CN110734992A - LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit - Google Patents
LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit Download PDFInfo
- Publication number
- CN110734992A CN110734992A CN201911180875.3A CN201911180875A CN110734992A CN 110734992 A CN110734992 A CN 110734992A CN 201911180875 A CN201911180875 A CN 201911180875A CN 110734992 A CN110734992 A CN 110734992A
- Authority
- CN
- China
- Prior art keywords
- food
- borne
- kit
- seq
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP detection kit of kinds of food-borne enterocolitis yersinia, which comprises primers specifically designed for the ail genes of the food-borne enterocolitis yersinia, wherein the primers comprise SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.52CFU/mL is 1000 times higher than that of common PCR, has the advantages of good specificity, visual result and the like, and is suitable for real-time basic layer of food safety monitoring field,Quickly and accurately detecting yersinia enterocolitica.
Description
Technical Field
The invention relates to the technical field of biological monitoring, in particular to an LAMP detection kit for kinds of food-borne yersinia enterocolitica and application thereof.
Background
The yersinia enterocolitica is gram-negative bacilli and exists in various environments, food-borne pathogenic bacteria are adopted, and hosts of the yersinia enterocolitica are , can be transmitted through polluted food and water sources, and can cause diseases such as gastroenteritis, arthritis, septicemia, erythema nodosum and the like of people and other various animals.
Disclosure of Invention
The invention aims to solve the technical problem that a kit for quickly and accurately detecting yersinia enterocolitica is lacked at present, and provides an LAMP detection kit for kinds of yersinia enterocolitica.
In order to solve the technical problems, the invention is realized by the following technical scheme:
in aspects of the invention, a LAMP detection kit for species of food-borne enterocolitis yersinia is provided, the kit comprising primers specifically designed for the food-borne enterocolitis yersinia ail gene, the primers comprising SEQ ID No.2 and SEQ ID No.3, and SEQ ID No.4 and SEQ ID No. 5.
Preferably, the kit further comprises 10 × ThermoPol reaction buffer, dNTP mixture and MgSO4Solution, DNA polymerase.
Preferably, the kit further comprises a chromogenic reagent such as SYBR Green I.
In the invention, the kit adopts isothermal amplification for detection reaction, and the isothermal amplification comprises the following steps: incubating at the constant temperature of 60-70 ℃ for 50-70 minutes, and inactivating at the temperature of 80-90 ℃ for 3-8 minutes.
In another aspect of the invention, primers for LAMP detection of Yersinia enterocolitica which specifically amplify the gene of Yersinia enterocolitica ail are provided, the primers comprising SEQ ID No.2 and SEQ ID No.3, and SEQ ID No.4 and SEQ ID No. 5.
In another aspect of the invention, the invention also provides the use of the LAMP detection kit for detecting food-borne enterocolitis yersinia.
By adopting the kit, whether the food contains the yersinia enterocolitica can be detected on the basic site in real time, quickly and accurately, and the safety monitoring of the food can be realized conveniently and quickly.
In another aspect of the invention, the invention also provides the use of the LAMP detection kit for identifying food-borne enterocolitis yersinia in a laboratory.
In another aspect of the invention, there is also provided methods of detecting food-borne yersinia enterocolitica in a food product, comprising the steps of:
sampling and enrichment culture of food;
extracting the DNA of the enriched sample;
detecting the DNA of the sample by adopting the LAMP detection kit;
and (4) judging a result: visually observing whether the reaction liquid in the reaction tube has sediment or not, and if so, indicating that the food contains food-borne enterocolitis yersinia; or observing the color of the reaction solution under an ultraviolet lamp, and if the reaction solution shows yellow-green fluorescence, the reaction solution is positive.
In the present invention, the term "primer" means an oligonucleotide capable of initiating primer extension of a synthetic product in the presence of a suitable polymerization reagent when paired with strands of DNA to maximize amplification efficiency, the primer is preferably single-stranded.
