KR101846952B1 - Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof - Google Patents

Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof Download PDF

Info

Publication number
KR101846952B1
KR101846952B1 KR1020170110405A KR20170110405A KR101846952B1 KR 101846952 B1 KR101846952 B1 KR 101846952B1 KR 1020170110405 A KR1020170110405 A KR 1020170110405A KR 20170110405 A KR20170110405 A KR 20170110405A KR 101846952 B1 KR101846952 B1 KR 101846952B1
Authority
KR
South Korea
Prior art keywords
seq
primer
polymerase chain
chain reaction
probe
Prior art date
Application number
KR1020170110405A
Other languages
Korean (ko)
Inventor
정수진
박정웅
송시범
송민경
김현지
구혜인
Original Assignee
주식회사 세니젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 세니젠 filed Critical 주식회사 세니젠
Priority to KR1020170110405A priority Critical patent/KR101846952B1/en
Application granted granted Critical
Publication of KR101846952B1 publication Critical patent/KR101846952B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113—PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a multiplex real-time polymerase chain reaction (PCR) primer kit enabling simultaneous detection of Listeria monocytogenes, Enterohemorrhagic Escherichia coli (EHEC), and Clostridium perfringens using the primer kit with an optimal combination. The primer kit can be useful as a primer kit capable of simultaneously detecting food poisoning bacteria listed above.

Description

리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균의 동시 검출을 위한 프라이머 세트 및 이를 포함하는 중합효소연쇄반응 키트 {Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof}[0002] Primer sets for simultaneous detection of Listeria monocytogenes, intestinal hemorrhagic Escherichia coli and gaseous gaseous organisms, and a polymerase chain reaction kit containing the same, and a polymerase chain reaction kit containing the same,

본 발명은 여러 미생물을 동시에 검출할 수 있게 하는 멀티플렉스 프라이머 세트 및 이를 포함하는 중합효소연쇄반응 키트에 관한 것으로, 더욱 상세하게는 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균의 동시 검출을 위한 멀티플렉스 프라이머 세트 및 이를 포함하는 중합효소연쇄반응 키트에 관한 것이다. The present invention relates to a multiplex primer set capable of simultaneously detecting various microorganisms and a polymerase chain reaction kit comprising the same, and more particularly, to a multiplex PCR primer set for simultaneous detection of Listeria monocytogenes, enterohemorrhagic Escherichia coli, A multiplex primer set and a polymerase chain reaction kit comprising the same.

식중독이란 식품의 섭취에 연관된 인체에 유해한 미생물 혹은 유독 물질에 의해 발생했거나 발생한 것으로 판단되는 감염성 또는 독소형 질환(식품위생법 제2조 제10호)을 말하는 것으로, 생활수준이 향상되고, 의료기술이 발달하였음에도 불구하고 식중독은 크게 줄지 않고 있으며, 오히려 병원성 대장균 O157:H7, 리스테리아 등과 같이 새로운 원인균에 의한 식중독 발생은 증가하는 추세이다(국내외식중독 발생 및 관리동향, 농식품안전정보서비스 운영/관리사업, 2008년 4월). 식품의약품안전청의 통계자료에 따르면 매년 최대 510건의 식중독이 발생하며 약 1만여 명이 식중독 미생물에 감염된다고 한다(식약청, 식중독 통계시스템).Food poisoning refers to an infectious or poisonous disease (Article 2, Item 10 of the Food Sanitation Law) that is caused or caused by microorganisms or toxic substances harmful to human body related to the intake of food. Although food poisoning has not been reduced significantly, the outbreak of food poisoning due to new causative organisms such as E. coli O157: H7 and listeria is increasing (domestic food poisoning occurrence and management trends, agricultural food safety information service operation / management project, 2008 April). The Korea Food and Drug Administration estimates that up to 510 food poisoning cases occur each year and about 10,000 people are infected with foodborne microorganisms (KFDA, food poisoning statistics system).

리스테리아 모노사이토제니스 (Listeria monocytogenes)는 사람 리스테리아증의 원인균으로 널리 자연계에 분포하며, 특히 포유류, 조류에서 분리되는 그람양성의 단간균이며, 장출혈성 대장균 (Enterohemorrhagic E. coli ,EHEC), O157:H7는 여행자 설사를 일으키는 여러 세포독소 (cytotoxin) 를 생산하며, 그 기작은 잘 알려져있지 않고, 가스괴저균 (Clostridium perfringens)은 가스괴저를 일으키는 그람양성, 혐기성의 간균으로 아포를 형성한다. 이 균은 14종의 아미노산을 필요로하고 우라실과 아데닌을 첨가하면 잘 자라 쇠고기와 닭고기에서 잘 자라며, 장염의 원인이 된다. Listeria monocytogenes is a gram-positive bacterium isolated from mammals and algae and is widely distributed in the natural world. It is an enterohemorrhagic E. coli (EHEC), O157: H7 ( Clostridium perfringens ) is a gram-positive, anaerobic bacterium that causes gas gangrene and forms apo- ogen . It is known to produce many cytotoxins that cause traveler's diarrhea. This bacterium needs 14 amino acids. When uracil and adenine are added, it grows well in beef and chicken, and causes enteritis.

현재까지 식중독 세균 (food poisoning bacteria)의 탐지법 중에 가장 많이 사용되어온 방법은 배양법 (culture-based method)으로, 정확도는 높지만, 많은 샘플을 동시에 처리하기가 어려우며, 최소 24시간 이상의 농화배양(enrichment culture)을 필요로 하고, 농화배양 후에도 선택 배양, 확정 시험단계를 필요로 하기 때문에 이러한 전통적인 배양법은 노동 집약적이며 많은 시간이 소요된다는 단점이 있다. To date, the most commonly used method for detecting food poisoning bacteria is the culture-based method, which is highly accurate, but it is difficult to treat many samples at the same time, and enrichment culture ) And requires a selective culture and a definitive test step even after the concentration culture, such a conventional culture method is labor-intensive and takes a long time.

