively 1000 one hundred Positively one hundred 10 Positively 10 one Negatively 0 0 Negatively 0

As follows from table 4, the sensitivity of PCR in the claimed method is at least 10 cfu / sample. This is facilitated by 2 factors - a shorter amplicon (synthesized DNA fragment), which increases the efficiency of the reaction, and the presence of a specific oligonucleotide probe, which reduces the negative effect of the background and allows you to increase the number of cycles and use higher concentrations of primers without fear of nonspecific reactions.

Thus, the inventive method allows more accurately on a quantitative, population level to control the effectiveness of antialsalmonella measures and adjust antiepizootic measures. Using the claimed method will improve the reliability of the analysis, and also more accurately, taking into account the totality of factors determining the interaction of a microorganism, a macroorganism, the preventive measure itself and environmental objects, control the effectiveness of anti-epizootic measures against salmonellosis.

Claims (2)

1. A method for determining microorganisms of the genus Salmonella, including selection of biomaterial, DNA isolation, detection of genomic DNA of a microorganism of the genus Salmonella in PCR using specially selected primers, characterized in that primers with the following nucleotide sequences are used to detect the genomic DNA of a microorganism of the genus Salmonella in PCR: 5 '-GAGCATATTCGTGGAGCAATG-3' and 5'-AATAACATCCTCAACTTCAGCAG-3 and Taqman fluorescent probe FAM-TGCTCGTAATTCGCCGCCATTGG quencher. 2. The method according to claim 1, characterized in that as the studied biomaterial use cloacal swabs or pathological material of farm birds.