The LAMP detection kit for the food-borne enterocolitis yersinia has the detection sensitivity of 2.8 multiplied by 102CFU/mL is 1000 times higher than that of common PCR, has the advantages of good specificity, visual result and the like, and is suitable for real-time, rapid and accurate detection of enterocolitis yersinia in laboratories and food safety monitoring field base layers.
Drawings
The invention is described in further detail with reference to the figures and the detailed description.
FIG. 1 is a diagram showing the results of optimal primer screening and primer utility identification of food-borne pathogenic bacterium Yersinia enterocolitica in example 1 of the present invention;
FIG. 2 is a diagram showing the result of specific identification of a Yersinia enterocolitica system for detecting food-borne pathogenic bacteria by LAMP in example 2 of the present invention;
FIG. 3 is a graph of the sensitivity identification result of the detection of the food-borne pathogenic bacterium Yersinia enterocolitica system by LAMP in example 3 of the present invention.
Detailed Description
Example 1 establishment of food-borne enterocolitis Yersinia LAMP detection method
The ail gene coding the adhesion-removal invasion site is selected as a target gene for detection (the ail whole gene sequence of yersinia enterocolitica is shown as SEQ ID NO. 1), 2 groups of detection primers are designed, and the primers respectively consist of an inner primer FIP/BIP and an outer primer F3/B3, and the primer sequences are shown in the following table 1.
TABLE 1 primer sequences
Extracting DNA of food-borne pathogenic bacteria Yersinia enterocolitica as a template, setting water as a negative control, carrying out LAMP amplification reaction, and carrying out result detection on reaction products.
The composition ratio of each component in LAMP amplification is shown in Table 2 below.
TABLE 2 constitution of the Components in the LAMP amplification reaction
The mixture was added to a PCR tube and isothermal amplification was performed in a water bath. The amplification steps are as follows: incubating at constant temperature of 65 ℃ for 1h, and inactivating at 85 ℃ for 5 min. SYBR Green I may also be added after inactivation of the polymerase.
And (4) observing results: visually observing and comparing the turbidity of the reaction solution in each EP tube, wherein the turbid reaction solution contains yersinia enterocolitica; simultaneously, observing the color of the reaction solution in the EP tube under an ultraviolet lamp, and if the reaction solution emits yellow green fluorescence under the ultraviolet lamp light, the reaction solution is yersinia enterocolitica; in addition, 10.0. mu.L of LAMP amplification product was mixed with the loading buffer and subjected to result analysis and identification on 2% agarose gel electrophoresis.
The results of example 1 are shown in FIG. 1, and in 2 sets of LAMP primers designed according to the ai-specific genes, the ai (1) primer set can be combined with the DNA of a target strain and generate an amplification reaction, but not combined with the DNA of a negative control strain and generate an amplification reaction (FIG. 1A), while the ai (2) primer set does not have unique property and can be combined with the DNA of the negative control strain and generate an amplification reaction (FIG. 1B), so the ai (1) primer set is selected as a primer of the LAMP detection system of Yersinia enterocolitica.
In FIG. 1, A and B are graphs showing the feasibility identification results of 2 pairs of LAMP primers screened and synthesized for the ail gene, wherein FIG. 1A is the ail (1) gene, FIG. 1B is the ail (2) gene, lanes 1-7 are genomic DNAs of enterohemorrhagic Escherichia coli O157, H7ATCC43889, Salmonella SL7207, Staphylococcus aureus standard strain SA29213, Staphylococcus aureus isolate SAFX02, Listeria monocytogenes standard strain LMF2365, Listeria monocytogenes isolate FX01 and food-borne pathogenic bacteria Yersinia enterocolitica ATCC23715, respectively, and M represents 2000bp DNA Marker.
Example 2 LAMP detection of specificity of Yersinia enterocolitica
Extracting the genome DNA of Yersinia enterocolitica strain ATCC23715, and performing LAMP amplification reaction by using the genome DNA of enterohemorrhagic Escherichia coli O157, H7ATCC43889, Sa bacteria SL7207, Staphylococcus aureus standard strain SA29213, Staphylococcus aureus isolate SAFX02, Listeria monocytogenes standard strain LMF2365, Listeria monocytogenes isolate FX01, Campylobacter jejuni HU-CJFX01, Escherichia coli ETEC-2, Escherichia coli ETEC-4, Escherichia coli ETEC-5 and Escherichia coli ETEC-6 Yersinia enterocolitica ATCC23715 and water-negative control.
LAMP was amplified using the selected ail (1) primer set, and the reaction system is shown in Table 3 below.
TABLE 3 LAMP amplification reaction System
Adding the mixture into a PCR tube, and carrying out isothermal amplification in a water bath kettle, wherein the amplification step is as follows: incubating at constant temperature of 65 ℃ for 1h, and inactivating at 85 ℃ for 5 min.
Taking 15.0 mu L of LAMP amplification product, adding 1.0 mu L of SYBR Green I, and observing by naked eyes and under 365nm ultraviolet light; meanwhile, 10.0. mu.L of LAMP amplification product is uniformly mixed with the loading buffer solution, and the result is verified on 2% agarose gel electrophoresis.
The result of the example 2 is shown in the attached figure 2, the LAMP detection method established by taking the yersinia enterocolitica ail gene as a detection target gene has good specificity, in the figure 2, A is a result graph observed under natural light by adding 1 muL SYBR Green I into a gene reaction product of the yersinia enterocolitica ail pathogenic bacterium ail (1) gene reaction product, B is a result graph observed under the natural light by adding 2% agarose gel electrophoresis of the gene reaction product of the yersinia enterocolitica ail pathogenic bacterium ail (1) gene reaction product of the enterocolitica ail pathogenic bacterium, C is a result graph observed under the ultraviolet light with the wavelength of 365nm, sample 6 is the genome DNA of the yersinia enterocolitica bacterium ATCC23715, samples 1-5 and 7-13 are non-enterocolitica yersinia genome DNA (as a reference), and specifically comprise enterohemorrhagic Escherichia coli strain O157, H7ATCC 8843729, Sasa 7207, Staphylococcus aureus SL standard strain SA29213, Staphylococcus aureus isolate strain FXX 02, SAFE strain, Escherichia coli FX hyperplasia strain, Escherichia coli FX-E strain, Escherichia coli FX-8-E-.
Example 3 sensitivity of LAMP detection of food-borne Yersinia enterocolitica
Taking the food-borne pathogenic bacterium Yersinia enterocolitica ATCC23715 bacterial liquid in logarithmic growth phase, carrying out 10-fold serial dilution by using normal saline, carrying out plate colony counting, and calculating the concentration of the original bacterial liquid. The original bacterial liquid concentration of the food-borne pathogenic bacterium yersinia enterocolitica is measured to be 2.8 multiplied by 10 by a plate colony calculation method9CFU/mL。
Carrying out gradient dilution of 10 times by using food-borne pathogenic bacterium yersinia enterocolitica with known concentration, wherein the dilution is respectively 2.8 multiplied by 109CFU/mL、2.8×108CFU/mL、2.8×107CFU/mL、2.8×106CFU/mL、2.8×105CFU/mL、2.8×104CFU/mL、2.8×103CFU/mL、2.8×102CFU/mL、2.8×101CFU/mL and 2.8X 100CFU/mLAnd extracting genome DNA from the 10-fold gradient diluted bacterial liquid, respectively carrying out LAMP and common PCR amplification detection by taking the genome DNA extracted from each food-borne pathogenic bacterium yersinia enterocolitica diluted gradient bacterial liquid as a template, and setting water as a negative control.
LAMP was amplified using the selected ail (1) primer set, and the reaction system was the same as that described in Table 3 above. . Adding the mixture into a PCR tube, and carrying out isothermal amplification in a water bath kettle, wherein the amplification step is as follows: incubating at constant temperature of 65 ℃ for 1h, and inactivating at 85 ℃ for 5 min.
The general PCR reaction system using F3 and B3 in the ail (1) primer set as amplification primer pairs is shown in Table 4 below.