이 외에도 최근에 배양을 이용한 방법 (culture-based method)을 대체하는 방법으로, 중합효소연쇄반응 (polymerase chain reaction, PCR) 및 항체를 이용한 면역학적 탐지법이 개발되었지만, 면역학적 방법은 실험과정이 간편한 반면 민감도가 낮고, 다양한 병원균을 탐지하는 데 신뢰할 만한 도구로 사용되어 온 중합효소연쇄반응, 특히 다중중합효소연쇄반응 (multiplex polymerase chain reaction, multiplex PCR)은 다수의 타겟을 동시에 탐지할 수 있는 장점을 갖고 있지만 다중중합효소연쇄반응을 포함한 전통적인 중합효소연쇄반응방법 역시 증폭 산물 (product)의 분석을 위한 전기영동 (gel electrophoresis) 과정을 필요로 하여 시간이 많이 소모되고 노동 집약적이다. Recently, polymerase chain reaction (PCR) and immunoassay using antibodies have been developed as an alternative to culture-based methods. However, The simple, yet sensitive, and reliable tool to detect a variety of pathogens, the multiplex polymerase chain reaction (PCR), which can be used to detect multiple targets simultaneously But traditional PCR methods involving multiple polymerase chain reactions also require gel electrophoresis for the analysis of amplification products, which is time consuming and labor intensive.

그에 반면, 실시간중합효소연쇄반응 (real-time polymerase chain reaction, Real-time PCR) 기법은 증폭 산물 (product)로부터 발생하는 형광의 강도(세기)를 탐지하는 방법으로, 전통적인 중합효소연쇄반응방법에 비해 더 신속하고 민감하게 결과를 확인할 수 있으며 분석이 매우 간단하다. 또한, 증폭 산물을 분석하기 위한 전기영동 (gel electrophresis), DNA간 혼성 (DNA-DNA hybridization), 시퀀싱 (sequencing)과 같은 추가적인 실험이 필요하지 않는 장점이 있다.On the other hand, real-time polymerase chain reaction (PCR) is a method for detecting the intensity (intensity) of fluorescence generated from an amplification product. You can see results more quickly and sensitively than before, and the analysis is very simple. Further, there is an advantage that additional experiments such as gel electrophoresis, DNA-DNA hybridization, and sequencing for analyzing amplification products are not necessary.

대한민국 공개특허 제10-2011-0049140호 (공개일자: 2011.05.12)에는, 식중독 원인균의 다중 실시간 검출방법에 대한 기술이 기재되어있다.Korean Patent Publication No. 10-2011-0049140 (published on May 12, 2011) discloses a technique for detecting multiple real-time detection of causative agents of food poisoning.

본 발명은 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens)에 대한 동시 검출이 가능한 프라이머 세트 및 이를 포함한 PCR 키트를 개발하여 제공하고자 한다. The present invention provides a primer set capable of simultaneous detection of Listeria monocytogenes , intestinal hemorrhagic Escherichia coli (EHEC), Clostridium perfringens , and a PCR kit containing the primer set.

본 발명은 서열번호 1에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 2에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 리스테리아 모노사이토제니스 (Listeria monocytogenes)의 검출을 위한 프라이머 세트 (a); 서열번호 4에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 5에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 장출혈성 대장균 (EHEC)의 검출을 위한 프라이머 세트 (b); 및 서열번호 7에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 8에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 가스괴저균 (Clostridium perfringens)의 검출을 위한 프라이머 세트 (c);를 포함하는 것을 특징으로 하는 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC) 및 가스괴저균 (Clostridium perfringens) 검출용 멀티플렉스 프라이머 세트를 제공한다. The invention Listeria monocytogenes Zenith configured as a reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 2 as a forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 1 (Listeria (a) a primer set for detection of monocytogenes ; (B) a primer set for detection of intestinal hemorrhagic Escherichia coli (EHEC) consisting of a forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 4 and a reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 5; And a primer set (c) for detection of gas gonococci ( Clostridium perfringens ) composed of a forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 7 and a reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 8 Janis L. monocytogenes (Listeria a set of multiplex primers for detecting monocytogenes , enterohemorrhagic Escherichia coli (EHEC) and Clostridium perfringens .

본 발명은 상기 본 발명의 멀티플렉스 프라이머 세트를 포함하는 것을 특징으로 하는 중합효소연쇄반응 (polymerase chain reaction, PCR)용 키트를 제공한다. The present invention provides a kit for polymerase chain reaction (PCR), which comprises the multiplex primer set of the present invention.

본 발명의 중합효소연쇄반응 (polymerase chain reaction, PCR)용 키트에 있어서, 상기 중합효소연쇄반응(polymerase chain reaction, PCR)은, 바람직하게 실시간중합효소연쇄반응 (real-time PCR, RT-PCR)인 것이 좋다. 이때, 상기 프라이머 세트 (a)는, 바람직하게 서열번호 3에 기재된 핵산서열을 갖는 탐침 (probe)을 더 포함하고 있는 것이 좋고, 상기 프라이머 세트 (b)는, 바람직하게 서열번호 6에 기재된 핵산서열을 갖는 탐침 (probe)을 더 포함하고 있는 것이 좋으며, 상기 프라이머 세트 (c)는, 바람직하게 서열번호 9에 기재된 핵산서열을 갖는 탐침 (probe)을 더 포함하고 있는 것이 좋다. 또한, 상기 서열번호 3에 기재된 핵산서열을 갖는 탐침 (probe)은, 바람직하게 5' 말단에 형광염료 (fluorescence dye)로 FAM (5-carboxyfluorescein)이 태깅 (tagging)되어 있는 것이 좋고, 상기 서열번호 6에 기재된 핵산서열을 갖는 탐침 (probe)은, 바람직하게 5' 말단에 형광염료 (fluorescence dye)로 VICTM (Microsynth 상용판매)가 태깅 (tagging)되어 있는 것이 좋으며, 상기 서열번호 9에 기재된 핵산서열을 갖는 탐침 (probe)은, 바람직하게 5' 말단에 형광염료 (fluorescence dye)로 Cy5 (cyanine)가 태깅 (tagging)되어 있는 것이 좋다.In the kit for polymerase chain reaction (PCR) of the present invention, the polymerase chain reaction (PCR) is preferably a real-time PCR (RT-PCR) . Preferably, the primer set (a) further comprises a probe having a nucleic acid sequence as set forth in SEQ ID NO: 3, and the primer set (b) preferably has the nucleotide sequence shown in SEQ ID NO: 6 (C) preferably further comprises a probe having a nucleic acid sequence as set forth in SEQ ID NO: 9. The probe having the nucleic acid sequence shown in SEQ ID NO: 3 is preferably a 5-carboxyfluorescein tagged with a fluorescent dye at the 5 'end, The probe having the nucleic acid sequence described in SEQ ID NO: 6 is preferably a tagged VIC TM (Microsynth commercially available) as a fluorescence dye at the 5 'end, and the nucleic acid described in SEQ ID NO: 9 Preferably, the probe having a sequence is tagged with Cy5 (cyanine) as a fluorescent dye at the 5 'end.

