CN114410840A

CN114410840A - Kit for detecting novel coronavirus and N501Y mutation site thereof and detection method

Info

Publication number: CN114410840A
Application number: CN202210020388.6A
Authority: CN
Inventors: 蒋析文; 彭海龙; 范建; 莫斯喻
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2022-01-10
Filing date: 2022-01-10
Publication date: 2022-04-29

Abstract

The invention provides a kit and a detection method for detecting novel coronavirus and N501Y mutation sites thereof, and particularly provides a primer probe set which is high in sensitivity, strong in specificity, good in repeatability, free of cross reaction on the novel wild coronavirus and capable of carrying out multiple detection and can be used for detecting and identifying the novel coronavirus and 501Y.V2 mutant strains thereof from a large number of primer probe sets through multiple rounds of screening verification.

Description

Kit for detecting novel coronavirus and N501Y mutation site thereof and detection method

Technical Field

The invention belongs to the field of biotechnology and molecular diagnosis, can be used for detecting 2019-nCoV novel coronavirus and N501Y mutation sites, and particularly relates to a nucleic acid detection kit for the novel coronavirus 2019-nCoV N gene and the 501Y.V2 mutant N501Y mutation sites.

Background

The clinical manifestations of the novel coronavirus mainly include fever, hypodynamia and dry cough. A few patients have nasal obstruction, watery nasal discharge, diarrhea, etc. Some patients only show low fever, slight weakness, etc., and no pulmonary inflammation, and most of them recover after 1 week. The prognosis is good in most patients, and patients with severe infection can cause pneumonia, severe respiratory malformation syndrome, renal failure and even death. The novel coronavirus (2019-nCoV) has strong infectivity to human, and the lung infection caused by the novel coronavirus is named as novel coronavirus pneumonia (NCIP).

The novel coronavirus (2019-nCoV) belongs to a member of the beta coronavirus genus, is enveloped, has a circular or oval particle shape, is usually polymorphic, has the diameter of 60-140nm, and is the 7 th coronavirus which is known to infect people at present. 2019-nCoV has higher mutation rate as an RNA virus. With the increasing number of mutants, the identification requirement for each mutant is increased. At present, the traditional isolation culture method for culturing and detecting the 2019 novel coronavirus consumes long time and is high in cost, and a rapid and complete 2019 novel coronavirus detection system cannot be formed. Therefore, it is necessary to develop a rapid, sensitive and convenient detection system for the new coronavirus (2019-nCoV) and each mutant strain to meet the clinical requirement.

Disclosure of Invention

The invention develops a detection method and a detection kit aiming at the novel coronavirus and the N501Y mutation site thereof, so that the infected patient can be detected with high efficiency, high specificity and low cost.

In a first aspect of the present invention, there is provided a set of primer pairs for detecting a novel coronavirus and its N501Y mutation site (501y.v2 mutant strain), the set of primer pairs comprising:

a first primer pair, the first primer pair comprising:

a forward primer shown as SEQ ID NO. 1; and, a reverse primer as shown in SEQ ID NO. 2.

In another preferred embodiment, the primer pair set further includes:

a second primer pair, the second primer pair comprising:

a forward primer shown as SEQ ID NO. 4; and, a reverse primer as shown in SEQ ID NO. 5.

In another preferred embodiment, the primer pair set further includes:

a third primer pair, the third primer pair comprising:

a forward primer shown as SEQ ID NO. 8; and, a reverse primer as shown in SEQ ID NO. 9.

In a second aspect of the present invention, there is provided a probe set for detecting a novel coronavirus and a 501y.v2 mutant strain thereof, the probe set comprising a first probe having a nucleotide sequence as shown in SEQ ID No. 3.

In another preferred embodiment, the probe set further comprises a second probe with the nucleotide sequence shown as SEQ ID NO. 6; preferably, the probe set further comprises a blocking probe shown in SEQ ID NO. 7.

In another preferred embodiment, the probe set further comprises a third probe with the nucleotide sequence shown in SEQ ID NO. 10.

In another preferred embodiment, the 5' end of each probe comprises a fluorescent reporter group; and/or, the 3' end of each probe comprises a fluorescence quenching group.