TABLE 4 general PCR reaction System
Adding the mixture into a PCR tube, and carrying out amplification on a PCR instrument, wherein the amplification step is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 40s, annealing at 52 ℃ for 40s, and extension at 72 ℃ for 30s for 35 cycles; further extension was carried out at 72 ℃ for 10 min.
Mixing 10.0 mu L of LAMP amplification product with the loading buffer solution, and performing result analysis and identification on 2% agarose gel electrophoresis; and analyzing and identifying the result of the common PCR amplification product by 1% agarose gel electrophoresis.
The results of example 3 show (see FIG. 3) that the sensitivity of the conventional PCR to genes is 2.8X 105CFU/mL, while the gene sensitivity of LAMP reaction system can reach 2.8 × 102CFU/mL, 1000 times the sensitivity of normal PCR. In fig. 3, a is a sensitivity measurement result diagram established by the LAMP detection of the food-borne pathogenic bacterium yersinia enterocolitica system, and B: common PCR gene sensitivity test result chart; the concentrations of lanes 1 to 10 in the figure are 2.8X 10, respectively9CFU/mL、2.8×108CFU/mL、2.8×107CFU/mL、2.8×106CFU/mL、2.8×105CFU/mL、2.8×104CFU/mL、2.8×103CFU/mL、2.8×102CFU/mL、2.8×101CFU/mL and 2.8X 100CFU/mL, lane 11 is a negative control, M is2000bp of Maker; the sensitivity of common PCR gene can reach 2.8 multiplied by 105CFU/mL, and the gene sensitivity of the LAMP detection primer reaction system for the strain ail (1) constructed by the invention can reach 2.8 multiplied by 102CFU/mL, compared to the ordinary PCR sensitivity is 1000 times higher.
The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Shanghai animal doctor institute of Chinese academy of agricultural sciences (Shanghai center of Chinese centers of animal health and epidemiology)
LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>2220
<212>DNA
<213> Yersinia enterocolitica (Yersinia enterocolitica)
<400>1
ggatcacatc atcaataccg aagcccaaga gattagccag tgtgccagaa aaatggctcg 60
atgggacgtt ggtggaagga agcaaatatt gcttacggca cgaaaacgca tgatagatga 120
gcttcagatg tatttgccag gactgggaag tcacgtgggt aattactgtg acatccagta 180
ataaaacaga gcctctatta aaggagcttc ccaatttgaa atcagaaaaa ttacatcata 240
aacatgggtg tccagaagtc agtcggcgat atatccattt aaagagcatt gagctatgac 300
cagtattcat caactacaga acaaaaatac aggaataagt gactgatggg ataaagctga 360
ggtaagctca cagtactgta tcaatatcca tatttacata tatatcatgg atttggcatt 420
atatcatcag ccatgtcagt gatatggtta ttgtattagt attgttataa caatctggat 480
tatttttatg aaaaagacat tactagctag ttctctaata gcctgtttat caattgcgtc 540
tgttaatgtg tacgctgcga gtgaaagtag tatttctatt ggttatgcgc aaagccatgt 600
aaaagaaaat gggtatacat tggataatga ccctaaaggt tttaacctga agtaccgtta 660
tgaactcgat gataactggg gagtaataggttcgtttgct tatactcatc agggatatga 720
tttcttctat ggcagtaata agtttggtca tggtgatgtt gattactatt cagtaacaat 780
ggggccatct ttccgcatca acgaatatgt tagcctttat ggattactgg gggccgctca 840
tggaaaggtt aaggcatctg tatttgatga atcaatcagt gcaagtaaga cgtcaatggc 900