한편, 본 발명의 중합효소연쇄반응(polymerase chain reaction, PCR)용 키트에 있어서, 상기 서열번호 1, 서열번호 2에 기재된 프라이머 및 서열번호 3에 기재된 탐침은, 바람직하게 중합효소연쇄반응 (polymerase chain reaction, PCR)을 위한 워킹볼륨 (working volume) 20 μl에 대해, 20 μM의 농도로 0.5 μl 만큼 첨가되어 사용되는 것이 좋고, 상기 서열번호 4, 서열번호 5에 기재된 프라이머 및 서열번호 6에 기재된 탐침은, 바람직하게 중합효소연쇄반응 (polymerase chain reaction, PCR)을 위한 워킹볼륨(working volume) 20 μl에 대해, 20 μM의 농도로 0.5 μl 만큼 첨가되어 사용되는 것이 좋으며, 상기 서열번호 7, 서열번호 8에 기재된 프라이머 및 서열번호 9에 기재된 탐침은, 바람직하게 중합효소연쇄반응 (polymerase chain reaction, PCR)을 위한 워킹볼륨(working volume) 20 μl에 대해, 20 μM의 농도로 1 μl 만큼 첨가되어 사용되는 것이 좋다. In the kit for the polymerase chain reaction (PCR) of the present invention, the primer set forth in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 are preferably polymerase chain reaction the primer described in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 and the probe described in SEQ ID NO: 6 and SEQ ID NO: 6 are used in a concentration of 20 μM for a working volume of 20 μl Is preferably used by adding 0.5 μl at a concentration of 20 μM to 20 μl of a working volume for polymerase chain reaction (PCR), and is preferably used in SEQ ID NO: 7, SEQ ID NO: 8 and the probe described in SEQ ID NO: 9 are preferably used for a 20 μl working volume for polymerase chain reaction (PCR), 1 μl at a concentration of 20 μM It may be used than is added.

본 발명에서 개발한 PCR 키트 (PCR kit)는, 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 모두를 간섭없이 검출할 수 있다. 또한, 상기 균주들을 유사한 형광 강도로 검출할 수 있어, 간편하게 분석할 수 있는 장점이 있다.The PCR kit developed in the present invention can detect all of Listeria monocytogenes , enterohemorrhagic Escherichia coli (EHEC), and Clostridium perfringens without interference. In addition, the above strains can be detected with similar fluorescence intensity, which is advantageous in that they can be easily analyzed.

도 1은 본 발명에서 디자인한 PCR 키트를 사용하여, 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens)의 검출 가능 여부를 확인하기 위한 다중실시간중합효소연쇄반응 (Multiplex real-time PCR) 결과이다.
도 2는 새로운 형광염료 사용에 따른, 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens)의 검출 가능 여부를 확인하기 위한 다중실시간중합효소연쇄반응 (Multiplex real-time PCR) 결과이다.
도 3은 프라이머 및 탐침의 조성비 상이에 따른, 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens)의 검출 패턴을 비교하기 위한 다중실시간중합효소연쇄반응 (Multiplex real-time PCR) 결과이다.FIG. 1 is a schematic diagram of a PCR kit designed in accordance with the present invention to detect the presence of Listeria monocytogenes , enterochromic E. coli (EHEC), and Clostridium perfringens (Multiplex real-time PCR).
FIG. 2 is a graph showing the results of a multiplex real-time PCR to confirm the detection of Listeria monocytogenes , EHEC, and Clostridium perfringens according to the use of a new fluorescent dye. -time PCR).
FIG. 3 shows the results of a multi-real-time PCR (Multiplex PCR) for comparing detection patterns of Listeria monocytogenes , EHEC, and Clostridium perfringens according to the composition ratio of primer and probe. real-time PCR).

본 발명에서는 식중독균으로 알려진 리스테리아 모노사이토제니스, 장출혈성 대장균 및 가스괴저균을 용이하게 분리할 수 있는 기술을 개발하고자 예의 노력하였으며, 그 결과 이들 3개의 균을 다른 균들 및 이들 균들과의 간섭없이 검출할 수 있는 프라이머 세트를 개발하였다. In the present invention, efforts have been made to develop a technique capable of easily isolating Listeria monocytogenes, enteric haemorrhagic Escherichia coli and gaseous gaseous bacteria known as food poisoning bacteria. As a result, these three bacteria are detected without interference with other fungi and these fungi A primer set was developed that can be used.

본 발명은 서열번호 1에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 2에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 리스테리아 모노사이토제니스의 검출을 위한 프라이머 세트 (a); 서열번호 4에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 5에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 장출혈성 대장균의 검출을 위한 프라이머 세트 (b); 및 서열번호 7에 기재된 핵산서열로 이루어진 정방향 프라이머와 서열번호 8에 기재된 핵산서열로 이루어진 역방향 프라이머로 구성된 가스괴저균의 검출을 위한 프라이머 세트 (c);를 포함하는 것을 특징으로 하는 리스테리아 모노사이토제니스, 장출혈성 대장균 및 가스괴저균 검출용 멀티플렉스 프라이머 세트를 제공한다. (A) a primer set (a) for detection of a listeria monocytogenenes composed of a forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 1 and a reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 2; (B) a primer set for detection of enterohemorrhagic Escherichia coli consisting of a forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 4 and a reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 5; And a primer set (c) for detection of a gaseous gaseous bacterium composed of a forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 7 and a reverse primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 8. The Listeria monocytogenes , A multiplex primer set for detecting enterohemorrhagic Escherichia coli and gaseous gaseous bacteria.

상기 본 발명의 멀티플렉스 프라이머 세트를 사용하여 중합효소연쇄반응을 수행할 경우, 간섭없이 이들 3개의 균주가 검출됨이 확인되었다. When the polymerase chain reaction was performed using the multiplex primer set of the present invention, it was confirmed that these three strains were detected without interference.

한편, 본 발명은 상기 본 발명의 멀티플렉스 프라이머 세트를 포함하는 것을 특징으로 하는 중합효소연쇄반응용 키트를 제공한다. 상기 본 발명에서 개발한 프라이머 세트는 PCR에 사용되는데, 검체를 대상으로 하여 PCR을 수행할 경우, 상기 3개의 균주를 검출할 수 있게 된다. PCR용 키트에는 본 발명의 멀티플렉스 프라이머 세트 외에 버퍼, dNTP 등이 첨가될 수 있는데, 이는 공지의 것을 특별한 것에 한정하지 않고 사용할 수 있으므로, 이에 대한 구체적인 기재는 생략하기로 한다. The present invention also provides a kit for a polymerase chain reaction, which comprises the multiplex primer set of the present invention. The primer set developed in the present invention is used in PCR. When PCR is performed on a specimen, the three strains can be detected. In addition to the multiplex primer set of the present invention, a buffer, dNTP, or the like may be added to the kit for PCR, and known ones can be used without being limited to specific ones, so a detailed description thereof will be omitted.