In another preferred embodiment, the fluorescent reporter groups labeled with each probe are different from each other.

In a third aspect of the invention, a kit for detecting a novel coronavirus and a 501y.v2 mutant strain thereof is provided, the kit comprising the primer pair set according to the first aspect of the invention.

In another preferred embodiment, the kit further comprises a probe set according to the second aspect of the present invention.

In another preferred embodiment, the kit comprises a primer probe mixture, and the primer probe mixture comprises the primer pair set according to the first aspect of the present invention and the probe set according to the second aspect of the present invention.

In another preferred embodiment, the kit further comprises one or more components selected from the group consisting of: hot start Taq abzyme, reverse transcriptase, dNTPs.

In another preferred embodiment, the kit further comprises a negative quality control product.

In another preferred embodiment, the kit further comprises a positive quality control substance.

In another preferred embodiment, the concentration of each primer and probe in the RT-PCR reaction system is prepared to be 0.1-1 μ M during the use of the kit.

In another preferred embodiment, the concentration of each primer and probe in the RT-PCR reaction system prepared in the kit is 0.1-1 μ M.

In another preferred embodiment, the concentration of dNTPs in the RT-PCR reaction system prepared in the kit is 0.2-0.4 mM.

In another preferred example, the kit is used for preparing an RT-PCR reaction system with 1-3U of C-MMLV enzyme and/or 2.5-5U of hot start Taq enzyme.

In a fourth aspect of the present invention, there is provided a method for detecting a novel coronavirus and a 501y.v2 mutant strain thereof, the method comprising the steps of:

(1) providing a nucleic acid sample of an object to be detected;

(2) preparing an RT-PCR reaction system and carrying out RT-PCR detection:

wherein, the RT-PCR reaction system comprises: the nucleic acid sample provided in step (1), the primer pair set according to the first aspect of the present invention, and the probe set according to the second aspect of the present invention.

In another preferred example, the nucleic acid sample may be from a pharyngeal swab sample, an alveolar lavage fluid sample, a blood sample, a sputum sample, a stool sample, or an environmental sample.

In another preferred embodiment, the method is a detection method for non-diagnostic purposes.

In another preferred embodiment, the PCR reaction system further comprises a positive quality control substance, and/or a negative quality control substance.

In another preferred embodiment, the PCR reaction system further comprises a PCR reaction enzyme system.

In the fifth aspect of the present invention, there is provided a use of the primer set of the first aspect of the present invention and/or the probe set of the second aspect of the present invention for preparing a PCR detection kit, wherein the PCR detection kit is used for detecting a novel coronavirus and a 501y.v2 mutant strain thereof.

In another preferred embodiment, the PCR is RT-PCR.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1: n gene sensitivity detection (FAM channel).

FIG. 2: sensitive detection of the N501Y mutation site (Texas Red channel).

FIG. 3: internal standard channel test results (Cy5 channel).

FIG. 4: specific detection of blocking probe at the N501Y mutation site.

FIG. 5: double detection specificity test of N gene and N501Y mutation site.

FIG. 6: internal standard channel test results.

FIG. 7: the N gene and the N501Y mutation site double detection of interfering substances test (FAM channel).

FIG. 8: the N gene and the N501Y mutation site double detection of interfering substances test (Texas Red channel).

FIG. 9: double detection precision test (FAM channel) of N gene and N501Y mutation site.

FIG. 10: the precision test (Texas Red channel) for the double detection of the N gene and the N501Y mutation site.

FIG. 11: the detection results of the control primer pair N-F2 and N-R2.

FIG. 12: the detection results of the control primer pair N-F3 and N-R3.

FIG. 13: the detection results of the control primer pairs N501Y-F2 and N501Y-R2.

FIG. 14: the detection results of the control primer pairs N501Y-F3 and N501Y-R3.