atacggggca ggggtgcaat tcaacccact tccaaatttt gtcattgacg cttcatatga 960
atactccaaa ctcgatagca taaaagttgg cacctggatg cttggtgcag ggtatcgatt 1020
ctaatcatct cagatagtga aaacccacct gagtgaagtg aaccccattt attggacact 1080
tttcctggcg gttgacatgg cctgatttcg gtactgcacc ggactcaggc cgtttaattt 1140
tactttgatc ctttcgttgt tgtagtaatg gatatactca tccaccgctt ttttcagttg 1200
ttctacatct tcgtattttt cattgtgcca gcattcagtc ttcagcagac caaaaaagtt 1260
ttctatcaca gcattatcca ggcagttgcc cttgcgcgac atactttgct ttacttcgcc 1320
agaccccagc cttttcttat agcttgccat ctgatattgc cagccctgat ccgagtgaag 1380
tacaggttca tcgcctgagt tcaacttctg tagcgcatca tcaagcattt tatcaatcag 1440
gttcattccg ggatgcgtat ccatctgcca ggcaacgact tcgctgttat acagatccag 1500
cacgggtgac agatacagct ttttacccct gacgttgaac tcggtcacat cgttacccac 1560
ttctggttag gggcttcggc agtaaatttt cgagcaagta tattagggac cactttaccg 1620
taggcaccct gatatgactg atatttttta cgacgcaagt tagatgcaag ctgctgttgc 1680
cgcatgagtt ttcgtacggt tttatggtta agactcccgc cctcattgcg tagggccagc 1740
gttattctgc ggtaaccata gcgaccttta tgatggtgaa acagggtttt tattctttgt 1800
ttctcatccg cataagtctc ttcacgacca ctggatttta cctgccagta gaaggtgctg 1860
cgcggaagac cggccacgta aagcaaggtc gccagtttat acagatgcct taattcagtg 1920
attattcgcg ttttttccgc tgcttctctt acaggtggta ttcactgagt gccaccgata 1980
atgcgcaggc aaagtcatta acgacccccg ccgctcaccc tgagcatggt cgttgatggc 2040
ttttatattt tccatagagc agaggatgat tctttatgtc ccgagtgaac tggggtgaac 2100
ggttatcccg gtttgccgct gaatggcaac ggacgggaat atcccctaaa gagtggtgtg 2160
agagagaagg ttattcgtgg ggaacagcga aagcgtatat ttcgataaaa gcagcgaaag 2220
<210>2
<211>22
<212>DNA
<213> Artificial sequence (Artificial)
<400>2
ccctaaaggt tttaacctga ag 22
<210>3
<211>22
<212>DNA
<213> Artificial sequence (Artificial)
<400>3
ccagtaatcc ataaaggcta ac 22
<210>4
<211>44
<212>DNA
<213> Artificial sequence (Artificial)
<400>4
atccctgatg agtataagca aacgtaccgt tatgaactcg atga 44
<210>5
<211>42
<212>DNA
<213> Artificial sequence (Artificial)
<400>5
tggcagtaat aagtttggtc atggttgatg cggaaagatg gc 42
<210>6
<211>18
<212>DNA
<213> Artificial sequence (Artificial)
<400>6
ggcgacagat tataccgt 18
<210>7
<211>19
<212>DNA
<213> Artificial sequence (Artificial)
<400>7
agtgagcact tctcaaact 19
<210>8
<211>42
<212>DNA
<213> Artificial sequence (Artificial)
<400>8
cgaagtactc attacctctg ggcgactcta gacccccaga tg 42
<210>9
<211>42
<212>DNA
<213> Artificial sequence (Artificial)
<400>9
atcacgcgag aggaacacaa aagtggaaac atatccgtca tc 42
Claims (10)
- The LAMP detection kit for yersinia enterocolitica is characterized by comprising primers specifically designed for the ail genes of the yersinia enterocolitica, wherein the primers comprise SEQ ID No.2 and SEQ ID No.3, and SEQ ID No.4 and SEQ ID No. 5.
- 2. The kit of claim 1, further comprising 10 x ThermoPol reaction buffer, dNTP mix, MgSO4And (3) solution.
- 3. The kit of claim 1, wherein the kit further comprises a DNA polymerase.
- 4. The kit of claim 1, further comprising a chromogenic reagent.
- 5. The kit of , wherein the kit employs isothermal amplification for detection reactions.