한편, 본 발명의 중합효소연쇄반응용 키트에 있어서, 상기 중합효소연쇄반응은, 바람직하게 실시간중합효소연쇄반응인 것이 좋다. Real-Time PCR을 수행하면, 연쇄중합반응 결과 산물을 실시간에 정량적으로 확인할 수 있어, 현장에서 병원성 미생물의 감염을 즉시 확인할 수 있는 장점이 있다. On the other hand, in the kit for polymerase chain reaction of the present invention, the polymerase chain reaction is preferably a real-time polymerase chain reaction. Real-time PCR can be used to quantitatively confirm the product as a result of the chain polymerization reaction in real time, which is advantageous in that the infection of pathogenic microorganisms can be confirmed immediately on site.

한편, 본 발명의 실시간중합효소연쇄반응에 있어서, 상기 프라이머 세트 (a)는, 바람직하게 서열번호 3에 기재된 핵산서열을 갖는 탐침을 더 포함하고 있는 것이 좋고, 상기 프라이머 세트 (b)는, 바람직하게 서열번호 6에 기재된 핵산서열을 갖는 탐침을 더 포함하고 있는 것이 좋으며, 상기 프라이머 세트 (c)는, 바람직하게 서열번호 9에 기재된 핵산서열을 갖는 탐침을 더 포함하고 있는 것이 좋다. 또한, 상기 서열번호 3에 기재된 핵산서열을 갖는 탐침은, 바람직하게 5' 말단에 형광염료로 FAM이 태깅되어 있는 것이 좋고, 상기 서열번호 6에 기재된 핵산서열을 갖는 탐침은, 바람직하게 5' 말단에 형광염료로 VIC가 태깅 (tagging)되어 있는 것이 좋으며, 상기 서열번호 9에 기재된 핵산서열을 갖는 탐침은, 바람직하게 5' 말단에 형광염료로 Cy5가 태깅되어 있는 것이 좋다. 상기와 같은 형광염료의 태깅에 의해, 타겟 미생물의 감염 여부를 형광 분석기를 통해 확인할 수 있는데, 본 발명에서 타겟 미생물들에 대해 사용한 상기 형광염료 조합에 의해, 검출 감도가 낮게 나타난 리스테리아 모노사이토제니스의 검출 감도를 높일 수 있다. In the meantime, in the real-time PCR reaction of the present invention, the primer set (a) preferably further comprises a probe having a nucleic acid sequence as set forth in SEQ ID NO: 3, and the primer set (b) The primer set (c) preferably further comprises a probe having a nucleic acid sequence as set forth in SEQ ID NO: 9. In the probe having the nucleic acid sequence shown in SEQ ID NO: 3, it is preferable that FAM is tagged as a fluorescent dye at the 5 'end, and the probe having the nucleic acid sequence shown in SEQ ID NO: 6 is preferably a 5' It is preferable that the probe having the nucleic acid sequence of SEQ ID NO: 9 is tagged with a fluorescent dye at the 5 'end. By the tagging of the fluorescent dye, it is possible to confirm whether the target microorganism is infected through the fluorescence analyzer. In the present invention, the combination of the fluorescent dyes used for the target microorganisms can be used to detect the sensitivity of the Listeria monocytogenes The detection sensitivity can be increased.

한편, 본 발명의 중합효소연쇄반응용 키트에 있어서, 상기 서열번호 1, 서열번호 2에 기재된 프라이머 및 서열번호 3에 기재된 탐침은, 바람직하게 중합효소연쇄반응을 위한 워킹볼륨 20 μl에 대해, 20 μM의 농도로 0.5 μl 만큼 첨가되어 사용되는 것이 좋고, 상기 서열번호 4, 서열번호 5에 기재된 프라이머 및 서열번호 6에 기재된 탐침은, 바람직하게 중합효소연쇄반응을 위한 워킹볼륨 20 μl에 대해, 20 μM의 농도로 0.5 μl 만큼 첨가되어 사용되는 것이 좋으며, 상기 서열번호 7, 서열번호 8에 기재된 프라이머 및 서열번호 9에 기재된 탐침은, 바람직하게 중합효소연쇄반응을 위한 워킹볼륨 20 μl에 대해, 20 μM의 농도로 1 μl 만큼 첨가되어 사용되는 것이 좋다. 이와 같은 처리 농도 및 첨가량을 사용할 경우, 타겟 미생물들의 검출 감도를 더욱 유사하게 맞출 수 있는 장점이 있다. Meanwhile, in the kit for a polymerase chain reaction of the present invention, the primer described in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 preferably have 20 to 20 l working volume for the polymerase chain reaction The primer described in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 are preferably used in an amount of 20 mu l per 20 [mu] l working volume for the polymerase chain reaction, preferably 20 [mu] The primer described in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 are preferably added at a concentration of 0.5 mu l at a concentration of 20 mu M, preferably 20 mu l for a working volume for the polymerase chain reaction. It is preferable that 1 μl is added at a concentration of μM to be used. When such treatment concentrations and addition amounts are used, there is an advantage that the detection sensitivity of the target microorganisms can be adjusted to be more similar.

[[ 실시예Example 1: 본 발명에서 디자인한  1: Designed according to the invention 프라이머를Primer 사용하여 리스테리아 모노사이토제니스 ( Using Listeria monocytogenes ( Listeria monocytogenesListeria monocytogenes ), 장출혈성 대장균 (EHEC), 가스괴저균 (), Intestinal hemorrhagic Escherichia coli (EHEC), gas gonococci Clostridium perfringensClostridium perfringens ) 검출 가능 여부 확인]) Check if detection is possible]

본 발명자가 새롭게 디자인한 하기 표 1에 기재된 서열을 갖는 프라이머 및 공지의 탐침을 사용하여 다중실시간중합효소연쇄반응을 수행함으로써, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균이 간섭 없이 명확히 검출되는지 여부를 확인하였다. Real-time polymerase chain reaction was performed using a newly designed primer having the sequence described in the following Table 1 and a known probe to clearly detect Listeria monocytogenes, enterohemorrhagic Escherichia coli and gaseous germs without interference Respectively.