Detailed Description

The invention aims at novel coronavirus and a 501Y.V2 mutant thereof, selects a wild type novel coronavirus N gene and a 501Y.V2 mutant N501Y mutant site to develop a diagnostic reagent, and aims to provide a novel coronavirus and a detection kit of a 501Y.V2 mutant thereof so as to detect a patient infected by the novel coronavirus and the 501Y.V2 mutant thereof with high efficiency, high specificity and low cost. The kit provided by the invention adds the detection of the 501Y.V2 mutant strain on the basis of taking the N gene as a novel coronavirus detection, and also comprises an endogenous internal standard detection system which is used for monitoring the specimen collection, the nucleic acid extraction process and the PCR amplification process, so that the occurrence of false negative results can be reduced. The kit has the characteristics of high sensitivity, strong specificity, good repeatability and the like.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Real-time fluorescence PCR is a technique based on the principle of Fluorescence Resonance Energy Transfer (FRET). The real-time fluorescent PCR technology based on TaqMan fluorescent labeled probe utilizes thermostable DNA polymerase Taq enzyme to have polymerase activity in 5 '-3' direction and exonuclease activity in 5 '-3' direction of nucleotide sequence combined with target sequence in polymerization extension process. The TaqMan fluorescent probe is respectively marked with a fluorescence emitting group and a quenching group at the 5 ' end and the 3 ' end, and the 3 ' end of the probe is phosphorylated to prevent the probe from being extended in the PCR amplification process. The quencher inhibits fluorescent emission of the emissive moiety when the probe remains intact. Once the emitting group is separated from the quenching group, the inhibition is released, and the optical density at the emission wavelength of the fluorescent emitting group is increased and detected by the fluorescence detection system. The renaturation period probe is hybridized with template DNA, the Taq enzyme in the extension period moves along the DNA template along with the extension of the primer, when the Taq enzyme moves to the position of the probe, the 5' exonuclease activity of the Taq DNA polymerase can degrade the specific fluorescence labeled probe, the fluorescence reporter group is separated from the quenching group, and fluorescence is emitted.

The main method for determining the infection of the novel coronavirus is nucleic acid detection, however, the nucleic acid detection kit on the market is mostly used for detecting the wild type novel coronavirus which lacks the mutant type novel coronavirus detection product, and the mutant type novel coronavirus is more infectious. At this stage, the detection of the occurrence of mutations in the novel coronavirus mainly relies on gene sequencing. However, for the current outbreak of epidemic situation, the gene sequencing needs to consider expert personnel, sequencing equipment and computing architecture required for processing and storing data, and the cost and workload involved in the gene sequencing are huge, which is a limitation of the gene sequencing. The fluorescent PCR method can make up for the deficiencies in detection.

Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.

There are many factors that affect multiplex PCR reactions, such as:

(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the occurrence of a large amount of amplification products, and thus, primers and templates thereof which are at a disadvantage in the early stage are more difficult to react, and finally, the amount of amplification products is so small that they cannot be detected.

(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.

(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.

(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are third-party DNA-mediated dimers, and these dimers, like non-specific primers, interfere with the competition between primers and target binding sites, affecting amplification efficiency.

Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.

The invention provides a novel nucleic acid detection kit for a mutant strain of coronavirus 2019-nCoV and 501Y.V2, which comprises a PCR reaction primer probe mixed solution for specifically detecting 2019-nCoV N gene and N501Y mutation sites in a sample:

wherein, the primer sequence for detecting the N gene is as follows:

SEQ ID NO. 1: 5'-GCAACTGAGGGAGCCTTGAATA-3' and

SEQ ID NO.2:5’-TGTAGCACGATTGCAGCATTG-3’，

the sequence and label of the corresponding detection probe are:

SEQ ID NO.3：5’FAM-AAGATCACATTGGCACCCGCAATCC-BHQ1-3’；

the primer sequence for detecting the N501Y mutation site is as follows:

SEQ ID NO.4: 5'-ATCATATGGTTTCCAACCCAGTT-3', and

SEQ ID NO.5:5’-AAACAGTTGCTGGTGCATGTAG-3’，

the sequence of the N501Y wild type blocker is as follows:

SEQ ID NO.6:5’-GGTTTCCAACCCACTAATGGTGTTGG-3’，

the sequence and label of the corresponding detection probe are:

SEQ ID NO.7：

5’TEXAS RED-ACCAACCATACAGAGTAGTAGTACTTTCT-eclipse-3’。

the probe labeling of pathogens according to the present invention is not limited to the listing of single labels of the same wavelength, and includes multiple detection reagents in different combinations of different labels.