- 6. The kit of claim 5, wherein the step of isothermal amplification comprises: incubating at the constant temperature of 60-70 ℃ for 50-70 minutes, and inactivating at the temperature of 80-90 ℃ for 3-8 minutes.
- 7, primers for LAMP detection of food-borne enterocolitis Yersinia, which specifically amplify food-borne enterocolitis Yersinia ail gene, the primers comprise SEQ ID NO.2 and SEQ ID NO.3, and SEQ ID NO.4 and SEQ ID NO. 5.
- 8. The LAMP detection kit of claim 1, which is used for detecting food-borne enterocolitis yersinia.
- 9. The LAMP detection kit of claim 1, which is used for identifying food-borne enterocolitis yersinia in laboratories.
- 10, method for detecting food-borne enterocolitis yersinia, comprising the steps of:sampling and enrichment culture of food;extracting the DNA of the enriched sample;detecting the DNA of the sample by adopting the LAMP detection kit of claim 1;and (4) judging a result: visually observing whether the reaction liquid in the reaction tube has sediment or not, and if so, indicating that the food contains food-borne enterocolitis yersinia; or observing the color of the reaction solution under an ultraviolet lamp, and if the reaction solution shows yellow-green fluorescence, the reaction solution is positive.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911180875.3A CN110734992A (en) | 2019-11-27 | 2019-11-27 | LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911180875.3A CN110734992A (en) | 2019-11-27 | 2019-11-27 | LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110734992A true CN110734992A (en) | 2020-01-31 |
Family
ID=69273903
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911180875.3A Pending CN110734992A (en) | 2019-11-27 | 2019-11-27 | LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110734992A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111534617A (en) * | 2020-04-24 | 2020-08-14 | 江苏农林职业技术学院 | Primer for detecting yersinia enterocolitica and application thereof |
| CN112111590A (en) * | 2020-11-03 | 2020-12-22 | 上海海关动植物与食品检验检疫技术中心 | Primer, probe, kit and detection method for detecting real-time fluorescent RAA of Yersinia enterocolitica |
| CN112375834A (en) * | 2020-11-23 | 2021-02-19 | 南开大学 | PCR detection method and application of 4 main O antigen serotypes of yersinia enterocolitica |
| CN114588144A (en) * | 2022-03-09 | 2022-06-07 | 青岛农业大学 | Bacteriostatic application of chlorogenic acid |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434890A (en) * | 2016-08-30 | 2017-02-22 | 上海生物信息技术研究中心 | Method, primers and kit for quickly detecting yersinia enterocolitica in constant-temperature manner |
| CN107663545A (en) * | 2017-09-19 | 2018-02-06 | 温和心 | Detect primer sets and the application of yersinia enterocolitica |
-
2019
- 2019-11-27 CN CN201911180875.3A patent/CN110734992A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434890A (en) * | 2016-08-30 | 2017-02-22 | 上海生物信息技术研究中心 | Method, primers and kit for quickly detecting yersinia enterocolitica in constant-temperature manner |
| CN107663545A (en) * | 2017-09-19 | 2018-02-06 | 温和心 | Detect primer sets and the application of yersinia enterocolitica |
Non-Patent Citations (3)
| Title |
|---|
| HONGWEI GAO等: "Application of loop-mediated isothermal amplification for detection of Yersinia enterocoliticain pork meat", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| STEFANOS PETSIOS等: "Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 * |
| 张蕴哲等: "RF-LAMP技术检测鸡肉中小肠结肠炎耶尔森氏菌", 《食品研究与开发》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111534617A (en) * | 2020-04-24 | 2020-08-14 | 江苏农林职业技术学院 | Primer for detecting yersinia enterocolitica and application thereof |
| CN111534617B (en) * | 2020-04-24 | 2024-01-23 | 江苏农林职业技术学院 | Primer for detecting yersinia enterocolitica and application thereof |
| CN112111590A (en) * | 2020-11-03 | 2020-12-22 | 上海海关动植物与食品检验检疫技术中心 | Primer, probe, kit and detection method for detecting real-time fluorescent RAA of Yersinia enterocolitica |