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출을 위한 프라이머 (primer) 및 탐침 (probe) 염기서열A primer and a probe base sequence for detecting Listeria monocytogenes , enterohemorrhagic Escherichia coli (EHEC), Clostridium perfringens , PathogenPathogen target genetarget gene Primer sequence(5'-3')Primer sequence (5'-3 ')



L. L. monocytogenesmonocytogenes




lssrA



lssrA

F-Primer
F-Primer

GGGATCGTCCTCGTTATCAAC
GGGATCGTCCTCGTTATCAAC
R-Primer
R-Primer

TCTATTTAACCCCAGACGGAGAT
TCTATTTAACCCCAGACGGAGAT
Probe
Probe

Cy5-CGCTGCCTAATAAGCAGTAGCATAGCTG-BHQ2
Cy5 -CGCTGCCTAATAAGCAGTAGCATAGCTG- BHQ2



EHEC



EHEC




stx2



stx2

F-Primer
F-Primer

ATTAACCACACCCCACCG
ATTAACCACACCCCACCG
R-Primer
R-Primer

GTCATGGAAACCGTTGTCAC
GTCATGGAAACCGTTGTCAC
Probe
Probe

VIC-CAGTTATTTTGCTGTGGATATACGAGGGCTTG-MGB
VIC -CAGTTATTTTGCTGTGGATATACGAGGGCTTG- MGB



C. C. perfringensperfringens



cpa



cpa

F-Primer
F-Primer

CCTGACACAGGGGAATCACAA
CCTGACACAGGGGAATCACAA
R-Primer
R-Primer

CATGTCCTGCGCTATCAACG
CATGTCCTGCGCTATCAACG
Probe
Probe

FAM-CTTGGAGAGGCTATGCACTATTTTGGAG-TAMRA
FAM -CTTGGAGAGGCTATGCACTATTTTGGAG- TAMRA

다중실시간중합효소연쇄반응 결과, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균이 검출됨을 확인할 수 있었다 <도 1>.As a result of the multiple real-time PCR, it was confirmed that Listeria monocytogenes, enterohemorrhagic Escherichia coli, and gas gangrene were detected.

그러나, Cy5 dye에 해당하는 리스테리아 모노사이토제니스의 타겟 유전자인 lssrA의 활성이 다른 타겟 유전자에 비해 현저히 낮았다 <도 1>. 이는 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균의 동시 검출을 위해 다중실시간중합효소연쇄반응을 수행할 경우, 실제 존재하는 리스테리아 모노사이토제니스를 음성으로 판단하는 허위 음성의 결과를 초래할 수 있다. However, the activity of lssrA, a target gene of Listeria monocytogenes, which corresponds to Cy5 dye, was significantly lower than that of other target genes (Fig. 1). This may result in a false negative that negatively determines the actual Listeria monocytogenes when the multi-real-time PCR is performed for the simultaneous detection of Listeria monocytogenes, intestinal hemorrhagic Escherichia coli and gaseous gaseous bacteria.

따라서, 본 발명에서는 활성이 낮은 리스테리아 모노사이토제니스의 타겟 유전자의 검출 감도를 높이고자, 하기의 추가 실험을 통해, 새롭게 조합한 형광염료 (Fluorescent dye)를 사용하고, 그 결과를 분석하고자 하였다. Therefore, in the present invention, in order to increase detection sensitivity of the target gene of Listeria monocytogenenis with low activity, a new combination of fluorescent dyes was used through further experiments to analyze the result.

[[ 실시예Example 2:  2: 새로운 형광염료New fluorescent dyes ((Fluorescent dye) 사용에 따른 리스테리아 모노사이토제니스 ( ((Fluorescent dye) according to the use of Listeria monocytogenen ( Listeria monocytogenesListeria monocytogenes ), 장출혈성 대장균 (EHEC), 가스괴저균 (), Intestinal hemorrhagic Escherichia coli (EHEC), gas gonococci Clostridium perfringensClostridium perfringens ) 검출 가능 여부 확인]) Check if detection is possible]

본 실시예에서는 새로운 형광염료를 사용하여 리스테리아 모노사이토제니스의 타겟 유전자의 검출 감도를 높이고자 하였다. 하기 표 2는 상기 실시예 1에서 사용한 형광염료의 구성을 정리한 것이고, 표 3은 본 실시예 2에서 새롭게 사용한 형광염료의 구성을 정리한 것이다. In this embodiment, a new fluorescent dye was used to increase the detection sensitivity of a target gene of Listeria monocytogenenes. Table 2 summarizes the constitution of the fluorescent dye used in Example 1 and Table 3 summarizes the constitution of the fluorescent dye newly used in Example 2. [

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출을 위한 실시예 1 형광염료 (Fluorescent dye) 구성Example 1 for the detection of Listeria monocytogenes , intestinal hemorrhagic Escherichia coli (EHEC), Clostridium perfringens (1) Fluorescent dye composition
PathogenPathogen

target genetarget gene
Fluorescent dyeFluorescent dye
L. L. monocytogenesmonocytogenes

lssrA
lssrA
Cy5-BHQ2
Cy5-BHQ2
EHEC

EHEC

stx2
stx2
VIC-TAMRA
VIC-TAMRA
C. C. perfringensperfringens

cpa
cpa
FAM-MGB
FAM-MGB

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출을 위한 새로운 형광염료 (Fluorescent dye) 구성New Fluorescent dye composition for detection of Listeria monocytogenes , EHEC and Clostridium perfringens .
PathogenPathogen

target genetarget gene
Fluorescent dyeFluorescent dye
L. monocytogenes L. monocytogenes

lssrA
lssrA
FAM-TAMRA
FAM-TAMRA
EHEC

EHEC

stx2
stx2
VIC-MGB
VIC-MGB
C. perfringensC. perfringens

cpa
cpa
Cy5-BHQ2
Cy5-BHQ2

표 3에 기재된 새로운 형광염료 사용에 따른 다중실시간중합효소연쇄반응 결과, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균이 용이하게 검출됨을 확인할 수 있었고, 특히 기존 형광염료 사용시 검출 감도가 낮게 나타났던, 리스테리아 모노사이토제니스의 검출감도가 매우 높게 향상됨을 확인할 수 있었다 <도 2>. 즉, 리스테리아 모노사이토제니스의 타겟 유전자인 lssrA의 형광염료를 Cy5 dye에서 FAM dye로 변경함으로써 다중실시간중합효소연쇄반응 활성이 개선됨을 확인한 것이다.As shown in Table 3, it was confirmed that Listeria monocytogenes, enterohemorrhagic Escherichia coli, and gaseous gaseous bacteria were easily detected by the multi-real-time PCR reaction using the new fluorescent dyes. In particular, , And the detection sensitivity of Listeria monocytosenicin was improved to be very high (Fig. 2). That is, it was confirmed that the multi-real-time polymerase chain reaction activity was improved by changing the fluorescent dye of lssrA, which is a target gene of Listeria monocytogenenis, from Cy5 dye to FAM dye.