In one embodiment, the kit further comprises an internal standard quality control and amplification primer and a detection probe; the internal standard quality control amplification primer sequence is as follows:

the amino acid sequences shown in SEQ ID NO.8: 5'-CCAGGTGGTCTCCTCTGACTTC-3' and,

SEQ ID NO.9:5’-GTGGTCGTTGAGGGCAATG-3’，

the sequence and label of the corresponding detection probe are:

SEQ ID NO.10：5’Cy5-AACAGCGACACCCACTCCTCCACCT-BHQ2-3’。

the internal standard can monitor sample collection and sample extraction process, and false negative caused by sample nucleic acid extraction failure is prevented.

In a preferred embodiment, the kit comprises an inactivated N gene, and a N501Y mutant pseudovirus positive control, and a sterilized saline negative control.

In a preferred embodiment, the PCR reaction tube (N/N501Y system) of the kit comprises a PCR reaction solution containing N gene and N501Y mutation sites, internal standard gene primers, probes, dNTPs and PCR buffer solution, wherein the concentration of the primers and the probes is 0.1-1 mu M, and MgCl is added₂The concentration is 2-5mM.

In a preferred embodiment, a novel mutant assay kit for the 2019-nCoV and 501Y.V2 coronavirus mutants provides a PCR enzyme system containing hot-start Taq enzyme and C-MMLV enzyme, wherein the concentration of dNTPs is 0.2-0.4mM, the concentration of C-MMLV enzyme is 1-3U, and the concentration of hot-start Taq enzyme is 2.5-5U.

The use method of the novel coronavirus 2019-nCoV and 501Y.V2 mutant strain detection kit provided by the invention comprises the following steps:

extracting a sample to be detected (the extraction reagent adopts a nucleic acid extraction or purification reagent (Yuejia mechanical equipment No. 20170583) produced by Guangzhou daan gene corporation to obtain a nucleic acid sample (positive quality control and negative quality control synchronously participate in extraction), adding 5 mu L of the sample into the PCR reaction solution (17 mu L) and the enzyme system mixture (3 mu L), carrying out amplification reaction in a real-time fluorescence PCR instrument, sequentially selecting FAM, Texas red and Cy5 as a fluorescence channel, and carrying out a PCR amplification program as follows;

50 ℃, 2min, 95 ℃, 5 min; 1 cycle

95 ℃, 5sec, 60 ℃, 35 sec; 10 cycles.

95 ℃, 5sec, 60 ℃, 35sec (fluorescence collection); 35 cycles.

After the PCR is finished, the negative and positive of the corresponding pathogen RNA are judged through different fluorescence channel curves and Ct values, and the detection result can be used for auxiliary diagnosis of wild type novel coronavirus infection or south Africa mutant strain infection and observation of the curative effect of the medicine, so that a reliable basis is provided for research.

The invention has the beneficial effects that:

(1) the kit and the detection method can be used for detecting and identifying the novel coronavirus and the 501Y.V2 mutant strain thereof.

(2) The detection kit disclosed by the invention has high sensitivity and strong specificity in detecting the novel coronavirus and the 501Y.V2 mutant strain thereof.

(3) Through multiple rounds of screening verification, the primer probe combination without cross reaction on wild strains is obtained from a large number of primer probe combinations, multiple detection can be performed, and the detection accuracy of the 501Y.V2 mutant strain is obviously improved.

The invention is suitable for detecting novel coronavirus, provides reliable basis for virus identification, typing, prevention and control, and is worthy of popularization and application. In addition, the method of the present invention is also suitable for non-diagnostic purposes, for example, in the process of epidemic prevention and control, the detection method of the present invention is used for detecting the virus nucleic acid in the environment, and the virus nucleic acid information can be used as the requirement of public health management.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1 kit and detection method

Conserved regions of the genome of the novel coronavirus are analyzed according to the sequence of the novel coronavirus, and specific primer and probe sequences for detecting the N gene of the novel coronavirus are designed in the conserved regions.

And designing a primer probe according to the mutation site in the novel coronavirus 501Y.V2 mutant strain gene.

In order to monitor the specimen collection, nucleic acid extraction process and PCR amplification process, an endogenous internal standard primer and a probe are also designed.