| CN112375834A (en) * | 2020-11-23 | 2021-02-19 | 南开大学 | PCR detection method and application of 4 main O antigen serotypes of yersinia enterocolitica |
| CN112375834B (en) * | 2020-11-23 | 2022-10-04 | 南开大学 | PCR detection method and application of 4 main O antigen serotypes of yersinia enterocolitica |
| CN114588144A (en) * | 2022-03-09 | 2022-06-07 | 青岛农业大学 | Bacteriostatic application of chlorogenic acid |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110734992A (en) | LAMP (loop-mediated isothermal amplification) detection kit for food-borne enterocolitis yersinia and application of LAMP detection kit | |
| CN112522429B (en) | Method and reagent set for detecting bacillus anthracis by RPA (reverse transcriptase polymerase chain reaction) combined CRISPR (clustered regularly interspaced short palindromic repeats) technology | |
| CN111020010B (en) | Rapid constant temperature detection method, primer set and kit for listeria monocytogenes | |
| Wang et al. | Rapid and sensitive detection of Shigella spp. and Salmonella spp. by multiple endonuclease restriction real-time loop-mediated isothermal amplification technique | |
| Wang et al. | Application of an improved loop-mediated isothermal amplification detection of Vibrio parahaemolyticus from various seafood samples | |
| CN104946749B (en) | A kind of universal primer for field quick detection brucella and probe and kit | |
| CN111394490A (en) | CRISPR-Cas12a detection primer group for eupolyphaga and application thereof | |
| Azinheiro et al. | Evaluation of different genetic targets for Salmonella enterica serovar Enteriditis and Typhimurium, using Loop-Mediated Isothermal AMPlification for detection in food samples | |
| Amoupour et al. | Differentiation of Brucella abortus and B. melitensis biovars using PCR-RFLP and REP-PCR | |
| Li et al. | Loop-mediated isothermal amplification method targets to the phoP gene for detection of Yersinia enterocolitica | |
| Liu et al. | Development of a Loop‐Mediated Isothermal Amplification Assay Based on lmo0460 Sequence for Detection of L isteria monocytogenes | |
| CN104911269A (en) | Primers, probe and kit for identifying Brucella A19 vaccine strain in aerosol | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| Suwanampai et al. | Evaluation of loop-mediated isothermal amplification method for detecting enterotoxin A gene of Staphylococcus aureus in pork | |
| CN113005211A (en) | LAMP primer and method for detecting tigecycline high-level drug resistance gene tet (X) and variant thereof | |
| KR101846182B1 (en) | Primer sets for simultaneous detection of Staphylococcus aureus, Bacillus cereus and Salmonella spp., polymerase chain reaction kit thereof | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| KR101846952B1 (en) | Primer sets for simultaneous detection of Listeria monocytogenes, EHEC and Clostridium perfringens, polymerase chain reaction kit thereof | |
| CN107937584B (en) | Meat salmonella molecular detection kit and non-diagnostic detection method thereof | |
| Zende et al. | Loop-Mediated Isothermal Amplification Assay (LAMP): A Rapid Tool for Diagnosis of Food Borne and Zoonotic Pathogens: A Review | |
| Oh et al. | Simultaneous detection of 10 foodborne pathogens using capillary electrophoresis-based single strand conformation polymorphism | |
| RU2738358C1 (en) | Set of oligonucleotide primers and fluorescent-labelled probes and method for detecting dna of agents of glanders and melioidosis by pcr method with product detection in real time | |
| CN112779326B (en) | GeXP multiplex PCR detection kit for simultaneously identifying sulfonamide antibiotic drug resistance genes and primer group thereof | |
| Nwaiwu et al. | Probing the Evolution of Genes Associated With DNA Methylation in Listeria monocytogenes | |
| CN112779325B (en) | GeXP multiplex PCR detection kit for simultaneously identifying beta-lactam antibiotic drug-resistant genes and primer group thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200131 |