[[ 실시예Example 3:  3: 프라이머primer (primer) 및 탐침 (probe)의 조성비 상이에 따른 리스테리아 모노사이토제니스 ( (Listeria monocytogenes) depending on the composition ratio of the primer and the probe Listeria monocytogenesListeria monocytogenes ), 장출혈성 대장균 (EHEC), 가스괴저균 (), Intestinal hemorrhagic Escherichia coli (EHEC), gas gonococci Clostridium perfringensClostridium perfringens ) 검출 패턴 비교]) Detection pattern comparison]

본 실시예에서는 프라이머 및 탐침의 조성비를 다양하게 하여 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균 검출 패턴을 비교해 보고자 하였다. In this Example, the compositions of the primers and probes were varied to compare the detection patterns of Listeria monocytogenes, enterohemorrhagic Escherichia coli and gaseous gaseous bacteria.

하기 표 4의 조성비로 프라이머 및 탐침을 조성하여 다중실시간중합효소연쇄반응 결과 (상기 실시예 2), 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균이 검출됨을 확인할 수 있었다 <도 2>.The primers and probes were prepared according to the composition ratios shown in Table 4 below, and it was confirmed that the multi-real-time PCR reaction (Example 2), Listeria monocytogenes, intestinal hemolytic Escherichia coli and gaseous gaseous bacteria were detected.

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출을 위한 다중실시간중합효소연쇄반응 (Multiplex real-time PCR) 프라이머 (primer) 및 탐침 (probe) 조성비Multiplex real-time PCR for detection of Listeria monocytogenes , intestinal hemorrhagic Escherichia coli (EHEC), and Clostridium perfringens (Multiplex real-time PCR) Primer and probe composition ratio
Target gene (dye)Target gene (dye)

SampleSample
volumevolume
기타Other


lssrA
(FAM-TAMRA)


lssrA
(FAM-TAMRA)

F primer
F primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

R primer
R primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

probe
probe

0.75 μl
0.75 μl

probe 농도 20 μM
probe concentration 20 μM



stx2
(VIC-MGB)


stx2
(VIC-MGB)

F primer
F primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

R primer
R primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

probe
probe

0.75 μl
0.75 μl

probe 농도 20 μM
probe concentration 20 μM



cpa
(Cy5-BHQ2)


cpa
(Cy5-BHQ2)

F primer
F primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

R primer
R primer

0.75 μl
0.75 μl

primer 농도 20 μM
primer concentration 20 μM

probe
probe

0.75 μl
0.75 μl

probe 농도 20 μM
probe concentration 20 μM

다만, FAM dye에 해당하는 리스테리아 모노사이토제니스의 타겟 유전자인 lssrA의 활성이 다른 타겟 유전자에 비해 월등히 높았다 <도 2>. However, the activity of lssrA, a target gene of Listeria monocytogenes corresponding to the FAM dye, was significantly higher than that of other target genes (Fig. 2).

이에, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균의 동시 검출을 위한 다중실시간중합효소연쇄반응 진행 시, 다중실시간중합효소연쇄반응 상에서 각 타겟 유전자 간의 활성 간극을 줄일 필요성이 대두되었고, 프라이머 및 탐침의 농도 조절이 필요한 것으로 판단하였다. 따라서, 프라이머 및 탐침 농도를 조절하여, 실험을 수행하고 그 결과를 분석하고자 하였다.Therefore, it has become necessary to reduce the activity gap between the target genes in the multi-real-time PCR process when performing the multi-real-time PCR for the simultaneous detection of Listeria monocytogenes, intestinal hemorrhagic Escherichia coli and gaseous germ cells. It was judged that the concentration of the probe was necessary to be adjusted. Therefore, experiments were conducted by controlling the concentration of primer and probe, and the results were analyzed.

하기 표 5에 기재된 조성비를 갖도록 프라이머 및 탐침을 새롭게 조성하여 다중실시간중합효소연쇄반응을 수행하였다. Primers and probes were newly constructed to have the composition ratios shown in Table 5 below to perform multiple real-time PCR.

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출능 개선을 위한 프라이머 및 탐침의 새로운 조성비New composition ratio of primer and probe for improving Listeria monocytogenes , EHEC, Clostridium perfringens detection ability
Target gene (dye)Target gene (dye)

SampleSample

volumevolume

　기타Other



lssrA
(FAM-TAMRA)


lssrA
(FAM-TAMRA)

F primer
F primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

0.5 μl
0.5 μl
probe 농도 20 μM
probe concentration 20 μM


stx2
(VIC-MGB)


stx2
(VIC-MGB)

F primer
F primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

0.5 μl
0.5 μl
probe 농도 20 μM
probe concentration 20 μM


cpa
(Cy5-BHQ2)


cpa
(Cy5-BHQ2)
F primer
F primer

1 μl
1 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

1 μl
1 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

1 μl
1 μl
probe 농도 20 μM
probe concentration 20 μM

새롭게 조성한 프라이머 및 탐침에 따른 다중실시간중합효소연쇄반응 결과, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균이 검출 감도가 유사하게 유지되면서, 검출됨을 확인할 수 있었다 < 도 3>.As a result of the multi-real-time polymerase chain reaction according to the newly prepared primers and probes, it was confirmed that Listeria monocytogenes, enterohemorrhagic Escherichia coli and gaseous gaseous bacteria were detected with similar detection sensitivity.

상기의 실험 결과를 정리한, 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균 검출을 위한 최종 조건은 하기 표 6과 같았다. The final conditions for the detection of Listeria monocytogenes, enterohemorrhagic Escherichia coli and gaseous gaseous bacteria were summarized in Table 6 below.