Finally, a set of primer and probe combination with optimal sensitivity and specificity is determined through multiple rounds of screening and optimization. The sequences are shown in Table 1:

TABLE 1 PCR reaction sequences

Sequence name	Sequence of	SEQ ID NO.
			nCoV-N-F1	GCAACTGAGGGAGCCTTGAATA	1
nCoV-N-R1	TGTAGCACGATTGCAGCATTG					2
			nCoV-N-P1	AAGATCACATTGGCACCCGCAATCC	3
N501Y-F1	ATCATATGGTTTCCAACCCAGTT	4
			N501Y-R1	AAACAGTTGCTGGTGCATGTAG	5
N501Y-S1	GGTTTCCAACCCACTAATGGTGTTGG	6
			N501Y-P1	ACCAACCATACAGAGTAGTAGTACTTTCT	7
Internal standard-F	CCAGGTGGTCTCCTCTGACTTC					8
			Internal standard-R	GTGGTCGTTGAGGGCAATG	9
Internal standard-P	AACAGCGACACCCACTCCTCCACCT					10

Wherein, the 5 'end fluorescence emission group of nCoV-N-P1 is FAM, and the 3' quenching group is BHQ 1; the 5 'end fluorescence emission group of N501Y-P1 is TEXAS RED, and the 3' quenching group is eclipse; the fluorescence emitting group at the 5 'end of the internal standard-P is CY5, and the quenching group at the 3' end of the internal standard-P is BHQ 2.

The concentration of the primers and the probes in the detection system is 0.2 mu M, and MgCl is adopted₂The concentration is 3mM, and the nucleic acid of the sample to be detected is 5 mu L. The PCR enzyme systems are hot start Taq enzyme and C-MMLV enzyme, wherein the C-MMLV enzyme is 2U, and the hot start Taq enzyme is 3U. The concentration of dNTPs in the system is 0.3 mM.

The use method of the kit comprises the following steps:

extracting a sample to be detected (the extraction reagent adopts a nucleic acid extraction or purification reagent (Yueju mechanical equipment No. 20170583) produced by Guangzhou Daan GenBank Limited company to obtain a nucleic acid sample (positive quality control and negative quality control synchronously participate in extraction), adding 5 mu L of the nucleic acid sample into the PCR reaction solution (primer probe mixed solution) and the enzyme system mixture, carrying out amplification reaction in a real-time fluorescent PCR instrument, sequentially selecting FAM, Texas red and Cy5 by a fluorescent channel, and carrying out a PCR amplification program as follows;

50 ℃, 2min, 95 ℃, 5 min; 1 cycle

95 ℃, 5sec, 60 ℃, 35 sec; 10 cycles.

95 ℃, 5sec, 60 ℃, 35sec (fluorescence collection); 35 cycles.

After the PCR is finished, the negative and positive of the corresponding pathogen RNA are judged through different fluorescence channel curves and Ct values, and the detection result can be used for auxiliary diagnosis of wild type novel coronavirus infection or mutant strain infection and observation of the curative effect of the medicine, so that a reliable basis is provided for research.

Example 2 Dual detection of N Gene and N501Y mutation site

Diluting the initial sample with the N gene pseudovirus and N501Y mutant site pseudovirus to 10 concentration⁶copies/ml, sequentially diluted to 10⁴、10³500, 200 and 100copies/ml, wherein 10 percent of final concentration is added into each concentration sample⁴And (3) taking the false virus containing the internal standard amplification fragment of copies/ml as a sample to be detected, and testing the sensitivity of the detection reagent.

FIG. 1 shows the results of the N-gene sensitivity detection (FAM channel) 10 from left to right⁴、10³、500、200copies/ml；

FIG. 2 shows the sensitive detection of the N501Y mutation site (Texas Red channel), 10 from left to right⁴、10³、500、200copies/ml；

Figure 3 shows the results of the internal standard channel test (Cy5 channel).

The detection result shows that the sensitivity of the kit aiming at each target can reach 200 copies/ml.

Example 3 specificity test

Adding different blocking probes to the detection system at 10⁵The wild pseudovirus of copies/ml is used as a sample to be detected to test the specificity of the detection reagent.

Because the gene sequences of the wild type and the mutant strain are close to each other, the closed probes capable of obviously distinguishing the wild type and the mutant strain are designed and screened, and the difficulty is high.

FIG. 4 shows the specific detection results of the blocking probe (N501Y-S1) at the N501Y mutation site, and the results show that the detection of the wild type is well specific when the N501Y-S1 blocking probe is added. While the control blocked probe is directed against wild-type nucleic acid, a non-specific amplification curve is observed.

The specificity of the double-detection kit for the N gene and the N501Y mutation site is tested by taking physiological saline, SARS pseudovirus, rhinovirus, adenovirus, influenza A virus, influenza B virus, parainfluenza virus, coronavirus OC43, respiratory syncytial virus, human coronavirus NL63 and human coronavirus HKU1 as specific reference substances.

FIG. 5 shows the result of the specificity test for the double detection of the N gene and the N501Y mutation site, which shows good specificity.

Figure 6 shows the internal standard channel test results indicating that the detection procedure is normal.

EXAMPLE 4 anti-interference substance testing

A large number of clinical tests show that the interference substances existing in clinical samples influence the detection result, so that the detection result fluctuates, the sensitivity is reduced, and even false negative conditions occur. For example, pharyngeal swab samples, which are commonly used in clinical tests, sometimes present blood contamination. The detection reagent is needed to be used for detecting the blood pollution sample and verifying the anti-interference capability of the blood pollution sample.

Because the gene sequence difference between the novel coronavirus and the mutant strain thereof is extremely small, the development of a detection reagent capable of accurately identifying the novel coronavirus mutant strain is difficult, and cross reaction to the wild novel coronavirus is easy to occur. And with the occurrence of false negative condition in clinical monitoring, detection reagents with stronger anti-interference performance are needed in clinic, so that the anti-interference capability of the detection reagents of the kit needs to be verified to obtain a detection reagent combination with stronger anti-interference capability.

To the N gene and the N501Y mutant site pseudovirus were added 5% of whole blood, 5% of mucus, ribavirin (1mg/mL), penicillin (0.5mg/mL), tetracycline (5mg/L), ofloxacin (3.06mg/L), and azithromycin (0.45mg/L) as interfering substance test samples, respectively, and the effect of the interfering substance on amplification of primer probes was tested with a sample containing no interfering substance as a control.

The test result shows that the sensitivity of the designed dozens of primer probe combinations to most primer probe combinations of samples added with whole blood or mucus is obviously reduced. The test results (500copies/ml) of the primer probe combination of the present invention are shown in FIGS. 7 and 8.

FIG. 7 shows the FAM channel detection results of the double detection of the interfering substance by the N gene and the N501Y mutation site, which indicates that the FAM channel can still be normally detected in the presence of the interfering substance.

FIG. 8 shows the detection results of Texas Red channel by N gene and N501Y mutant site double detection interfering substance test, which indicates that the normal detection can still be performed in the presence of the interfering substance.

Sensitivity tests after adding whole blood show that the sensitivity of the primer probe combination of the invention can still reach 200 copies/ml.

The detection sensitivity of the control primer pair N-F2 and N-R2 for detecting the wild type N gene in the conventional sample can reach 500copies/ml, and the detection result of the sensitivity of the control primer pair for detecting the wild type N gene in the whole blood-containing sample is shown in FIG. 11 (10 from left to right respectively)⁵、10⁴、10³copies/ml), the results show thatThe sensitivity of the control primer pair N-F2 and N-R2 to whole blood containing samples was significantly reduced.

The detection sensitivity of the control primer pair N-F3 and N-R3 for detecting the wild type N gene in the conventional sample can reach 200copies/ml, and the detection result of the sensitivity of the control primer pair for detecting the wild type N gene in the whole blood-containing sample is shown in FIG. 12 (10 from left to right respectively)⁵、10⁴、10³500copies/ml) showed that the sensitivity of the control primer pair N-F3 and N-R3 to whole blood containing samples was also significantly reduced.

The detection sensitivity of the control primer pairs N501Y-F2 and N501Y-R2 for detecting the mutation site of N501Y in a conventional sample can reach 200copies/ml, and the detection result of the sensitivity of the control primer pairs for a whole blood-containing sample is shown in FIG. 13 (10 from left to right respectively)⁵、10⁴、10³500copies/ml) showed a significant decrease in sensitivity of the control primer pair N501Y-F2 and N501Y-R2 to the whole blood-containing samples.

The detection sensitivity of the control primer pairs N501Y-F3 and N501Y-R3 for detecting the mutation site of N501Y in a conventional sample can reach 200copies/ml, and the detection results of the sensitivity of the control primer pairs for a whole blood-containing sample are shown in FIG. 14 (10 from left to right respectively)⁵、10⁴、10³500copies/ml) showed a significant decrease in sensitivity of the control primer pair N501Y-F3 and N501Y-R3 to the whole blood-containing samples.

The anti-interference capability of each control primer pair for blood-containing and mucus-containing samples is poor, and false negative detection results are easy to occur in the actual use process. Therefore, it is not suitable for clinical use.

Example 5 precision testing

Respectively diluting the N gene and the N501Y mutant site pseudovirus to 10⁴The copies/ml and 500copies/ml are used as precision reference substances, and are respectively repeated for 10 times, and the variation coefficient of the precision reference substances of each concentration is calculated.

FIG. 9 shows the results of the double detection precision test (FAM channel) for the N gene and the N501Y mutation site, and the results show that the kit of the invention has excellent precision.

FIG. 10 shows the results of the double detection precision test (Texas Red channel) for the N gene and the N501Y mutation site, and the results show that the kit of the present invention has excellent precision.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Guangzhou Daan Gene GmbH

<120> kit for detecting novel coronavirus and N501Y mutation site thereof and detection method

<130> 020091

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

gcaactgagg gagccttgaa ta 22

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tgtagcacga ttgcagcatt g 21

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

aagatcacat tggcacccgc aatcc 25

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

atcatatggt ttccaaccca gtt 23

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

aaacagttgc tggtgcatgt ag 22

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ggtttccaac ccactaatgg tgttgg 26

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

accaaccata cagagtagta gtactttct 29

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ccaggtggtc tcctctgact tc 22

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

gtggtcgttg agggcaatg 19

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

aacagcgaca cccactcctc cacct 25

Claims

1. A set of primer pairs for detecting a novel coronavirus and its N501Y mutation site, wherein the set of primer pairs comprises:

a first primer pair, the first primer pair comprising:

a forward primer shown as SEQ ID NO. 1; and, a reverse primer as shown in SEQ ID NO. 2;

a second primer pair, the second primer pair comprising:

2. The set of primer pairs of claim 1, further comprising:

a third primer pair, the third primer pair comprising:

3. A probe set for detecting novel coronavirus and N501Y mutation sites thereof comprises a first probe with a nucleotide sequence shown as SEQ ID NO.3, a second probe with a nucleotide sequence shown as SEQ ID NO.6 and a third probe with a nucleotide sequence shown as SEQ ID NO. 10; preferably, the probe set further comprises a blocking probe shown in SEQ ID NO. 7.

4. A kit for detecting a novel coronavirus and its N501Y mutation site, wherein the kit comprises the primer set of claim 1.

5. The kit of claim 4, further comprising the probe set of claim 3.

6. The kit of claim 4, further comprising one or more components selected from the group consisting of: hot start Taq abzyme, reverse transcriptase, dNTPs.

7. The kit according to claim 4, comprising a primer probe mixture comprising a primer pair set according to the first aspect of the invention and a probe set according to the second aspect of the invention.

8. A method for detecting a novel coronavirus and its N501Y mutation site, the method comprising the steps of:

(1) providing a nucleic acid sample of an object to be detected;

(2) preparing an RT-PCR reaction system and carrying out RT-PCR detection:

wherein, the RT-PCR reaction system comprises: the nucleic acid sample provided in step (1), the primer set of claim 1, and the probe set of claim 3.

9. The method of claim 6, wherein the nucleic acid sample is from a pharyngeal swab sample, an alveolar lavage sample, a blood sample, a sputum sample, a stool sample, or an environmental sample.

10. Use of the set of primer pairs of claim 1, and/or the set of probes of claim 3, for the preparation of a PCR assay kit for the detection of novel coronaviruses and their 501y.v2 mutants.