WO2022089550A1

WO2022089550A1 - Novel compositions and methods for coronavirus detection

Info

Publication number: WO2022089550A1
Application number: PCT/CN2021/127178
Authority: WO
Inventors: Shiyang PAN; Chunrong GU; Yuan MU; Jian Xu; Fang Wang; Ting Xu; Lei Zang; Yue Pan; Jianfeng TAO; Mengxiao XIE
Original assignee: Jiangsu Code Biomedical Technology Co., Ltd.
Priority date: 2020-10-28
Filing date: 2021-10-28
Publication date: 2022-05-05
Also published as: CN112063764A

Abstract

Provided herein are primers, probes and kits for the detection of the ORF1ab gene and the N gene of SARS-CoV-2 using multiple real-time fluorescent RT-PCR. Also provided herein are methods for detecting novel coronavirus nucleic acid and diagnosis of COVID-19.

Description

NOVEL COMPOSITIONS AND METHODS FOR CORONAVIRUS DETECTION

TECHNICAL FIELD

This disclosure relates to compositions and kits for detecting coronavirus (e.g., SARS-CoV-2) and uses thereof. Specifically, primers and probes for multiplex, real-time fluorescent RT-PCR and methods of detecting SARS-CoV-2 nucleic acid are provided.

BACKGROUND

Coronaviruses (CoVs) primarily cause enzootic infections in birds and mammals. In the last few decades, coronaviruses have shown to be capable of infecting humans as well. The outbreak of severe acute respiratory syndrome (SARS) in 2003, Middle-East respiratory syndrome (MERS) and, more recently, coronavirus disease 2019 (COVID-19) has demonstrated the lethality of CoVs when they cross the species barrier and infect humans. A renewed interest in coronaviral research has led to the discovery of several novel human CoVs and since then much progress has been made in understanding the CoV life cycle.

Cases of COVID-19 have now been identified in over 150 countries. Sustained community spread (human-to-human transmission) of SARS-CoV-2 has also been reported in the United States and globally.

Most patients with confirmed 2019-nCoV infection appear to develop fever and/or symptoms of acute respiratory illness (e.g., cough, difficulty breathing) . However, limited information is currently available to characterize the full spectrum of clinical illness associated with 2019-nCoV infection. Signs and symptoms may appear any time from 2 to 14 days after exposure to 2019-nCoV virus. Based on preliminary data, the median incubation period is approximately 4 days.

The WHO characterized COVID-19 as a pandemic on March 11, 2020. The WHO COVID-19 Dashboard (February 01, 2021) documented a global total of over 103 million confirmed cases, with 2.24 million of deaths. According to the Centers for Disease Control and Prevention (CDC) , as of February 01, 2021, there have been 26,034,475 cases in the United States (9,825,492 active cases and 16,632,840 recovered) with 439, 955 deaths. Laboratories in the United States therefore need diagnostic tools for use in the COVID-19 emergency for rapid diagnosis of acute COVID-19.

As a result, approaches that provide rapid and accurate tests for SARS-CoV-2 infection is needed in the art.

SUMMARY

The disclosure relates to primers, probes and kits for the detection of the ORF1ab gene and the N gene of SARS-CoV-2 using multiple real-time fluorescent RT-PCR. The disclosure also relates to methods for detecting coronavirus nucleic acid and diagnosis of COVID-19.

Accordingly, the current disclosure provides an oligonucleotide comprising a sequence that is at least 90%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NOs.: 1-9.

In some embodiments, the oligonucleotide binds to the ORF1ab of SARS-CoV-2, and the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 1 or 2.

In some embodiments, the oligonucleotide binds to the SARS-CoV-2 N gene, and the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: SEQ ID NO: 4 or 5.

In some embodiments, the oligonucleotide binds to the human β-Actin gene, and the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 7 or 8.

In some embodiments, the oligonucleotide described herein comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 3, 6, or 9, and the oligonucleotide has a 5’ terminus and 3’ terminus, and wherein the oligonucleotide is detectably labeled.

In some embodiments, the oligonucleotide is detectably labeled with FAM at the 5’ terminus and/or the oligonucleotide is detectably labeled with BHQ1 at the 3’ terminus.

In some embodiments, the oligonucleotide comprises a sequence consisting of SEQ ID NO: 3.

In some embodiments, the oligonucleotide is detectably labeled with Texas Red at the 5’ terminus and/or the oligonucleotide is detectably labeled with BHQ2 at the 3’ terminus.

In some embodiments, the oligonucleotide comprises a sequence consisting of SEQ ID NO: 6.

In some embodiments, the oligonucleotide is detectably labeled with JOE at the 5’ terminus and/or the oligonucleotide is detectably labeled with ECLIPSE at the 3’ terminus.

In some embodiments, wherein the oligonucleotide comprises a sequence consisting of SEQ ID NO: 9.

Also provided is a pharmaceutical composition comprising an effective amount of any one of the oligonucleotides provided herein, and a pharmaceutically acceptable carrier, diluent, or both.

Also provided is a method comprising contacting a biological sample with any one of the oligonucleotides described herein.

In some embodiments, the method further comprises detecting a SARS-CoV-2 gene in the biological sample.

In some embodiments, the method further comprises diagnosing a subject of having a SARS-CoV-2 infection.

Also provided is a method for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises: (A) incubating the biological sample with: (1) a reverse transcriptase and a DNA polymerase; and (2) a forward ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 1; (3) a reverse ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 2; and (4) a detectably labeled ORF1ab probe, wherein the ORF1ab probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of ORF1ab; wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse ORF1ab primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce an amplified ORF1ab fragment, if said SARS-CoV-2 is present in said clinical sample; (B) detecting the ORF1ab probe; thereby detecting the presence of SARS-CoV-2 in the biological sample.

In some embodiments, the ORF1ab probe is detectably labeled with FAM at the 5’ terminus and/or the oligonucleotide is detectably labeled with BHQ1 at the 3’ terminus.

In some embodiments, the ORF1ab probe comprises an oligonucleotide sequence of SEQ ID NO: 3.

In some embodiments, the ORF1ab probe hybridizes to the amplified ORF1ab fragments.

In some embodiments, the DNA polymerase has a 5’→3’ exonuclease activity that hydrolyzes the hybridized ORF1ab probe, to thereby separate the detectable labels on the ORF1ab probe and cause a signal to become detected.

In some embodiments, the hybridization of the ORF1ab probe to the amplified ORF1ab fragments separates the detectable labels on the ORF1ab probe and causes a signal to become detectable.

In some embodiments, the signal is a fluorescent signal.

In some embodiments, the ORF1ab probe oligonucleotide is labeled with a fluorophore and a quencher of fluorescence of the fluorophore.

In some embodiments, the DNA polymerase is a Taq DNA polymerase.

Also provided is a method for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises: (A) incubating the biological sample with: (1) a reverse transcriptase and a DNA polymerase; and (2) a forward SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 4; (3) a reverse SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 5; and (4) a detectably labeled SARS-CoV-2 N gene probe, wherein the SARS-CoV-2 N gene probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of SARS-CoV-2 N gene; wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse SARS-CoV-2 N gene primers to mediate a polymerase chain reaction amplification of a region of the SARS-CoV-2 N gene to thereby produce an amplified SARS-CoV-2 N gene fragment, if said SARS-CoV-2 is present in said clinical sample; (B) detecting the SARS-CoV-2 N gene probe; thereby detecting the presence of SARS-CoV-2 in the biological sample.

In some embodiments, the SARS-CoV-2 N gene probe is detectably labeled with Texas Red at the 5’ terminus and/or the oligonucleotide is detectably labeled with BHQ2 at the 3’ terminus.

In some embodiments, the ORF1ab probe comprises an oligonucleotide sequence of SEQ ID NO: 6.

In some embodiments, the SARS-CoV-2 N gene probe hybridizes to the amplified SARS-CoV-2 N gene fragments.

In some embodiments, the DNA polymerase has a 5′→3′ exonuclease activity that hydrolyzes the hybridized SARS-CoV-2 N gene probe, to thereby separate the detectable labels on the SARS-CoV-2 N gene probe and cause a signal to become detected

In some embodiments, the hybridization of the SARS-CoV-2 N gene probe to the amplified ORF1ab fragments separates the detectable labels on the SARS-CoV-2 N gene probe and causes a signal to become detectable.

In some embodiments, the signal is a fluorescent signal.

In some embodiments, the DNA polymerase is a Taq DNA polymerase.

In some embodiments, the methods described herein further comprises detecting human β-Actin in the biological sample.

In some embodiments, the detecting of human β-Actin comprises: (A) incubating the biological sample with: (1) a reverse transcriptase and a DNA polymerase; and (2) a forward human β-Actin primer having a nucleotide sequence consisting of SEQ ID NO: 7; (3) a reverse human β-Actin primer having a nucleotide sequence consisting of SEQ ID NO: 8; and (4) a detectably labeled human β-Actin probe, wherein the human β-Actin probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of human β-Actin; wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse human β-Actin primers to mediate a polymerase chain reaction amplification of a region of the human β-Actin to thereby produce an amplified human β-Actin fragment; (B) detecting the human β-Actin probe; thereby detecting the presence of human β-Actin in the biological sample.

In some embodiments, the human β-Actin probe is detectably labeled with JOE at the 5’ terminus and/or the oligonucleotide is detectably labeled with ECLIPSE at the 3’ terminus.

In some embodiments, the human β-Actin probe comprises an oligonucleotide sequence of SEQ ID NO: 9.

In some embodiments, the human β-Actin probe hybridizes to the amplified SARS-CoV-2 N gene fragments.

In some embodiments, the DNA polymerase has a 5′→3′ exonuclease activity that hydrolyzes the hybridized human β-Actin probe, to thereby separate the detectable labels on the human β-Actin probe and cause a signal to become detected.

In some embodiments, the hybridization of the human β-Actin probe to the amplified ORF1ab fragments separates the detectable labels on the human β-Actin probe and causes a signal to become detectable.

In some embodiments, the signal is a fluorescent signal.

In some embodiments, the human β-Actin probe oligonucleotide is labeled with a fluorophore and a quencher of fluorescence of the fluorophore.

In some embodiments, the DNA polymerase is a Taq DNA polymerase.

In some embodiments, the ratio of the final concentration of each primer to the probe in the reaction is 2: 1.

Also provided is a method of diagnosing a subject of having a SARS-CoV-2 infection, comprising detecting SARS-CoV-2 ORF1ab and/or SARS-CoV-2 N gene according to any of the methods described herein.

Also provided is a kit, comprising: (1) a first composition comprising one or more oligonucleotide, wherein the one or more oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NOs. 1-9; (2) a second composition comprising a RT-PCR buffer solution, a reverse transcriptase, and a DNA polymerase; and (3) instructions for performing the any of the methods described herein.

Also provided herein is a multiple real-time fluorescence PCR primer/probe set for detecting novel coronavirus that comprise multiple real-time fluorescence PCR primers and probes for detecting ORF1ab gene and N gene of SARS-CoV-2; wherein the forward primer for amplifying ORF1ab gene has a sequence of SEQ ID NO: 1, and the reverse primer has a sequence of SEQ ID NO: 2, and the probe sequence for detecting ORF1ab gene has a sequence of SEQ ID NO: 3; and wherein the forward primer for amplifying the N gene has a sequence of SEQ ID NO: 4, and the reverse primer has a sequence of SEQ ID NO: 5, and the probe sequence for detecting the N gene has a sequence of SEQ ID NO: 6.

In some embodiments, the multiple real-time fluorescent PCR primer/probe set for detecting novel coronavirus further comprises a multiple real-time fluorescent PCR primer/probe set for the detection of human beta-Actin gene.

In some embodiments, the forward primer for amplifying human β -Actin gene has a sequence of SEQ ID NO: 7, the reverse primer has a sequence of SEQ ID NO: 8, and the probe sequence for detecting the human beta-Actin gene has a sequence of SEQ ID NO: 9.

Also provided herein is a use of the multiplex real-time fluorescent PCR primer/probe set described herein for the preparation of novel coronavirus detection reagents.

Also provided herein is a novel coronavirus detection kit comprising the multiplex real-time fluorescent PCR primer/probe set described herein.

In some embodiments, the ratio between the final concentration of each primer to the final concentration of the probe is 2: 1.

In some embodiments, the kit further comprises an RT-PCR reaction solution, a positive quality control reference and a negative quality control reference.

In some embodiments, the RT-PCR reaction solution comprises RT-PCR buffer solution, reverse transcriptase and a hot start Taq DNA polymerase.

In some embodiments, the positive quality control reference is an in vitro transcribed RNA fragment containing a PCR-amplified target sequence, wherein the RNA of the ORF1ab has a sequence of SEQ ID NO: 10, and the RNA of the N gene has a sequence of SEQ ID NO: 11.

In some embodiments, the negative quality control reference is a buffer for the positive quality control reference that does not contain a PCR-amplified target sequence.

In some embodiments, the forward primer for amplifying the ORF1ab gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of GGCTGTAATAATGCTAACCA (SEQ ID NO: 12) ; the reverse primer for amplifying the ORF1ab gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of AAGTGCAACTTGATCCTC (SEQ ID NO: 13) ; and the probe for detecting the ORF1ab gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of AATAAAGTTTAGCCTTACCCCAT (SEQ ID NO: 14) . In some embodiments, the forward primer for amplifying the N gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of AGGTATACCCAATAATACTGC (SEQ ID NO: 15) ; the reverse primer for amplifying the N gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of GGTAGTAGCTAATTTGGTCA (SEQ ID NO: 16) ; and the probe for detecting the N gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of TCTACCTTGCCATGTTGAGTGA (SEQ ID NO: 17) .

In some embodiments, the forward primer for amplifying the human β-actin gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of GGACCTGACTGACTACCTCATGAA (SEQ ID NO: 18) ; the reverse primer for amplifying the human β-actin gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of CTTAATGTCACGCACGATTTCCCGC (SEQ ID NO: 19) ; and the probe for detecting the human β-actin gene includes an oligonucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, or 100%identical to the sequence of CACCGAGCGCGGCTACAGCTTC (SEQ ID NO: 20) .

In some embodiments, the 5’ terminus of the probe for detecting ORF1ab gene is detectably labeled with FAM, and 3’ terminus of the probe for detecting ORF1ab gene is detectably labeled with BHQ1. In some embodiments, the 5’ terminus of the probe for detecting the N gene is detectably labeled with Texas Red and the 3’ terminus of the probe for detecting the N gene is detectably labeled with BHQ2. In some embodiments, the 5’ terminus of the probe for detecting the human β-actin gene is detectably labeled with JOE and the 3’ terminus of the probe for detecting the human β-actin gene is detectably labeled with ECLIPSE.

In some embodiments, the ORF1ab target sequence is acgaugguggcuguaauaaugcuaaccaagucaucgucaacaaccuagacaaaucagcugguuuuccauuuaauaaaugg gguaaggcuaaacuuuauuaugauucaaugaguuaugaggaucaaguugcacuuuucgcaua (SEQ ID NO: 21) .

In some embodiments, the N gene target sequence is cggccccaagguauacccaauaauacugcgucuugguucaccgcucucacucaacauggcaagguagaccuuaaauuccc ucgaggacaaggcguuccaauuaacaccaauagcaguccagaugaccaaauuagcuacuaccgaagagcu (SEQ ID NO: 22) .

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein:

FIG. 1 is a set of graphs showing the PCR amplification curves using 2 primer/probe concentrations in an embodiment of the present disclosure.

FIG. 2 shows the comparison of dimer formation between primers and probes described herein.

DETAILED DESCRIPTION

The disclosure relates to compositions and methods for the detection of coronavirus (e.g., SARS-CoV-2) nucleic acid. Specifically, probes and primers, and kits for performing multiple real-time fluorescent RT-PCR are provided. The kit provided herein comprises multiplex real-time fluorescence RT-PCR primers and probes for detecting the ORF1ab gene and the N gene of SARS-CoV-2.

As used herein, the singular forms “a” , “an” , and “the” include plural reference unless the context clearly dictates otherwise.

The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

SARS-CoV-2

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is an enveloped, positive-strand RNA virus that causes the disease COVID-19 (Coronavirus Disease-2019) . While coronaviruses typically cause relatively mild respiratory diseases, as of February 2021 COVID-19 is on course to kill 2.5 million people since its emergence in late 2019. While recent progress in vaccine development has been remarkable, the emergence of novel coronaviruses in human populations represents a continuing threat. SARS-CoV-2 genome comprises the following open reading frames or ORFs, from its 5' end to its 3' end: ORF1ab corresponding to the non-structural proteins forming the transcription-replication complex, and ORF-S (the S gene) , ORF-E (the E gene) , ORF-M (the M gene) and ORF-N (the N gene) corresponding to the four major structural proteins, spike surface glycoprotein (S) , envelope protein (E) , membrane glycoprotein (M) and nucleocapsid protein (N) . It also comprises several accessory proteins like ORFs interspersed among or overlapping the structural genes and corresponding to proteins of unknown function.

SARS-CoV-2 RNA genome has a 5' methylated cap and a 3' polyadenylated tail, which allows the RNA to attach to the host cell's ribosome for translation. ORF1 b encodes a protein called RNA-dependent RNA polymerase (RdRp or nsp12) , which allows the viral genome to be transcribed into new RNA copies using the host cell's machinery. The RdRp is the first protein to be made; once the gene encoding the RdRp is translated, translation is stopped by a stop codon. RNA-dependent RNA polymerase (RdRp, RDR) is an enzyme that catalyzes the replication of RNA from an RNA template. This is in contrast to a typical DNA-dependent RNA polymerase, which catalyzes the transcription of RNA from a DNA template. RdRP is an essential protein encoded in the genomes of all RNA-containing viruses with no DNA stage. It catalyzes synthesis of the RNA strand complementary to a given RNA template. The RNA replication process is a two-step mechanism. First, the initiation step of RNA synthesis begins at or near the 3' end of the RNA template by means of a primer-independent (de novo) , or a primer-dependent mechanism that utilizes a viral protein genome-linked (VPg) primer. The de novo initiation consists in the addition of a nucleoside triphosphate (NTP) to the 3'-OH of the first initiating NTP. During the following so-called elongation phase, this nucleotidyl transfer reaction is repeated with subsequent NTPs to generate the complementary RNA product. The protein nsp9 which is encoded by ORF1a may participate in viral replication by acting as Single-stranded RNA-binding protein. The protein nsp6, also encoded by ORF1a, plays a role in the initial induction of autophagosomes from host reticulum and later limits expansion of these phagosomes that are no longer able to deliver viral components to lysosomes.

Several variants of SARS-CoV-2 carrying mutations on the Spike protein with a predicted impact on the epidemiology of the Covid-19 disease emerged since mid-2020 and are currently spreading worldwide. These variants of concern were first reported in the UK (lineage B. 1.1.7; notable mutations N501Y, 69-70del, P681 H) and VOC-202102/02 (B. 1.1.7 with E484K) ; South Africa (SA) (lineage B. 1.351 ; notable mutations N501Y, E484K, K417N) ; Brazil (BR) (lineage P. 1 ; notable mutations N501Y, E484K, K417T) ; UK and Nigeria (lineage B. 1.525; notable mutations E484K, F888L, 69-70del) and are currently spreading to multiple countries around the world.

All these new variants of SARS-CoV-2 are characterized by an enhanced human-to-human transmissibility in comparison to earlier variants of the virus. The UK, SA and BR variants all share the mutation N501Y in the receptor-binding region (RBD) , predicted to increase the spike’s binding affinity towards the human ACE2 receptor. Variants SA and BR share an additional mutation in this region (K417T/N) suspected to contribute to further binding affinity to hACE2. The UK variant carries another mutation outside the RBD (del69/70) with a predicted impact on transmissibility. Furthermore, the variants SA and BR share an additional mutation in the RBD (E484K) reported to enhance SARS-CoV-2 ability to escape the immune response (both natural and vaccine induced) . Monoclonal and serum-derived antibodies are reported to be from 10 to 60 time less effective in neutralizing virus bearing the E484K mutation. The distinct mutation L452R carried by the Californian variant was shown to enhance SARS-CoV-2 immune evasion ability in previous studies. Some vaccines might see their efficacies reduced against these variants.

Consequently, these emerging variants of SARS-CoV-2 are of concern due to their increased transmissibility (UK, BR, SA) . Furthermore, the reduced sensitivity to neutralizing antibodies of the variants carrying the mutation E484K (SA, BR) may compromise vaccine effectiveness.

As used herein a “variant” of a reference sequence of nucleotides according to the present invention (primer, probe) is a modified form in which at least one nucleotide is added, deleted, or substituted. In some embodiments the variant includes only addition of one or more nucleotides. In some embodiments the variant includes only deletion of one or more nucleotides. In some embodiments the variant includes only substitution of one or more nucleotides. In some embodiments the variant includes addition and deletion of different nucleotides. An addition is a change that increases the total number of nucleotides in the sequence while a deletion is a change that decreases the total number of nucleotides. In some embodiments the addition and/or deletion occurs at only one end while in other embodiments it occurs at both ends. In some embodiments an addition or deletion is internal. In some embodiments the variant includes only one nucleotide that is added, deleted, or substituted. In some

embodiments

2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides are added, deleted, or substituted. A variant according to the invention hybridizes to SARS-CoV-2 nucleic acid (RNA, DNA equivalent or complement thereof) . In this context, the term “hybridizes to” refers to the ability of the variant to form a double-stranded hybrid molecule with SARS-CoV-2 nucleic acid.

As used herein, SARS-Co-V2 refers to any isolate, strain, lineage or variant of SARS-CoV-2. As used herein, SARS-Co-V2 variant refers to an emerging SARS-CoV-2 variant of concern due to its increased transmissibility and/or enhanced ability to escape the immune response (natural and/or vaccine induced) . In particular, the SARS-CoV-2 variant carries mutations in the Spike protein predicted to increase the spike’s and/or virus particles binding affinity towards the human ACE2 receptor and/or reduce SARS-CoV-2 virus particles sensitivity to neutralizing antibodies. The neutralizing antibodies may be monoclonal antibodies or serum antibodies, in particular human serum antibodies. Examples of such mutations include in particular, E484K; K417T/N, N501Y, A570D, P681 H, T716I, S982A, D1118H, del69/70 and del144/145. Examples of mutations which increase the spike’s binding affinity towards the human ACE2 receptor include in particular, N501Y, K417T/N in the receptor binding domain (RBD) and 69-70del outside of the RBB. Examples of mutations which reduce SARS-CoV-2 virus sensitivity to neutralizing antibodies include in particular, E484K, present in the SA and BR variants. Preferred SARS-CoV-2 variants include the UK variant (lineage B. 1 . 1 . 7; notable mutations N501Y, 69-70del, P681 H; GISAID epi accession number B. 1 . 1 . 7 -EPI_ISL_1001329) ; South Africa (SA) variant (lineage B. 1.351 ; notable mutations N501Y, E484K, K417N; GISAID epi accession number B. 1 . 351 -EPIJSL_1001390) ; Brazil (BR) variant (lineage P. 1 ; notable mutations N501Y, E484K, K417T; GISAID epi accession number P. 1 -EPI_ISL_1001385) .

All the sequences are indicated in their 5’ to 3’ orientation.

Primers and Probes

Provided herein are oligonucleotides (e.g., primers and probes) used for the detection of SARS-CoV-2 nucleic acid (e.g., the ORF1ab and/or the N gene of SARS-CoV-2) . Further provided herein are primers and probes for the detection of human β-actin as an internal control (e.g., to examine the source of detected specimens, to determine whether the sample is from human patients, or to determine whether the sample is processed correctly) .

The disclosure also provides sets of probes and primers for detecting one or more SARS-CoV-2 genes and the human β-actin gene, e.g., using multiplex real-time fluorescent RT-PCR. In some embodiments, the forward primer for amplifying the ORF1ab gene includes an oligonucleotide sequence of SEQ ID NO: 1; the reverse primer for amplifying the ORF1ab gene includes an oligonucleotide sequence of SEQ ID NO: 2; and the probe for detecting the ORF1ab gene includes an oligonucleotide sequence of SEQ ID NO: 3. In some embodiments, the forward primer for amplifying the N gene includes an oligonucleotide sequence of SEQ ID NO: 4; the reverse primer for amplifying the N gene includes an oligonucleotide sequence of SEQ ID NO: 5; and the probe for detecting the N gene includes an oligonucleotide sequence of SEQ ID NO: 6.

In some embodiments, the forward primer for amplifying the human β-actin gene includes an oligonucleotide sequence of SEQ ID NO: 7; the reverse primer for amplifying the human β-actin gene includes an oligonucleotide sequence of SEQ ID NO: 8; and the probe for detecting the human β-actin gene includes an oligonucleotide sequence of SEQ ID NO: 9.

The oligonucleotide sequences of SEQ ID NOs: 1-9 are shown in Table 2. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 1. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 2. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 3. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 4. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 5. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 6. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 7. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 8. In some embodiments, the oligonucleotide described herein includes a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NO: 9.

In some embodiments, the primers and probes described herein are used in a multiplex real-time fluorescent RT-PCR for the detection of the corresponding genes. In some embodiments, the probes and primers for the detection of one or more genes, e.g., or more of ORF1ab, the N gene, and the human β-actin gene are used in combination for the detection of SARS-CoV-2.

In some embodiments, the oligonucleotides of the primers and probes described herein are modified (e.g., detectably labeled) . In some embodiments, the oligonucleotide of probe for the detection of the SARS-CoV-2 gene (s) or the human β-actin gene is modified (e.g., detectably labeled) . In some embodiments, the two ends of the probe (the 5’ end and the 3’ end) are respectively detectably labeled with a reporter fluorophore and a quenching fluorophore. The 5' modifications of the probes of the invention are selected from the reporter fluorophores commonly used in the art, such as FAM, Texas Red, JOE; and the 3’ modification of the probe of the invention is selected from quenching fluorescent groups commonly used in the field, such as BHQ1, BHQ2, ECLIPSE. And the reporter fluorophore and the quencher fluorophore on the probe for a gene are different from the probe for another gene. Any other suitable oligonucleotide modifications can be used in the probes described herein. Any other suitable fluorophore and quencher fluorophore can be used to modify the probes described herein.

In some embodiments, the target ORF1ab sequence for the primers and probes described herein has an oligonucleotide of SEQ ID NO: 10. In some embodiments, the target N gene sequence for the primers and probes described herein has an oligonucleotide of SEQ ID NO: 11. The oligonucleotide sequences of the ORF1ab and the N gene are shown in Table 3.

Also provided herein are pharmaceutical compositions including an effective amount of the oligonucleotide described herein, and a pharmaceutically acceptable carrier, diluent, or both.

Methods of Detection

Provided herein are methods including contacting a biological sample with the oligonucleotide described herein. In some embodiments, the methods further include detecting a SARS-CoV-2 gene (e.g., the ORF1ab and the N gene) in the biological sample. In some embodiments, the methods further include diagnosing a subject of having a SARS-CoV-2 infection.

Further provided herein are methods for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises:

(A) incubating the biological sample with: (1) a reverse transcriptase and a DNA polymerase; and (2) a forward ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 1; (3) a reverse ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 2; and (4) a detectably labeled ORF1ab probe, wherein the ORF1ab probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of ORF1ab; wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse ORF1ab primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce an amplified ORF1ab fragment, if said SARS-CoV-2 is present in said clinical sample; (B) detecting the ORF1ab probe; thereby detecting the presence of SARS-CoV-2 in the biological sample.

Further provided herein are methods for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises: (A) incubating the biological sample with: (1) a reverse transcriptase and a DNA polymerase; and (2) a forward SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 4; (3) a reverse SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 5; and (4) a detectably labeled SARS-CoV-2 N gene probe, wherein the SARS-CoV-2 N gene probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of SARS-CoV-2 N gene; wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse SARS-CoV-2 N gene primers to mediate a polymerase chain reaction amplification of a region of the SARS-CoV-2 N gene to thereby produce an amplified SARS-CoV-2 N gene fragment, if said SARS-CoV-2 is present in said clinical sample; (B) detecting the SARS-CoV-2 N gene probe; thereby detecting the presence of SARS-CoV-2 in the biological sample.

Any suitable probes described herein can be used for detecting SARS-CoV-2 in the biological sample.

In some embodiments, the biological sample is obtained from an environmental sample, such as air, soil, food, beverages, feed, water (e.g., fresh water, salt water, waste water, and drinking water) , sewage, sludge, and surfaces or samples obtained from surface swipes. In some embodiments, the biological sample is obtained from a human subject, for example, stool, tissue sample, and body fluid from a human subject. Body fluid includes mucosal secretions, such as with no limitations oral and respiratory tract secretions (sputa, saliva and the like) blood, plasma, serum, urine, and cerebrospinal fluid. Samples include swabs such as oral or nasopharyngeal (NP) swabs, aspirate, wash or lavage. Samples for diagnostic tests for SARS-CoV-2 can be taken from the upper (nasopharyngeal/oropharyngeal swabs, nasal aspirate, nasal wash or saliva) or lower respiratory tract (sputum or tracheal aspirate or bronchoalveolar lavage (BAL) . In some particular embodiments, the biological sample is a clinical sample from human individual suspected of having SARS-CoV-2, preferably a body fluid sample, more preferably oral or respiratory tract secretions.

The biological sample can be subjected to well-known isolation and purification protocols or used directly. For example, the sample can be subjected to a treatment to release/extract the nucleic acids of the sample and/or to remove proteins and other non-nucleic acid components of the sample using conventional techniques.

In some embodiments, the probes used in the methods (e.g., the ORF1ab probe, the N gene probe, or the human β-actin probe) hybridizes to the amplified fragments of the corresponding targets.

In some embodiments, the DNA polymerase used in the methods has a 5’→3’ exonuclease activity that hydrolyzes the hybridized probes (e.g., the ORF1ab probe, the N gene probe, or the human β-actin probe) to thereby separate the detectable labels on the probes and cause a signal to become detected. In some embodiments, the DNA polymerase is a Taq DNA polymerase. In some embodiments, the DNA polymerase is a hot start Taq DNA polymerase.

In some embodiments, the signal is a fluorescent signal. In some embodiments, the hybridization of the probes to the amplified fragments of the target genes separates the detectable labels on the ORF1ab probe and causes a signal to become detectable. In some embodiments, the signal is a fluorescent signal. Other suitable methods of detectably label a probe and detecting the signals are known in the art.

In some embodiments, the ratio of the final concentration of each primer to the final concentration of the probe used in the reaction is about 5: 1, 4: 1, 3: 1, 2: 1, 1: 1, 1: 2, 1: 3, 1: 4, or about 1: 5. In some embodiments, the ratio of the final concentration of each primer to the final concentration of the probe used in the reaction is about 2: 1.

In some embodiments, one or more internal reference marker (e.g., quality control sample) is used in the methods described herein. In some embodiments, human β-Actin is used as a reference marker. In some embodiments, human β-Actin is used as an internal control.

Therefore, in some embodiments, the method described herein further includes detecting human β-Actin in the biological sample (e.g., to examine the source of detected specimens, to determine whether the sample is from human patients, or to determine whether the sample is processed correctly) .

In some embodiments, the nucleic acid of SARS-CoV-2 (e.g., the ORF1ab and/or the N gene) is detected at an RNA concentration of about 25 copies/mL, about 50 copies/mL, about 100 copies/mL, about 200 copies/mL, about 250 copies/mL, about 300 copies/mL, about 400 copies/mL, about 500 copies/mL, about 600 copies/mL, about 700 copies/mL, about 800 copies/mL, about 900 copies/mL, about 1000 copies/mL, about 1500 copies/mL, about 2000 copies/mL, about 2500 copies/mL or higher. In some embodiments, the nucleic acid of SARS-CoV-2 is detected at an RNA concentration of about 100 copies/mL (e.g., with a sensitivity of at least 95%) . In addition, because of the optimization of the probes, the limit of detection of the methods described herein can reach about 2-3 copies/mL.

In some embodiments, the nucleic acid of human β-actin is detected at an RNA concentration of about 25 copies/mL, about 50 copies/mL, about 100 copies/mL, about 200 copies/mL, about 250 copies/mL, 300 copies/mL, about 400 copies/mL, about 500 copies/mL, about 600 copies/mL, about 700 copies/mL, about 800 copies/mL, about 900 copies/mL, about 1000 copies/mL, about 1500 copies/mL, about 2000 copies/mL, about 2500 copies/mL or higher.

Other suitable positive or negative reference markers can also be used in the method described herein. For example, virus preservation solutions can be used as a negative reference for the detection of SARS-CoV-2 nucleic acid.

Methods of Diagnosis

Also provided herein are methods of diagnosing a subject of having a SARS-CoV-2 infection, the methods including detecting SARS-CoV-2 ORF1ab and/or SARS-CoV-2 N gene according to any one of the methods described herein. One of the advantages of the methods provides herein is the high sensitivity of detecting SARS-CoV-2 nucleic acid, e.g., the ability of detecting SARS-CoV-2 nucleic acid with low Ct level.

In some embodiments, the subject is a human subject. In some embodiments, the subject is a human subject having a SARS-CoV-2 infection. In some embodiments, the subject is a human subject suspected of having a SARS-CoV-2 infection. In some embodiments, the subject is a human subject who has been exposed to SARS-CoV-2.

In some embodiments, the subject is diagnosed of having a SARS-CoV-2 infection if one or more SARS-CoV-2 gene is detected using any of the methods described herein. In some embodiments, the subject is diagnosed of having a SARS-CoV-2 infection if the ORF1ab gene is detected using any of the methods described herein. In some embodiments, the subject is diagnosed of having a SARS-CoV-2 infection if the N gene is detected using any of the methods described herein. In some embodiments, the subject is diagnosed of having a SARS-CoV-2 infection is one or more SARS-CoV-2 gene is detected using any of the methods described herein, and if the human β-actin is detected using any of the methods described herein.

Any suitable standard can be used for the diagnosis of the SARS-CoV-2 based on the multiplex fluorescent RT-PCR results. In a real time PCR (RT-PCR) assay a positive reaction is detected by accumulation of a fluorescent signal. The Ct (cycle threshold) is defined as the number of cycles required for the fluorescent signal to cross the threshold (i.e., exceeds background level) . Ct levels are inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct level the greater the amount of target nucleic acid in the sample) .

In some embodiments, the sample is determined to be positive of SARS-CoV-2 nucleic acid if the Ct (cycle threshold) is <50, <45, <40, <35, or <30. In some embodiments, the sample is determined to be positive of SARS-CoV-2 nucleic acid if Ct<40.

Any other suitable methods of diagnosing SARS-CoV-2 can be used in combination with the methods described herein. For example, antibody tests using known techniques such as ELISA, lung imaging using X-ray, or computed tomography scan (CT) , and/or contact tracing can be used in combination with the diagnosis methods described herein.

Kits

Also provided herein are coronavirus (e.g., SARS-CoV-2) nucleic acid detection kits including the primers and probes for multiple real-time fluorescent RT-PCR described herein.

Accordingly, provided herein are kits including: (1) a first composition including one or more oligonucleotide, wherein the one or more oligonucleotide includes a sequence that is at least 90%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NOs.: 1-9; (2) a second composition including an RT-PCR buffer solution, a reverse transcriptase, and a DNA polymerase; and (3) instructions for performing any of the methods described herein.

Any suitable RT-PCR buffer solution can be used in the kits described herein.

In some embodiments, the kit further includes a positive quality control product and/or a negative quality control product. In some embodiments, the kit includes dNTPs and other necessary components for performing an RT-PCR reaction. The necessary components are known in the art.

EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLE 1: Primers, Probes and Kits for the Detection of SAR-CoV-2 Nucleic Acid

The PCR primer and the probe sets targeting the ORF1ab and the N gene of SARS-CoV-2 were designed based on a template target sequence that is not from one specific viral strain, e.g., NCBI Reference Sequence: NC_045512.2. The target sequence was based on sequences of multiple viral strains that were publicly reported earlier than June 25, 2020. Specifically, all sequences with complete sequence and a quality evaluation as “High” in the bioinformatics center-2019 novel coronavirus information database (https: //bigd. big. ac. cn/ncov/release_genome) were downloaded and saved as local files. After removing sequences except ORF1ab and N gene, the files were submitted to European molecular biology laboratories-European bioinformatics institute (EMBL-EBI) , and a Clustal Omega (https: //www. ebi. ac. uk/Tools/msa/clustalo/) multiple sequence alignment tool was used to obtain the consistent sequences and the consistent rates of the bases in the sequences, and the consistent sequences were used as design templates of primers and probes. Thus, all suitable viral strains in the database were included, which extends the detection to nucleic acid mutations in different viral sequences.

Multiple primers and probes were designed for the ORF1ab and the N gene. 3 pairs of primers and 3 probes for ORF1ab and the N gene of SARS-CoV-2, a set of primers and probes for human β-actin were selected according to the general principle of PCR primer design principles. Different sets of real-time fluorescent RT-PCR primers and probes are created using different combinations of these primers and probes. Each set includes a pair of primers and a probe for the ORF1ab gene, a pair of primers and a probe for the N gene, and a pair of primers and a probe for the human β-actin gene (see Table 1 for examples of primer and probe sets) . Dimerization formation was analyzed for all 9 sets of primers and probes and the best two sets were selected for further experiments.

TABLE 1. Example Combinations of PCR Primers and Probes

A preferred set of primers and probe for each of ORF1ab, the N gene, and human β-actin were further selected, the sequences of the primers and probes are shown in Table 2, and each of the sets is highly specific for the detection of their target gene.

TABLE 2 Primer and Probe Sequences for the Detection of SARS-CoV-2 ORF1ab and the N Gene and the Human β-Actin Gene

The positive quality control material is an in vitro transcribed RNA fragment containing a PCR amplification target sequence (the sequence is shown in Table 3) . Therefore, it ensures that the chemical properties of the quality control product and the tested object of the sample are consistent, and the clinical sample is simulated to the maximum extent to monitor the RT-PCR reaction. Furthermore, this eliminates the risk of infection caused by using inactivated virus or pseudovirus.

TABLE 3 In Vitro Transcribed RNA Sequences in Positive Quality Controls

The negative quality control material is a solvent matrix of the positive quality control material, and does not contain a PCR amplifiable target substance.

The kit used in the follow experiments include a component A and a component B, wherein the component A is the primer and probe set, and the component B includes concentrated RT-PCR buffer solution, reverse transcriptase and hot start Taq DNA polymerase. The preparation of reaction solution is completed only by mixing components A and B upon use, and after an RNA sample is added, one-step multiplex fluorescence RT-PCR is carried out, so that ORF1ab and N gene of SARS-CoV-2 virus and human source sampling quality control gene beta-Actin can be detected simultaneously. The method is simple, convenient and quick.

The disclosed primer and probe sets, kits and methods are suitable for variable real-time fluorescent quantitative PCR instruments, such as ABI 7500 series, Roche 480 series, Bio-Rad CFX96, and Hongshite SLAN series.

The advantages of the primer and probe sets, kits and methods described herein include that the invention discloses a multiple real-time fluorescent RT-PCR primer probe composition and a kit for detecting novel coronavirus nucleic acid, wherein the primer probe in the kit is designed based on a virus information base, so that the omission caused by virus nucleic acid variation is avoided to the greatest extent; the kit of the optimized primer probe composition has high specificity on SARS-CoV-2 detection, the lowest limit of detection is 100 copies/mL, and the Ct value variation coefficient is <5%; the tested object of the positive quality control product is RNA in nature and participates in the RT-PCR whole-process reaction, so that the accuracy and effectiveness of the detection result are ensured. Through clinical verification in China and America, the kit of the current invention has >95%consistency in detection results compared to the commercially available kit made by BGI Genomics Co. Ltd. (BGI Kit) and the

6800 System (Roche) is >95%. This demonstrates that the kits described herein can meet the need for detection of clinical samples from all over the world.

In the following experiments, the Lasergene primer selection software (DNASTAR, inc. ver. 7.1.0) was used to analyze the formation of primer-to-probe dimer on 9 sets of candidate primers and probes, and preferably 2 sets of primers and probes were selected, and the worst Δ G value (free energy) formed by pairing of more than 3 consecutive bases in the dimer was compared and shown in FIG. 2.

The two sets of primer probe combinations were respectively assembled into corresponding Kit 1 and Kit 5, and then the detection performances were compared. Specifically, the novel coronavirus ribonucleic acid genome standard substance (China institute of metrology science; accession number: GBW (E) 091099; Lot number: 2020-02; ORF1ab: 6.89x10 ² copies/μL; N gene: 1.36X 10 ³ copies/μL) was diluted in pharyngeal swab virus preservation solution (Haishi Gene Technology, Cat #: XB06013, Batch number: 200518001) , obtaining simulated virus samples with ORF1ab of 2500 copies/mL, 250 copies/mL and 25 copies/mL and N gene of 2500 copies/mL, 250 copies/mL and 25 copies/mL respectively. And (3) according to the requirements of the clinical sample RNA extraction kit instructions, simultaneously carrying out RNA extraction on the simulated virus sample, the virus preservation solution, the positive quality control substance and the negative quality control substance.

The RT-PCR reaction system was prepared by respectively adopting Kit 1 and Kit 5, the final concentration of each primer and the final concentration of each probe in the 2 reaction systems were respectively 200nmol/L and 100nmol/L, and the volumes of the used reagents are shown in Table 4.

TABLE 4. Reaction Systems for Two RT-PCR Kits

The reaction system was loaded into PCR reaction tubes in a volume of 20μL per tube, 10μL of the extracted RNA sample was added into the corresponding reaction tubes, the tubes were covered, the reaction tubes were instantly put on a machine by instant centrifugation, the RT-PCR reaction was carried out according to the set parameters in Table 5, and the detection channels were FAM, JOE and Texas Red.

TABLE 5. RT-PCR Reaction Parameters

The data analysis was performed according to the instructions of the instrument used and the results were shown in Table 6.

TABLE 6. Detection of SARS-CoV-2 Nucleic Acid

Therefore, on the premise that the quality control product result was correct, Kit 1 was superior to Kit 5 in both positive detection rate and Ct value. The primers and probes contained in Kit 1 were shown in Table 2. The primers for ORF1ab contained in Kit 1 were the forward primer having a nucleotide sequence of SEQ ID NO: 1, and the reverse primer having a nucleotide sequence of SEQ ID NO: 2, and the probes for ORF1ab contained in Kit 1 has a nucleotide sequence of SEQ ID NO: 3 and modification as shown in Table 2. The primers for the N gene contained in Kit 1 were the forward primer having a nucleotide sequence of SEQ ID NO: 4, and the reverse primer having a nucleotide sequence of SEQ ID NO: 5, and the probes for the N gene contained in Kit 1 has a nucleotide sequence of SEQ ID NO: 6 and modification as shown in Table 2. The primers for human β-Actin contained in Kit 1 were the forward primer having a nucleotide sequence of SEQ ID NO: 7, and the reverse primer having a nucleotide sequence of SEQ ID NO: 8, and the probes for β-Actin contained in Kit 1 has a nucleotide sequence of SEQ ID NO: 9 and modification as shown in Table 2.

Further, the detection performance of 2 concentrations of the primers and probes in Kit 1 was compared to further optimize the concentration of the primers and probes of the present invention.

Specifically, preparation of a simulated virus sample and RNA extraction sample were carried out as described above, and RT-PCR reaction systems were prepared using 2 primer probe concentrations, respectively, using the reagent volumes shown in Table 7.

TABLE 7. Preparation of RT-PCR Reaction Systems with Different Concentrations of Primers and Probes

20 μL of each reaction system was added into PCR reaction tubes, 10 μL of the extracted RNA sample was added to each reaction tube, and RT-PCR was performed as described above, and the results are shown in Table 8.

TABLE 8. Detection of SARS-CoV-2 Nucleic Acid Using 2 Different Concentrations of Primers and Probes

Therefore, on the premise that the quality control product result was correct, Concentration 2 of the primer and probe set was superior to Concentration 1 of the primer and probe set in both positive detection rate and Ct value, and the PCR amplification reaction curve is shown in FIG. 1.

Further, the minimum limit of detection of the kit of the present invention was evaluated.

Specifically, simulated virus samples were prepared as described above such that the concentrations of the ORF1ab and the N gene were 200 copies/mL, 100 copies/mL, 50copies/mL, and 25 copies/mL, respectively. As described above, RNA in the sample was extracted and the RT-PCR reaction was performed on the sample, and the results are shown in Table 9.

TABLE 9. Limit of Detection of the Kit

*Note: Positive results were determined as Ct <40 for any of the ORF1ab or the N gene.

Therefore, the minimum limit of detection of the kit is 100 copies/mL, the Ct value variation coefficient of positive results was less than 5%.

Furthermore, Sequence BLAST was used to analyze common pathogens of the respiratory tract to evaluate the detection specificity of the kit of the present invention. Specifically, the primer and probe sequences of Kit 1 and the clinically common pathogen were subjected to BLAST alignment analysis (NCBI BLAST Tool) , and the results are shown in Table 10.

TABLE 10. BLAST Alignment Results of Primers and Probes with Common Respiratory Pathogens

As shown in Table 11, BLAST analysis showed that none of the above common respiratory pathogens could be amplified by the primers and probes of the present invention, indicating the specificity of the primers and probes described herein.

Further, the nucleic acid positive samples of the common clinical microorganisms (from the microbiology laboratory of the National Institute of Medical Examination of Jiangsu Province, China) were tested by using the kit of the present invention to evaluate their cross-reactivity, and the test results are shown in Table 11.

TABLE 11. Detection of Nucleic Acid of Common Clinical Microorganisms

* ND: None Detected

Therefore, the bioinformatic BLAST analysis and the detection of nucleic acid positive samples of common microorganisms both show that the kit has high specificity and no cross reaction to common clinical microorganisms.

In the following example, a total of 90 clinical specimens (from the First Hospital Affiliated to Guangdong Medical University, China) were subjected to parallel assay comparison (the assay was performed in the First Hospital Affiliated to Guangdong Medical University, China) using Kit 1 of the present invention and a novel coronavirus 2019-nCoV nucleic acid detection kit (NMPA: 20203400060, Cat#RM0349, lot#: 6020200217, minimum limit of detection: 100 copies/mL) produced by BGI Genomics Co. Ltd., and the results are shown in Table 12.

TABLE 12. Parallel Detection Comparison of the Kit of the Present Invention and a Commercially Available Kit

Note: *, Positive was determined by Ct < 40 for any of the PRF1ab or the N gene using the kit from the current disclosure;

#, Positive was determined by Ct ≤ 38 using the BGI Kit

## ND: None detected

It can be seen that the clinical sample detection results of the kit of the present invention and the BGI Kit are 100%identical (95%confidence interval: 96.7%-100%) , the Ct value of ORF1ab gene is not statistically different from that of the BGI Kit (paired t test, bilateral α ═ 0.05, N ═ 14, t ═ 1.676, and P ═ 0.118) , and the Ct value of N gene is significantly smaller than that of the BGI Kit (paired t test, unilateral α ═ 0.05, N ═ 15, t ═4.997, and P < 0.001) .

In the next example,

6800 automatic nucleic acid analyzer and the corresponding SARS-CoV-2Test reagents were used and compared with the kit from the current invention. A total of 90 clinical specimens (from Wisconsin Medical School of Milwaukee, Wisconsin, USA) were tested in parallel (testing was done at Wisconsin Medical School, Milwaukee, Wisconsin, USA) , and the results are shown in Table 13.

TABLE 13. Comparison of the Kit Described Herein and the

6800 Automatic Detection System

Thus, the kit of the present invention and the

6800 system have consistent results for the detection and the consistency is 96.7% (95%confidence interval: 90.6%-99.3%) .

EXAMPLE 2: Clinical Use of the SARS-CoV-2 Detection Kit

Product Overview/Test Principle:

The kit described herein is a real-time reverse transcription polymerase chain reaction (RT-PCR) test for the qualitative detection of the ORF1ab and N genes of SARS-CoV-2 RNA extracted from upper respiratory specimens (such as nasopharyngeal, mid-turbinate, nasal and oropharyngeal swab specimens) using the QIAamp Viral RNA Mini Kit (QIAGEN) from individuals suspected of COVID-19 by their healthcare provider. Primers and probes for the ORF1ab and N genes of SARS-CoV-2 included in the kit described herein are listed in Table 2. The kit includes primer/probe sets, the fluorophore FAM is for ORF1ab gene probe and Texas Red is for N gene probe. The kit also includes a primer/probe set to detect human β-actin as an internal control (IC) intended to examine the source of detected specimen. The IC probe is labeled with JOE fluorescent dye which uses an independent fluorescence detection channel from SARS-CoV-2 targets. All targets are amplified in the same reaction and are distinguished/detected by their respective fluorescence label.

In addition, the kit utilizes external Positive (PC) and Negative (NC) controls. The PC contains synthetic RNA templates of SARS-CoV-2 ORF1ab and N targets, the NC is nuclease-free water of molecular grade.

1) Description of Test Steps:

Extraction (Manual)

The QIAamp Viral RNA Mini Kit (QIAGEN, catalog #52904 or 52906) with manual extraction has been validated with the kit described herein for RNA extraction. The extraction kit requires 280μL sample input and yields 60μL of purified nucleic acid eluent. A negative control needs to be included into the extraction. Extracted RNA is to be kept on ice or frozen at -70C.

PCR reagent preparation:

1) In the reagent preparation area, take out the kit described herein from the freezer and open the package. Thaw PCR Reaction Mix A, PCR Reaction Mix B, Negative Control, and Positive Control at room temperature prior to use. Place on ice or cold block once thawed. Keep cold during preparation and use.

2) Gently invert PCR Reaction Mix A and PCR Reaction Mix B 8 to 10 times to mix, then quick spin to collect reagents at the bottom of the tube. Place the tube on ice or cold block.

3) Determine the number of reactions (N) to set up per assay. It is necessary to make excess reaction mix for the Positive Control (PC) , Negative Control (NC) and for pipetting error. Use the following guide to determine N (n refers to the number of patient samples) : N = n + PC + NC + 1

4) Calculate the amount of PCR amplification mix. (Table 14)

Table 14. The Amount of PCR Amplification Mix

5) Combine the calculated amounts for PCR Reaction Mix A and B into one appropriate microcentrifuge tube to make the master mix (amplification mix) . After adding the reagents, mix by pipetting up and down. DO NOT vortex.

6) Perform a quick spin to collect reagents at the bottom of the tube.

7) Dispense 20uL of reaction tube (master mix) per (N) wells of a 96 well plate.

Nucleic Acid Template and Controls Addition

1) Extracted nucleic acid samples need to be kept on ice (or on a cold rack) once extracted or thawed.

2) Pipette 10 μL of either the positive control, the negative control or the extracted sample into each PCR reaction well containing master mix (Total volume =30 μL) . Change tips between each sample and each control.

3) Proceed to PCR amplification.

Software Settings

● See Table 15 for RT-PCR Conditions Settings on the Applied Biosystems 7500 systems and Table 16 for setting on the Roche Cobas z 480.

TABLE 15. RT-PCR Settings Applied Biosystems 7500 Real-Time PCR Instrument System with Software V1.4.1 Or Above and Applied Biosystems 7500 Fast Real-Time PCR Instrument System With Software V1.4.1 Or Above

Start Applied Biosystems Real Time PCR System 7500: Turn on the computer connected to the system first, then turn on Applied Biosystems Real Time PCR System 7500.

Load the instrument: Push the tray door to open it, load the prepared plate containing samples and controls into the plate holder in the instrument. Ensure that the plate is properly aligned in the holder. Close the tray door.

Set up the experiment run:

Double-click the icon to run the software or select Start>>All Programs>>Applied Biosystems>>7500 Software.

Click New Experiment to enter Experiment menu. In the Experiment Properties screen, enter identifying information for the experiment; You can leave the other fields empty.

Select 7500 (96 Wells) ; Quantitation-Standard Curve (for the experiment type) ; TaqMan Reagents (for reagent) ; and Standard (for ramp speed) .

Click Plate Setup; Under the tab Define Targets and Samples, set Target 1 to FAM, target 2 to TEXAS RED and target 3 to JOE; Select None for Quencher; Assign three different colors to each of the targets.

Click Assign Targets and Sample tab; enter the name of samples and controls to include in the reaction plate in corresponding well and select the sample/target reactions to set up. Select None for passive reference.

Click Run Method. On the Run Method screen, select either the Graphical View tab (default) or the Tabular View to edit the run method. Make sure the thermal profile displays the holding and cycling stages shown below. Enter 30 μL in the Reaction Volume Per Well field.

The FAM and TEXAS RED channel (Reporter: FAM, Quencher: None; Reporter: TEXAS RED, Quencher: None) will be set up for detection of SARS-CoV-2 RNA ORF1ab and N genes and the JOE channel (Reporter: JOE, Quencher: None) will be set up for the detection of the internal reference (β-actin) ; Reference Dye: None.

Click Run. In the Run screen, save the experiment. Click START.

After the run completes, unload the instrument, and proceed to data analysis.

Analysis

Click Analysis. →Amplification Plot, under Plot Settings tab →select sequentially ΔRn vs Cycle (default) →Log →Target. Set the baseline start at cycle 3 and end at cycle 15.

Under options tab, select target (Reporter) to be adjusted > Adjust the Threshold value manually.

Ct values will be calculated after adjusting threshold. To review a Ct value of a sample, click the well; then from the Target drop-down, select the target for review.

TABLE 16. RT-PCR Settings Roche Cobas z 480 Software Version 1.5.0 or Above

To run the software: Double click LightCycler480 software icon on the desktop; Enter username and password to log into the software interface.

Click New Experiment

On the drop-down menu next to Detection Format, select the Multi Color Hydrolysis Probe. Always click the Customize next to the drop-down to make sure the selected format matches the test required setting: FAM, TEXAS RED and JOE should be listed under the Filter Combination.

Designate individual program under Program Name and set temperature and time parameters for each program in the Program Temperature Targets panel below, referring to the steps, number of cycles, temperature, and duration. Use (+) and (–) buttons to add or delete steps in the interface.

● Click Save As Template to save the program. The template can be used for future experiments by clicking Apply Template.

● After editing subset and defining all sample names for this experiment, select Start Run to run the test.

● After running, click Analysis on the left panel to open the analysis interface.

● To adjust Noise Band and Threshold of different channels, select Filter Comb:

- To adjust the Noise Band parameter, click Noise Band tab. The optimal position of the Noise Band should be as low as possible, without any background noise, and as high as necessary, where it clearly crosses all sample.

- To adjust the Threshold parameter, set Threshold to Threshold (Auto) .

- Click Calculate in the bottom left of the screen to apply the change. The results will be analyzed.

- On the upper left corner of the interface, select a well, and the corresponding Ct value will show after dragging the bar to the right.

- To export results, right-click and select Export Table.

-

2) Interpretation of Results

All test controls should be examined prior to interpretation of patient results. If PC and NTC controls are not valid, the patient results cannot be interpreted.

All human clinical specimens should exhibit β-actin growth curves that cross the threshold line with the Ct value < 36. However:

If the β-actin assay does not produce a positive result for human clinical specimens, interpret as follows:

1. If either the ORF1ab or the N is positive, even in the absence of a positive β-actin, the result should be considered valid. It is possible that some samples may fail to exhibit β-actin growth curves due to low cell numbers in the original clinical sample or due to competitive inhibition when high levels of SARS-CoV2 are present in the sample. A negative β-actin signal does not preclude the presence of 2019-nCoV virus RNA in a clinical specimen.

2. If the ORF1ab, N and β-actin are all negative for the specimen, the result should be considered invalid. If residual specimen is available, repeat the extraction procedure and repeat the test. If all markers remain negative after re-test, report the results as invalid and a new specimen should be collected if possible.

The Interpretation for Control results are presented in Table 17 and the interpretation of test results for patient samples is shown in Table 18.

TABLE 17. Interpretation of Positive and Negative Controls

TABLE 18. Interpretation of Result for Patient Samples

Product Details

1) Components Included with the Test

Components manufactured by Jiangsu Code Biomedical Technology Co., Ltd. and supplied with the test are included in Table 19.

TABLE 19. Kit Contents (Materials Provided)

2) Components Required but Not Included with the Test

● Instruments

○ Applied Biosystems 7500 Real-Time PCR Instrument System with software V1.4.1 or above

○ Applied Biosystems 7500 Fast Real-Time PCR Instrument System with software V1.4.1 or above

○ Roche Cobas z 480 Software version 1.5.0 or above

● RNA extraction or purification reagents. It is recommended to use the QIAamp Viral RNA Mini Kit (QIAGEN, catalog #52904 or 52906) .

● 96 well PCR plate

● 8 strip PCR tubes

● Sealing Film or 8-12 well PCR optic cap

● Vortex and microcentrifuge

● Pipette and tips with filter (10 μL, 200 μL and 1000 μL)

● 1.5 mL DNase/RNase free microcentrifuge tubes and racks

● Disposable powder-free gloves and laboratory gowns

● Cold blocks or ice

3) Testing Capabilities

● Sample throughput capacity: 94 reactions per 3-4 hours.

● Number of tests that can be performed per instrument run and per day: 96/run and 96×4/day=384 tests/day

Analysis

Observe the Ct values of target FAM, target Texas Red, and JOE of samples and determine the result of samples referring to instructions for use of the kit described herein for detecting SARS-CoV-2.

1) Control Material (s) to be Used with kit described herein:

Controls provided with the test kit include:

1. Negative Control (NC)

The Negative Control (NC) consists of nuclease-free water and is included in the extraction process (280 μL from the provided NC vial) as a full process control.

The NC reactions for the primer and probe sets of ORF1ab and N should NOT: 1) Exhibit fluorescence growth curves that cross the threshold line. 2) Exhibit fluorescence growth with Ct＜40. If either of these two situations occurs, the interpretation is a control failure, where sample contamination may have occurred. Report as in valid and repeat the assay following the instructions for use.

2. Positive Control (PC)

The PC consists of synthetic RNA containing sequences of ORF1ab and N genes of SARS-CoV-2 at a concentration of 500 copies/mL (5x the LoD) . The PC will yield a positive result with expected Ct value of <36. It is a full process control, taken through the entire sample processing procedure, including the extraction.

3. Internal Control

Human β-actin primer and probe set are included in Reaction Mix A as an internal control for evaluation of adequate sampling. The β-actin probe is labeled with JOE fluorescent dye which uses an independent fluorescence detection channel for SARS-CoV-2 targets.

3) Performance Evaluation

1) Limit of Detection (LoD) -Analytical Sensitivity:

Limit of detection studies were performed on both the Roche Cobas z480 and the ABI 7500 PCR detection systems.

The Limit of Detection (LoD) studies determined the lowest detectable SARS-CoV-2 viral RNA concentration that yield greater than or equal to 95%of all (true positive) replicates testing positive with the kit described herein. All sample replicates were prepared by spiking the standard SARS-CoV-2 viral genomic RNA*obtained from the National Institute of Metrology of China (NCRM; #GBW (E) 09109, lot #: 2020-02) into negative clinical nasopharyngeal (NP) swab specimen matrix. The clinical nasopharyngeal (NP) swabs were provided by Jiangsu Province Hospital, the First Affiliated Hospital with Nanjing Medical University and were testing by the Real-Time Fluorescent RT-PCR Kit for Detecting SARS-2019-nCoV” (NMPA: 20203400060, Cat#RM0349, lot#: 6020200217) from BGI Genomics Co. Ltd.

Samples for the LoD studies were processed using the QIAamp Viral RNA Mini Kit (QIAGEN, catalog #52906) and run on the ABI 7500. The QIAamp Viral RNA Mini Kit (QIAGEN, catalog #52906) has been validated with the kit described herein. The extraction kit requires 280μL sample input and yields 60μL of purified nucleic acid eluent.

Step 1: Tentative LoD Determination Study

In the first part of this study, the tentative LoD was conducted at 3 different concentrations levels with 5 replicate measurements at each concentration of 2500, 250 and 25 copies/mL, respectively.

Step 2: LoD Confirmation Study

The final claimed LoD was confirmed using 20 replicates for each of claimed compatible PCR instrument. Refer to Table 20.

TABLE 20. Limit of Detection Data Summary

Conclusion:

The lowest concentration level with observed positive rates ≥ 95%was 100 Copies/mL for both PCR instruments; therefore, the claimed LoD for the kit described herein run with both the Applied Biosystems 7500 Real Time PCR System (software v2.0.6) or the Roche Cobas z480 PCR detection system (software v1.5.0) is 100 Copies/mL.

2) Inclusivity (analytical sensitivity) :

The primers and probes for the kit described herein were designed based on SARS-CoV-2 sequences published on GenBank (https: //www. ncbi. nlm. nih. gov/genbank/sars-cov-2-seqs/) and 2019nCoVR (https: //bigd. big. ac. cn/ncov/lang=en) until March 21, 2020. It was shown these primers and probes are specific to NCBI Reference Sequence NC_045512.2 by Nucleotide BLAST. Inclusivity was re-analyzed on October 9, 2020 using the BLAST+software Version 2.10.1, for searching the SARS-CoV-2 taxid: 2697049. The database included 35, 635 sequences and showed that 39 variants with mismatches in the 5’-end of forward primers, 39 variants with mismatches in 5’-end of reverse primers, and 46 variants with mismatches in the middle of the probes. All these variants are single nucleotide polymorphisms. After excluding ambiguous nucleotides (N) , a total number of 47 SNPs were identified as shown in the table below. Notably, none of the mismatches are located within 4 sites of the 3’-end, and all the mismatches are presented only once in one sequence which impact Tm less than Δ2℃. Thus, the PCR amplification component of the assay is tolerant to all identifiable variants in publicly available sequence data, which means that none of these variants are predicted to impact the assay performance. The results of the in-silico analysis are presented in Table 21.

TABLE 21. Inclusivity Analysis (In-silico)

Additional analysis:

The United Kingdom variant, VUI-202012/01, is a recently identified SARS-CoV-2 identified in several countries. The test described herein has been analyzed against this variant. Of concern is the potential interference of the test’s performance due to the spike (S) gene of the virus. However, the test described herein targets the ORF1ab and N gene of SARS-CoV-2. Moreover, the in-silico study did not show adverse impact that might be affected by the variant. The primers and probes of the test described herein showed 100%specific, against to the “VUI-202012/01” variant by using Nucleotide BLAST. (GenBank: MW450666.1, Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/ITA/APU-POLBA01/2020, complete genome) . In conclusion, the recently found variant does not impact to the performance of the test described herein.

The Brazil Variant, B. 1.1.248, is also a newly identified lineage of the SARS-CoV-2. It has 10 mutations in its spike protein, including N501Y and E484K. This does not affect the performance of the test described herein, which targets the ORF1ab and N gene of SARS-CoV-2. Moreover, the in-silico study did not show adverse impact caused by the variant. The primers and probes of the test described herein showed 100%specific against to the “B. 1.1.248” variant by using local

(GISAID: EPI_ISL_792680, EPI_ISL_792681, EPI_ISL_792682, EPI_ISL_792683) . In conclusion, the recently found variant B. 1.1.248 does not impact the performance of the test described herein.

The South Africa Variant, 501Y. V2, was first detected in South Africa. It can attach easily to human cells due to its three mutations in the receptor-binding domain (RBD) of the spike glycoprotein of the virus. This variant does not affect the test described herein targeting the ORF1ab and N gene of SARS-CoV-2. In addition, the in-silico study did not show adverse impact. The primers and probes of the test described herein showed 100%specific against to the “501Y. V2, GH/501Y. V2 (B. 1.351) ” variant by using local BLAST (Total 724 viruses searched from GISAID on Feb 1st, 2021) . In conclusion, the South Africa variant does not impact the performance of the test described herein.

3) Cross-reactivity (Analytical Specificity) :

Evaluation of analytical specificity of the kit was conducted using both, in silico analysis and through wet testing, against pathogenic organisms mainly found in the human respiratory tract (Table 23) .

a. In-silico Analysis:

BLASTn analysis queries of the primers and probes of the kit described herein (1 ORF1ab primer/probe set and 1 N primer/probe set) were performed against public domain nucleotide sequences with the following database search parameters:

● Mask low complexity regions = Yes

● Expectation value = 10

● Match/Mismatch = Match 2 Mismatch -3

● Gap Costs = Existence 5 Extension 2

● Max number of hit sequence = 250

● Mask lower case = No

● Mask low complexity regions = Yes

● Number of threads = 16

● Filter out redundant results = No.

Table 22. In-silico Cross-Reactivity Analysis

b. Cross Reactivity: Wet Testing

The kit described herein was used to test contrived nasopharyngeal (NP) swab preparations of microorganisms which are similar to SARS-CoV-2 species which can cause similar symptoms with SARS-CoV-2, including Epstein-Barr virus (EBV) , human cytomegalovirus (CMV) , Haemophilus influenzae, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Klebsiella pneumoniae, Aspergillus fumigatus, Candida albicans, Candida glabrata and Cryptococcus neoformans. Testing was performed according to the IFU of the kit described herein on the Applied Biosystems 7500 Real-Time PCR Instrument. The testing was performed in triplicate. The results are presented in Tables 23 and 24 below.

TABLE 23. Wet Testing Results of Quality Controls

TABLE 24. Wet Testing Results of Samples

4) Clinical Evaluation:

● Date: September 24 and October 9, 2020

● Location: Medical College of Wisconsin

● Sample Size: 90

The clinical performance of the kit described herein was established by testing 90 previously collected residual nasopharyngeal samples from patients undergoing routine clinical testing for SARS-CoV-2 and identified as SARS-CoV-2 positive or negative with the FDA authorized Cobas SARS-CoV-2 assay on the Roche 6800 system. Testing with the Cobas SARS-CoV-2 was conducted according to the manufacturer’s instruction, including extraction, for use with viral transport media. Selected samples were deidentified, randomized, assigned a number and enrolled for comparison testing. Study samples were tested in a blinded fashion with the kit described herein according to the instructions for use on the Applied Biosystems 7500 PCR system with the Qiagen Qia-AMP viral mini-kit extraction kit. The study included four low positive samples. Low positives were defined as samples in which the comparator’s (Cobas SARS-CoV-2) Ct value was 33 or greater, based on being within 3 Ct values of the mean of Ct at the LoD of the test (～36) . Based on these criteria, the study included 4 low positives, 1 of which resulted in a false negative. The results are presented below in Table 25.

TABLE 25. Clinical Agreement of the Kit Described Herein with Cobas SARS-CoV-2

Note: The Cobas SARS-CoV-2 reference Ct values of the false negative result were 34.5 and 36.2, respectively for

targets

1 and 2.

Positive percent agreement: 97.8%, 95%CI (88.4-99.6)

Negative percent agreement: 95.6%, 95%CI (85.2-98.8)

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

An oligonucleotide comprising a sequence that is at least 90%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NOs. 1-9.
The oligonucleotide of claim 1, wherein the oligonucleotide binds to the ORF1ab of SARS-CoV-2, and wherein the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 1 or 2.
The oligonucleotide of claim 1, wherein the oligonucleotide binds to the SARS-CoV-2 N gene, and wherein the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 4 or 5.
The oligonucleotide of claim 1, wherein the oligonucleotide binds to the human β-Actin gene, and wherein the oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 7 or 8.
The oligonucleotide of claim 1, comprising a sequence that is at least 90%identical to the full length of an oligonucleotide sequence of SEQ ID NO: 3, 6, or 9, wherein the oligonucleotide has a 5’ terminus and 3’ terminus, and wherein the oligonucleotide is detectably labeled.
The oligonucleotide of claim 5, wherein the oligonucleotide is detectably labeled with FAM at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with BHQ1 at the 3’ terminus.
The oligonucleotide of claim 6, wherein the oligonucleotide comprises a sequence consisting of SEQ ID NO: 3.
The oligonucleotide of claim 5, wherein the oligonucleotide is detectably labeled with Texas Red at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with BHQ2 at the 3’ terminus.
The oligonucleotide of claim 8, wherein the oligonucleotide comprises a sequence consisting of SEQ ID NO: 6.
The oligonucleotide of claim 5, wherein the oligonucleotide is detectably labeled with JOE at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with ECLIPSE at the 3’ terminus.
The oligonucleotide of claim 10, wherein the oligonucleotide comprises a sequence consisting of SEQ ID NO: 9.
A pharmaceutical composition comprising an effective amount of the oligonucleotide of any one claims 1-8, and a pharmaceutically acceptable carrier, diluent, or both.
A method comprising contacting a biological sample with the oligonucleotide of any one of claims 1-8.
The method of claim 13, further comprising detecting a SARS-CoV-2 gene in the biological sample.
The method of claim 13 or 14, further comprising diagnosing a subject of having a SARS-CoV-2 infection.
A method for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises:

(A) incubating the biological sample with:

(1) a reverse transcriptase and a DNA polymerase; and

(2) a forward ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 1;

(3) a reverse ORF1ab primer having a nucleotide sequence consisting of SEQ ID NO: 2; and

(4) a detectably labeled ORF1ab probe, wherein the ORF1ab probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of ORF1ab;

wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse ORF1ab primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce an amplified ORF1ab fragment, if said SARS-CoV-2 is present in said clinical sample;

(B) detecting the ORF1ab probe;

thereby detecting the presence of SARS-CoV-2 in the biological sample.
The method of claim 16, wherein the ORF1ab probe is detectably labeled with FAM at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with BHQ1 at the 3’ terminus.
The method of claim 17, wherein the ORF1ab probe comprises an oligonucleotide sequence of SEQ ID NO: 3.
The method of any one of claims 16-18, wherein the ORF1ab probe hybridizes to the amplified ORF1ab fragments.
The method of claim 19, wherein the DNA polymerase has a 5’ →3’ exonuclease activity that hydrolyzes the hybridized ORF1ab probe, to thereby separate the detectable labels on the ORF1ab probe and cause a signal to become detected.
The method of claim 19, wherein the hybridization of the ORF1ab probe to the amplified ORF1ab fragments separates the detectable labels on the ORF1ab probe and causes a signal to become detectable.
The method of claim 20 or 21, wherein the signal is a fluorescent signal.
The method claim 22, wherein the ORF1ab probe oligonucleotide is labeled with a fluorophore and a quencher of fluorescence of the fluorophore.
The method of any one of claims 16-22, wherein the DNA polymerase is a Taq DNA polymerase.
A method for detecting the presence of SARS-CoV-2 in a biological sample, wherein said method comprises:

(A) incubating the biological sample with:

(1) a reverse transcriptase and a DNA polymerase; and

(2) a forward SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 4;

(3) a reverse SARS-CoV-2 N gene primer having a nucleotide sequence consisting of SEQ ID NO: 5; and

(4) a detectably labeled SARS-CoV-2 N gene probe, wherein the SARS-CoV-2 N gene probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of SARS-CoV-2 N gene;

wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse SARS-CoV-2 N gene primers to mediate a polymerase chain reaction amplification of a region of the SARS-CoV-2 N gene to thereby produce an amplified SARS-CoV-2 N gene fragment, if said SARS-CoV-2 is present in said clinical sample;

(B) detecting the SARS-CoV-2 N gene probe;

thereby detecting the presence of SARS-CoV-2 in the biological sample.
The method of claim 24, wherein the SARS-CoV-2 N gene probe is detectably labeled with Texas Red at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with BHQ2 at the 3’ terminus.
The method of claim 25, wherein the ORF1ab probe comprises an oligonucleotide sequence of SEQ ID NO: 6.
The method of any one of claims 24-26, wherein the SARS-CoV-2 N gene probe hybridizes to the amplified SARS-CoV-2 N gene fragments.
The method of claim 27, wherein the DNA polymerase has a 5′→3′ exonuclease activity that hydrolyzes the hybridized SARS-CoV-2 N gene probe, to thereby separate the detectable labels on the SARS-CoV-2 N gene probe and cause a signal to become detected
The method of claim 27, wherein the hybridization of the SARS-CoV-2 N gene probe to the amplified ORF1ab fragments separates the detectable labels on the SARS-CoV-2 N gene probe and causes a signal to become detectable.
The method of claim 28 or 29, wherein the signal is a fluorescent signal.
The method claim 30, wherein the ORF1ab probe oligonucleotide is labeled with a fluorophore and a quencher of fluorescence of the fluorophore.
The method of any one of claims 24-31, wherein the DNA polymerase is a Taq DNA polymerase.
The method of any one of claims 16-32, further comprising detecting human β-Actin in the biological sample.
The method of claim 33, wherein the detecting of human β-Actin comprises:

(A) incubating the biological sample with:

(1) a reverse transcriptase and a DNA polymerase; and

(2) a forward human β-Actin primer having a nucleotide sequence consisting of SEQ ID NO: 7;

(3) a reverse human β-Actin primer having a nucleotide sequence consisting of SEQ ID NO: 8; and

(4) a detectably labeled human β-Actin probe, wherein the human β-Actin probe comprises an oligonucleotide sequence that is able to specifically hybridize to an oligonucleotide sequence of human β-Actin;

wherein the incubation is in a reaction under conditions sufficient to permit the forward and reverse human β-Actin primers to mediate a polymerase chain reaction amplification of a region of the human β-Actin to thereby produce an amplified human β-Actin fragment;

(B) detecting the human β-Actin probe;

thereby detecting the presence of human β-Actin in the biological sample.
The method of claim 34, wherein the human β-Actin probe is detectably labeled with JOE at the 5’ terminus and/or wherein the oligonucleotide is detectably labeled with ECLIPSE at the 3’ terminus.
The method of claim 34 or 35, wherein the human β-Actin probe comprises an oligonucleotide sequence of SEQ ID NO: 9.
The method of any one of claims 34-36, wherein the human β-Actin probe hybridizes to the amplified SARS-CoV-2 N gene fragments.
The method of claim 37, wherein the DNA polymerase has a 5′→3′ exonuclease activity that hydrolyzes the hybridized human β-Actin probe, to thereby separate the detectable labels on the human β-Actin probe and cause a signal to become detected
The method of claim 37, wherein the hybridization of the human β-Actin probe to the amplified ORF1ab fragments separates the detectable labels on the human β-Actin probe and causes a signal to become detectable.
The method of claim 38 or 39, wherein the signal is a fluorescent signal.
The method claim 40, wherein the human β-Actin probe oligonucleotide is labeled with a fluorophore and a quencher of fluorescence of the fluorophore.
The method of any one of claims 34-41, wherein the DNA polymerase is a Taq DNA polymerase.
The method of any one of claims 16-42, wherein the ratio of the final concentration of each primer to the probe in the reaction is 2: 1.
A method of diagnosing a subject of having a SARS-CoV-2 infection, comprising detecting SARS-CoV-2 ORF1ab and/or SARS-CoV-2 N gene according to any one of claims 16-43.
A kit, comprising:

(1) a first composition comprising one or more oligonucleotide, wherein the one or more oligonucleotide comprises a sequence that is at least 90%identical to the full length of an oligonucleotide sequence selected from any one of SEQ ID NOs. 1-9;

(2) a second composition comprising a RT-PCR buffer solution, a reverse transcriptase, and a DNA polymerase; and

(3) instructions for performing the method of any one of claims 16-44.