리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC), 가스괴저균 (Clostridium perfringens) 검출을 위한 최종 다중실시간중합효소연쇄반응 (Multiplex real-time PCR) 형광 염료 (fluorescent dye) 및 조성Multiplex real-time PCR for detection of Listeria monocytogenes , intestinal hemorrhagic Escherichia coli (EHEC), and Clostridium perfringens Multiplex real-time PCR Detection of fluorescent dyes and compositions
Target gene (dye)Target gene (dye)

SampleSample

volumevolume

　기타Other
DNA
DNA
1 μl
1 μl
40 ng/μl, 각 pathogen의 DNA 동일 양 mix 후
40 ng / μl, the same amount of DNA in each pathogen after mixing



lssrA
(FAM-TAMRA)


lssrA
(FAM-TAMRA)

F primer
F primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

0.5 μl
0.5 μl
probe 농도 20 μM
probe concentration 20 μM


stx2
(VIC-MGB)


stx2
(VIC-MGB)

F primer
F primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

0.5 μl
0.5 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

0.5 μl
0.5 μl
probe 농도 20 μM
probe concentration 20 μM


cpa
(Cy5-BHQ2)


cpa
(Cy5-BHQ2)




F primer
F primer

1 μl
1 μl
primer 농도 20 μM
primer concentration 20 μM
R primer
R primer

1 μl
1 μl
primer 농도 20 μM
primer concentration 20 μM
probe
probe

1 μl
1 μl

probe 농도 20 μM
probe concentration 20 μM

qPCR mix
qPCR mix

8 μl
8 μl
엠지메드 사 qPCR mix　
MM Med Company qPCR mix
PCR mix
PCR mix

2 μl
2 μl
바이오니아 사 qPCR mix
Bioneer's qPCR mix
Molecular water
Molecular water

3 μl
3 μl
TotalTotal

20 μl20 μl

<110> Sanigen Co.,Ltd. <120> Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof <130> YP-17-145 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 1 gggatcgtcc tcgttatcaa c 21 <210> 2 <211> 23 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 2 tctatttaac cccagacgga gat 23 <210> 3 <211> 28 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 3 cgctgcctaa taagcagtag catagctg 28 <210> 4 <211> 18 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli(EHEC) (ATCC 43895) <400> 4 attaaccaca ccccaccg 18 <210> 5 <211> 20 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli(EHEC) (ATCC 43895) <400> 5 gtcatggaaa ccgttgtcac 20 <210> 6 <211> 32 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli(EHEC) (ATCC 43895) <400> 6 cagttatttt gctgtggata tacgagggct tg 32 <210> 7 <211> 21 <212> DNA <213> Unknown <220> <223> Clostridium perfringens (ATCC 3624) <400> 7 cctgacacag gggaatcaca a 21 <210> 8 <211> 20 <212> DNA <213> Unknown <220> <223> Clostridium perfringens (ATCC 3624) <400> 8 catgtcctgc gctatcaacg 20 <210> 9 <211> 28 <212> DNA <213> Unknown <220> <223> Clostridium perfringens (ATCC 3624) <400> 9 cttggagagg ctatgcacta ttttggag 28 <110> Sanigen Co., Ltd. <120> Primer sets for simultaneous detection of Listeria monocytogenes,          EHEC and Clostridium perfringens, polymerase chain reaction kit          the <130> YP-17-145 <160> 9 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 1 gggatcgtcc tcgttatcaa c 21 <210> 2 <211> 23 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 2 tctatttaac cccagacgga gat 23 <210> 3 <211> 28 <212> DNA <213> Unknown <220> <223> Listeria monocytogenes (ATCC 15313) <400> 3 cgctgcctaa taagcagtag catagctg 28 <210> 4 <211> 18 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli (EHEC) (ATCC 43895) <400> 4 attaaccaca ccccaccg 18 <210> 5 <211> 20 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli (EHEC) (ATCC 43895) <400> 5 gtcatggaaa ccgttgtcac 20 <210> 6 <211> 32 <212> DNA <213> Unknown <220> <223> Enterohemorrhagic Escherichia coli (EHEC) (ATCC 43895) <400> 6 cagttatttt gctgtggata tacgagggct tg 32 <210> 7 <211> 21 <212> DNA <213> Unknown <220> Clostridium perfringens (ATCC 3624) <400> 7 cctgacacag gggaatcaca a 21 <210> 8 <211> 20 <212> DNA <213> Unknown <220> Clostridium perfringens (ATCC 3624) <400> 8 catgtcctgc gctatcaacg 20 <210> 9 <211> 28 <212> DNA <213> Unknown <220> Clostridium perfringens (ATCC 3624) <400> 9 cttggagagg ctatgcacta ttttggag 28

Claims (6)

삭제delete 서열번호 1에 기재된 핵산서열로 이루어진 정방향 프라이머, 서열번호 2에 기재된 핵산서열로 이루어진 역방향 프라이머 및 서열번호 3의 5‘말단에 형광염료 (fluorescence dye)로 FAM이 태깅 (tagging)된 서열번호 3에 기재된 핵산서열을 갖는 탐침 (probe)으로 구성된 리스테리아 모노사이토제니스 (Listeria monocytogenes)의 검출을 위한 프라이머 세트 (a);
서열번호 4에 기재된 핵산서열로 이루어진 정방향 프라이머, 서열번호 5에 기재된 핵산서열로 이루어진 역방향 프라이머 및 서열번호 6의 5‘말단에 형광염료 (fluorescence dye)로 VIC이 태깅 (tagging)된 서열번호 6에 기재된 핵산서열을 갖는 탐침 (probe)으로 구성된 장출혈성 대장균 (EHEC)의 검출을 위한 프라이머 세트 (b); 및
서열번호 7에 기재된 핵산서열로 이루어진 정방향 프라이머, 서열번호 8에 기재된 핵산서열로 이루어진 역방향 프라이머 및 서열번호 9의 5‘말단에 형광염료 (fluorescence dye)로 Cy5가 태깅 (tagging)된 서열번호 9에 기재된 핵산서열을 갖는 탐침 (probe)으로 구성된 가스괴저균 (Clostridium perfringens)의 검출을 위한 프라이머 세트 (c);를 포함하며,
상기 서열번호 1, 서열번호 2에 기재된 프라이머 및 서열번호 3에 기재된 탐침은, 중합효소연쇄반응 (polymerase chain reaction)을 위한 워킹볼륨 (working volume) 20 μl에 대해, 20 μM의 농도로 0.5 μl 첨가되어 사용되고,
상기 서열번호 4, 서열번호 5에 기재된 프라이머 및 서열번호 6에 기재된 탐침은, 중합효소연쇄반응 (polymerase chain reaction)을 위한 워킹볼륨 (working volume) 20 μl에 대해, 20 μM의 농도로 0.5 μl 첨가되어 사용되며,
상기 서열번호 7, 서열번호 8에 기재된 프라이머 및 서열번호 9에 기재된 탐침은, 중합효소연쇄반응 (polymerase chain reaction)을 위한 워킹볼륨 (working volume) 20 μl에 대해, 20 μM의 농도로 1 μl 첨가되어 사용되는 것을 특징으로 하는, 리스테리아 모노사이토제니스 (Listeria monocytogenes), 장출혈성 대장균 (EHEC) 및 가스괴저균 (Clostridium perfringens) 동시 검출을 위한 중합효소연쇄반응 (polymerase chain reaction)용 키트.
A reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 1, a reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 2, and a reverse primer consisting of the FAM-tagged FAM with a fluorescent dye at the 5 ' A primer set (a) for detection of Listeria monocytogenes consisting of a probe having the described nucleic acid sequence;
A reverse primer consisting of a nucleic acid sequence shown in SEQ ID NO: 4, a reverse primer consisting of a nucleic acid sequence shown in SEQ ID NO: 5, and a reverse primer consisting of a VIC-tagged VIC with a fluorescent dye at the 5 ' (B) a primer set for detection of enterohemorrhagic Escherichia coli (EHEC) consisting of a probe having the nucleic acid sequence described; And
A reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 7, a reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 8, and a reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 9 in which Cy5 was tagged with a fluorescent dye at the 5 ' And a primer set (c) for detection of gas gonococci ( Clostridium perfringens ) consisting of a probe having the nucleic acid sequence described,
The primers described in SEQ ID NO: 1 and SEQ ID NO: 2 and the probes described in SEQ ID NO: 3 were prepared by adding 0.5 mu l of 20 mu M of the working volume to 20 mu l of working volume for polymerase chain reaction Therefore,
The primers set forth in SEQ ID NOS: 4 and 5 and the probe set forth in SEQ ID NO: 6 were prepared by adding 0.5 μl at a concentration of 20 μM to a working volume of 20 μl for a polymerase chain reaction Therefore,
The primers described in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 were prepared by adding 1 [mu] l of a 20 [mu] M concentration to 20 [mu] l working volume for polymerase chain reaction A kit for polymerase chain reaction for simultaneous detection of Listeria monocytogenes , enterohemorrhagic Escherichia coli (EHEC) and Clostridium perfringens .
제2항에 있어서,
상기 중합효소연쇄반응(polymerase chain reaction)은,
실시간중합효소연쇄반응 (real-time PCR)인 것을 특징으로 하는 중합효소연쇄반응 (polymerase chain reaction)용 키트.
3. The method of claim 2,
The above-mentioned polymerase chain reaction can be carried out,
Wherein the polymerase chain reaction is a real-time PCR.
삭제delete 삭제delete 삭제delete
KR1020170110405A 2017-08-30 2017-08-30 Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof KR101846952B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170110405A KR101846952B1 (en) 2017-08-30 2017-08-30 Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170110405A KR101846952B1 (en) 2017-08-30 2017-08-30 Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof

Publications (1)

Publication Number Publication Date
KR101846952B1 true KR101846952B1 (en) 2018-04-10

Family

ID=61975126

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170110405A KR101846952B1 (en) 2017-08-30 2017-08-30 Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof

Country Status (1)

Country Link
KR (1) KR101846952B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102108432B1 (en) 2018-12-12 2020-05-08 주식회사 세니젠 Primer sets for simultaneous detection of Listeria monocytogenes and Listeria innocua, polymerase chain reaction kit thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Justin O' Grady et al., Food Microbiology, 25, p.75-84. 2008.*

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102108432B1 (en) 2018-12-12 2020-05-08 주식회사 세니젠 Primer sets for simultaneous detection of Listeria monocytogenes and Listeria innocua, polymerase chain reaction kit thereof

Similar Documents

Publication Publication Date Title
Nocker et al. Use of propidium monoazide for live/dead distinction in microbial ecology
CN111073955B (en) Rapid isothermal detection method for nucleic acid of vibrio cholerae O1 group and application
Cocolin et al. Molecular detection and identification of Brettanomyces/Dekkera bruxellensis and Brettanomyces/Dekkera anomalus in spoiled wines
Okuda et al. Characterization of the tuf B-sec E-nus G-rpl KAJL-rpo B gene cluster of the citrus greening organism and detection by loop-mediated isothermal amplification
US10227660B2 (en) Strand-invasion based DNA amplification method
Wang et al. Rapid and sensitive recombinase polymerase amplification combined with lateral flow strips for detecting Candida albicans
CN111118211A (en) Bovine sarcoidosis detection kit and method based on loop-mediated isothermal amplification technology
CN110734992A (en) LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit
Osek et al. Listeria monocytogenes in foods—From culture identification to whole‐genome characteristics
KR101846182B1 (en) Primer sets for simultaneous detection of Staphylococcus aureus, Bacillus cereus and Salmonella spp., polymerase chain reaction kit thereof
KR101846952B1 (en) Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof
Afroj et al. Simultaneous detection of multiple Salmonella serovars from milk and chicken meat by real-time PCR using unique genomic target regions
Suwanampai et al. Evaluation of loop-mediated isothermal amplification method for detecting enterotoxin A gene of Staphylococcus aureus in pork
CN100485045C (en) Method and kit for detecting pine wood nematode, and special-purpose primer and probe for same
Oh et al. Simultaneous identification of seven foodborne pathogens and Escherichia coli (Pathogenic and Nonpathogenic) using capillary electrophoresis–based single-strand conformation polymorphism coupled with multiplex PCR
KR101981401B1 (en) Primer set for detection of acute hepatopancreatic necrosis disease using the LAMP method, detection method and detection kit using the same
CN110894532A (en) RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS)
KR101299627B1 (en) Primers for simultaneous detection of foodborne bacteria and use thereof
Padungtod et al. Identification of Campylobacter jejuni isolates from cloacal and carcass swabs of chickens in Thailand by a 5′ nuclease fluorogenic polymerase chain reaction assay
US11447834B2 (en) Genetic array for simultaneous detection of multiple Salmonella serovars
Cheng et al. Simultaneous detection of food pathogens, Staphylococcus aureus, Salmonella enterica, Bacillus cereus and Vibrio parahaemolyticus by multiplex real-time polymerase chain reaction
KR102618075B1 (en) Composition for rapid detection of Salmonella D group in feed containing oligonucleotide set
KR100922217B1 (en) Gene composition for detecting vibrio virus and method for detecting vibrio virus
CN112111584A (en) Method for rapidly detecting escherichia coli in water
Chen et al. Reverse transcription loop-mediated isothermal amplification assay with high sensitivity to rapid detection of viable Salmonella in foods

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant