CN113481325B

CN113481325B - Method and kit for detecting novel coronavirus B.1.1.7 mutant strain

Info

Publication number: CN113481325B
Application number: CN202110763533.5A
Authority: CN
Inventors: 蒋析文; 范建; 廖芷卉; 王霞
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2021-07-06
Filing date: 2021-07-06
Publication date: 2024-08-16
Anticipated expiration: 2041-07-06
Also published as: CN113481325A

Abstract

The invention provides a method and a kit for detecting a novel coronavirus B.1.1.7 mutant strain, and particularly, the method and the kit are verified by multiple rounds of screening, and a primer probe set which has high sensitivity, strong specificity, good repeatability, no cross reaction to a wild type novel coronavirus and can perform multiple detection is obtained from a large number of primer probe sets, and can be used for detecting and identifying the novel coronavirus B.1.1.7 mutant strain.

Description

Method and kit for detecting novel coronavirus B.1.1.7 mutant strain

Technical Field

The invention belongs to the field of biotechnology and molecular diagnosis, and particularly relates to a novel real-time fluorescent RT-PCR multiple detection system for a mutant strain of coronavirus B.1.1.7.

Background

The novel coronavirus is a single-stranded positive strand RNA virus belonging to the genus Sarbecovirus of the genus beta coronavirus of the family coronaviridae. The novel coronavirus is a single-stranded RNA virus, and is prone to mutation. The mutation of the virus is closely related to the infection capacity and reproductive capacity of the recombination on the virus, the detection of the virus and the effectiveness of antibodies, so the monitoring of the mutation and the recombination of the virus is a vital part of researching the virus.

Common signs of a person infected with coronavirus are respiratory symptoms, fever, cough, shortness of breath, dyspnea, and the like. In more severe cases, the infection can lead to pneumonia, severe acute respiratory syndrome, renal failure, and even death. The virus has confirmed that there is a human-derived phenomenon, the virus has a latency period of1 day at the shortest and a latency period of 14 days at the longest, and the latency period is infectious, so that the disease has no specific treatment method.

After the novel coronavirus B.1.1.7 mutant strain appears, genetic evolution analysis shows that the novel strain has 23 special mutations, the transmission capacity of the novel strain is 70% higher than that of the original strain, and the binding affinity of S protein and human ACE2 receptor is improved by 1000 times. It is not clear how the accumulation of these mutations has long-term impact on new pandemics, but these mutations may affect the natural immunity and effectiveness of the immunity from vaccination.

Based on the above, it is important to establish a fluorescent quantitative PCR method with high sensitivity and good specificity for detecting pneumonia caused by infection of a novel coronavirus B.1.1.7 mutant.

Disclosure of Invention

The invention develops a detection method and a kit aiming at a novel coronavirus B.1.1.7 mutant strain so as to detect an infected patient with high efficiency, high specificity and low cost.

In a first aspect of the invention, there is provided a primer pair set for detecting a novel coronavirus b.1.1.7 mutant, the primer pair set comprising:

a first primer pair, the first primer pair comprising:

a forward primer as shown in SEQ ID NO. 1; and, a reverse primer as shown in SEQ ID NO. 2.

In another preferred embodiment, the primer pair set further comprises:

a second primer pair, the second primer pair comprising:

A forward primer as shown in SEQ ID NO. 4; and, a reverse primer as shown in SEQ ID NO. 5.

In another preferred embodiment, the primer pair set further comprises:

a third primer pair, the third primer pair comprising:

a forward primer as shown in SEQ ID NO. 7; and, a reverse primer as shown in SEQ ID NO. 8.

In another preferred embodiment, the primer pair set further comprises:

an internal pair of primers, the internal pair of primers comprising:

A forward primer as shown in SEQ ID NO. 10; and, a reverse primer as shown in SEQ ID NO. 11.

In a second aspect of the present invention, there is provided a probe set for detecting a novel coronavirus B.1.1.7 mutant, the probe set comprising a first probe having a nucleotide sequence as shown in SEQ ID NO. 3.

In another preferred embodiment, the probe set further comprises a second probe having a nucleotide sequence shown in SEQ ID NO. 6.

In another preferred embodiment, the probe set further comprises a third probe having a nucleotide sequence shown in SEQ ID NO. 9.

In another preferred embodiment, the probe set further comprises an internal standard probe having a nucleotide sequence shown in SEQ ID NO. 12.

In another preferred embodiment, the 5' end of each probe comprises a fluorescent reporter group; and/or, the 3' end of each probe comprises a fluorescence quenching group.

In another preferred embodiment, the fluorescent reporter groups labeled with each probe are different from each other.

In a third aspect of the invention there is provided a kit for detecting a novel coronavirus B.1.1.7 mutant, said kit comprising a primer pair set according to the first aspect of the invention.

In another preferred embodiment, the kit further comprises a probe set according to the second aspect of the invention.

In another preferred embodiment, the kit further comprises one or more components selected from the group consisting of: hot start Taq abzymes, taq enzymes, reverse transcriptases, UDG enzymes, dNTPs.

In another preferred embodiment, the kit further comprises a negative quality control.

In another preferred embodiment, the kit further comprises a positive quality control.

In another preferred example, the kit is used in a RT-PCR reaction system with 10pmol primer concentration as shown in SEQ ID NO. 1 and SEQ ID NO. 2 and 4pmol probe concentration as shown in SEQ ID NO. 3.

In another preferred embodiment, the kit is used in a RT-PCR reaction system with 15pmol of the primers shown as SEQ ID NO. 4 and SEQ ID NO. 5 and 8pmol of the probe shown as SEQ ID NO. 6.

In another preferred example, the kit is used in a RT-PCR reaction system with a primer concentration of 12pmol as shown in SEQ ID NO. 7 and SEQ ID NO. 8 and a probe concentration of 6pmol as shown in SEQ ID NO. 9.

In another preferred embodiment, the kit is used in which the primer concentrations shown as SEQ ID NO.10 and SEQ ID NO. 11 and the probe concentration shown as SEQ ID NO. 12 are set to 4pmol in an RT-PCR reaction system.

In a fourth aspect of the invention, there is provided a method of detecting a novel coronavirus b.1.1.7 mutant, the method comprising the steps of:

(1) Providing a nucleic acid sample of an object to be detected;

(2) Preparing an RT-PCR reaction system and carrying out RT-PCR detection:

Wherein, the RT-PCR reaction system comprises: the nucleic acid sample provided in step (1), the primer set according to the first aspect of the present invention, and the probe set according to the second aspect of the present invention.

In another preferred embodiment, the nucleic acid sample may be from a pharyngeal swab sample, an alveolar lavage sample, a blood sample, a sputum sample, a stool sample, or an environmental sample.

In another preferred embodiment, the method is a detection method for non-diagnostic purposes.

In another preferred embodiment, the PCR reaction system further comprises a positive quality control, and/or a negative quality control.

In another preferred embodiment, the PCR reaction system further comprises a PCR reaction enzyme system.

In another preferred embodiment, in step (2), the primer concentrations shown in SEQ ID NO. 1 and SEQ ID NO. 2 and the probe concentration shown in SEQ ID NO. 3 are 10pmol and 4pmol respectively in the RT-PCR reaction system.

In another preferred embodiment, in step (2), the primer concentrations shown as SEQ ID NO. 4 and SEQ ID NO. 5 and the probe concentration shown as SEQ ID NO. 6 are set to 15pmol in the RT-PCR reaction system.

In another preferred embodiment, in step (2), the primer concentrations shown as SEQ ID NO. 7 and SEQ ID NO. 8 and the probe concentration shown as SEQ ID NO. 9 are 12pmol and 6pmol respectively in the RT-PCR reaction system.

In another preferred embodiment, in step (2), the primer concentrations shown as SEQ ID NO. 10 and SEQ ID NO. 11 and the probe concentration shown as SEQ ID NO. 12 are set to 4pmol in the RT-PCR reaction system.

In a fifth aspect of the invention there is provided the use of a primer set according to the first aspect of the invention and/or a probe set according to the second aspect of the invention for the preparation of a PCR detection kit for the detection of novel coronavirus B.1.1.7 mutants.

In another preferred embodiment, the PCR is RT-PCR.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIGS. 1,2, 3, 4 show the effect of different concentrations of primers and probes on fluorescent PCR reactions;

FIG. 5 shows the sensitivity test results;

FIG. 6 shows the results of the specific assay;

FIG. 7 shows the results of repeatability tests;

FIGS. 8, 9 and 10 show the detection results for wild-type strains of clinical samples;

FIG. 11 shows cross-reactions of a portion of a primer probe combination to a wild-type strain;

fig. 12 and 13 show the detection results of a part of primer probe combinations in a single-and multiple-system, respectively.

Detailed Description

Through extensive and intensive studies, the present inventors have found that real-time fluorescent RT-PCR is one of the common methods for coronavirus nucleic acid detection, and has been widely used in the fields of medicine and molecular biology. The novel coronavirus diagnostic reagent is mainly developed and designed aiming at the novel coronavirus ORF1ab gene and the novel N gene on the market. The invention selects novel coronavirus British mutant strain N gene mutation (28280 GAT- > CTA, D3L), ORF1ab gene mutation (11288-11296 deletion,SGF 3675-3677 deletion) and S gene mutation (21765-21770 deletion,HV 69-70 deletion) to develop diagnostic reagents, and aims to provide a novel coronavirus B.1.1.7 mutant strain triple detection kit so as to detect novel coronavirus B.1.1.7 mutant strain infected patients with high efficiency, high specificity and low cost.

Therefore, it is necessary to develop a targeted detection system to prevent missed detection that may be caused by mutation.

Before describing the present invention, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.

The multiplex PCR (multiplex PCR), also called multiplex primer PCR or multiplex PCR, is a PCR reaction in which more than two pairs of primers are added in the same PCR reaction system and simultaneously a plurality of nucleic acid fragments are amplified, and the reaction principle, reaction reagent and operation process are identical to those of the general PCR.

There are many factors that affect multiplex PCR reactions, such as:

(1) The imbalance of the reaction system results in rapid amplification of certain advantageous primers and templates thereof in the previous rounds of reaction, resulting in large amounts of amplified products which are also good inhibitors of DNA polymerase. Therefore, with the large amount of amplified products, the polymerization ability of the polymerase is more and more strongly inhibited, and therefore, the primer and its template, which are at a disadvantage in the early stage, are more difficult to react, eventually resulting in an amount of amplified products that is too small to be detected.

(2) Primer specificity, if the primer binds more strongly to other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, resulting in a decrease in amplification efficiency.

(3) The optimal annealing temperatures are not uniform, and a plurality of pairs of primers are placed in a system for amplification, so that the optimal annealing temperature of each pair of primers is required to be close because the annealing temperatures for carrying out PCR reactions are the same.

(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are also third party DNA mediated polymers, which, like non-specific primers, interfere with the competition of primers with the target binding sites, affecting amplification efficiency.

Although several factors affecting amplification efficiency are mentioned above, more factors are not yet clear. To date, there is no effective method by which amplification efficiency can be predicted explicitly.

The invention has the beneficial effects that:

(1) The kit and the detection method can be used for detecting and identifying the B.1.1.7 mutant strain.

(2) The detection kit provided by the invention has the advantages of high sensitivity and strong specificity in detecting the novel coronavirus.

(3) According to the invention, through multiple rounds of screening verification, the primer probe combination without cross reaction on the wild strain is obtained from a large number of primer probe sets, multiple detection can be performed, and the detection accuracy of the B.1.1.7 mutant strain is remarkably improved.

(4) The invention adopts three different fluorescent channels to detect the site mutation on different genes of the B.1.1.7 mutant strain respectively, and has no cross interference.

The invention is suitable for detecting novel coronaviruses, provides reliable basis for virus identification and typing, prevention and control, and is worthy of popularization and application. In addition, the method of the invention is also suitable for non-diagnostic purposes, for example, in epidemic prevention and control processes, the detection method of the invention is used for detecting virus nucleic acid in the environment, and the virus nucleic acid information can be used as public health management requirement.

The present invention will be described in further detail with reference to the following examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The following examples are not to be construed as limiting the details of the experimental procedure, and are generally carried out under conventional conditions such as those described in the guidelines for molecular cloning laboratories, sambrook.J.et al, (Huang Peitang et al, beijing: scientific Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

Example 1 kit and detection method

Primer and probe design: the whole genome sequences of the novel coronaviruses and the B.1.1.7 mutant strains are analyzed, and the conserved regions of the whole genome are analyzed and compared. Specific primer and probe sequences for the N gene mutation (28280 GAT- > CTA, D3L), ORF1ab gene mutation (11288-11296 deletion,SGF 3675-3677 deletion) and S gene mutation (21765-21770 deletion,HV 69-70 deletion) are respectively designed according to the design principle of the primer and the probe.

In addition, endogenous internal index primers and probes are designed for monitoring the sample collection, the nucleic acid extraction process and the PCR amplification process and selecting ribonuclease P (RPP 30) in human genome DNA. And finally, a set of primer and probe combination with optimal sensitivity and specificity is determined through multiple rounds of screening and optimization.

Primer probe sequence:

Sequence name	Sequence(s)	SEQ ID NO.:
			NCOV-N-F	CGTTGTTCGTTCTATGAAGACTTT	1
NCOV-N-R	TGATTTTGGGGTCCATT	2
			NCOV-N-P	CATGACGTTCGTGTTGTT	3
NCOV-ORF1ab-F	GTATTATGACATGGTTGGATATG	4
			NCOV-ORF1ab-R	CCTAGCACCATCATCATACACAGTT	5
NCOV-ORF1ab-P	TATGTATGCATCAGCTGTAGTGTTACTAATCC	6
			NCOV-S-F	TACTTGGTTCCATGCTAT	7
NCOV-S-R	TGTTAGACTTCTCAGTGGA	8
			NCOV-S-P	ACCAATGGTACTAAGAGGTT	9
P30-F6	TTGAGATAGGGTCTTTGTAC	10
			P30-R6	ATTGAGCCCAGGATTGAGC	11
P30-P6	CAGTGGCATAATCACAGC	12

Wherein, the 5 '-end fluorescent group of NCOV-N-P is FAM and the 3' -end quenching group is BHQ1; the 5 '-end fluorescent group of NCOV-ORF1ab-P is VIC, and the 3' -end quenching group is BHQ1; NCOV-S-P has a 5 '-end fluorescent group of TEXAS RED and a 3' -end quenching group of BHQ2; the 5 '-end fluorescent group of P30-P6 is CY5, and the 3' -end quenching group is BHQ2

Inspection method and system establishment

The principle of detecting novel coronavirus RNA by using the Taqman probe is as follows:

The extracted viral RNA is reverse transcribed into cDNA with anchor sequence by using the added primer sequences NCOV-N-F and NCOV-N-R, NCOV-ORF1ab-F and NCOV-ORF1ab-R, NCOV-S-F and NCOV-S-R as reverse transcription primers, and then amplified by using NCOV-N-F and NCOV-N-R, NCOV-ORF1ab-F and NCOV-ORF1ab-R, NCOV-S-F and NCOV-S-R as forward and reverse primers for real-time fluorescence PCR detection.

The method is a one-step amplification method, namely, two steps of reverse transcription of viral RNA into cDNA and DNA amplification are combined together, and the operation is carried out without tube replacement.

In order to determine the detection system of the primers and probes, the effect of different concentrations of the primers and probes on the fluorescent PCR reaction was tried, respectively.

The results showed that when the concentration of NCOV-N-F, NCOV-N-R primer was 10pmol and the concentration of NCOV-N-P probe was 4pmol; NCOV-ORF1ab-F, NCOV-ORF1ab-R primer concentration was 15pmol and NCOV-ORF1a-P probe concentration was 8pmol; NCOV-S-F, NCOV-S-R primer at a concentration of 12pmol and NCOV-S-P probe at a concentration of 6pmol; the concentration of the P30-F6, P30-R6 primer was 4pmol, the concentration of the P30-P6 probe was 2pmol, and the amplification curve was the best (FIG. 1).

When NCOV-N-F and NCOV-N-R primer were used in a concentration of 10pmol and NCOV-N-P probe was used in a concentration of 4pmol; NCOV-ORF1ab-F, NCOV-ORF1ab-R primer concentration was 15pmol and NCOV-ORF1a-P probe concentration was 8pmol; NCOV-S-F, NCOV-S-R primer concentration of 10pmol and NCOV-S-P probe concentration of 6pmol; the concentration of the P30-F6, P30-R6 primer was 5pmol, the concentration of the P30-P6 probe was 2.5pmol, and the amplification curve was as shown in FIG. 2.

When NCOV-N-F and NCOV-N-R primer were used in a concentration of 10pmol and NCOV-N-P probe was used in a concentration of 3pmol; NCOV-ORF1ab-F, NCOV-ORF1ab-R primer concentration was 15pmol and NCOV-ORF1a-P probe concentration was 8pmol; NCOV-S-F, NCOV-S-R primer at a concentration of 12pmol and NCOV-S-P probe at a concentration of 6pmol; the concentration of the P30-F6, P30-R6 primer was 4pmol, the concentration of the P30-P6 probe was 2pmol, and the amplification curve was as shown in FIG. 3.

When NCOV-N-F and NCOV-N-R primer were used in a concentration of 10pmol and NCOV-N-P probe was used in a concentration of 4pmol; NCOV-ORF1ab-F, NCOV-ORF1ab-R primer concentration was 15pmol and NCOV-ORF1a-P probe concentration was 8pmol; NCOV-S-F, NCOV-S-R primer concentration of 10pmol and NCOV-S-P probe concentration of 7pmol; the concentration of the P30-F6, P30-R6 primer was 5pmol, the concentration of the P30-P6 probe was 2.5pmol, and the amplification curve was as shown in FIG. 4.

The final reaction system (25. Mu.L) was determined as follows:

Wherein the RT-PCR reaction enzyme is composed of hot start Taq antibody enzyme, taq enzyme, reverse transcriptase, dNTPs and RNasin. The reverse transcriptase may be common reverse transcriptase such as C-MMLV. The Taq enzyme, reverse transcriptase and dNTPs can be commercially available products, such as Qiagen, wherein the amount of Taq antibody enzyme used for hot start in each human RT-PCR reaction enzyme system is 3U, the amount of Taq enzyme used is 3U, the amount of reverse transcriptase used is 3U, the amount of UDG enzyme used is 1U, and the amount of dNTPs used is 10mmol.

By testing different annealing temperatures, the reaction procedure on the ABI7500 fluorescent PCR instrument was finally determined as: 2 minutes at 50 ℃ for 1 cycle; 95 ℃ for 2 minutes, 1 cycle; 95℃for 5 seconds to 60℃for 35 seconds (fluorescence is collected), 45 cycles.

Example 2 detection of sensitivity

And (3) connecting the target fragment to a constructed pET28a-MS2 vector, converting the target fragment into an expression host bacterium BL21 competent cell, picking up a monoclonal, sequencing and verifying, performing induced expression, and digesting the completely crushed expression product with RNaseA and DNase I to obtain the virus-like particle containing the target fragment.

The pseudoviruses with the determined concentrations were diluted to the appropriate concentrations and then diluted by a 10-fold ratio, wherein the concentrations were 5.00E+06, 5.00E+05, 5.00E+04, 5.00E+03, and 5.00E+02copies/ml, respectively. The above pseudoviruses were detected using the above-identified detection system and cycle parameters (FIG. 5). The result shows that the detection method has higher sensitivity.

Example 3 detection of specificity and repeatability

Influenza A/B virus, coronavirus 229E, coronavirus NL63, coronavirus OC43, coronavirus HKU1, respiratory syncytial virus, adenovirus, mycoplasma pneumoniae, chlamydia pneumoniae and streptococcus pneumoniae are used as specific samples for detection (figure 6), and the result shows that the system has higher specificity.

Pseudoviruses at concentrations of 1.00E+06copies/ml and 1.00E+04copies/ml were selected for detection and repeated 10 times each (FIG. 7). The results show better repeatability.

2019-NCoV wild-type strain detection

10 2019-NCoV clinical wild strains (the concentration is not lower than 1.00E+05 copies/mL) are selected for detection (as shown in figures 8, 9 and 10), and the result shows that the detection accuracy of the body system to the B.1.1.7 mutant strain is extremely high, and the B.1.1.7 mutant strain can be accurately identified in the clinical use process, so that an accurate basis is provided for epidemic prevention and control.

Comparative example 1

In the research process, the inventor screens dozens of groups of PCR primers and probes aiming at the novel coronavirus target nucleic acid sequence of subtype B.1.1.7, and finally obtains the primer and probe combination which can meet the clinical detection requirements in sensitivity and specificity and can carry out multiple detection through a large number of tests.

Because the gene sequence difference of the novel coronavirus and the mutant strain thereof is very small, the difficulty of developing a detection reagent capable of accurately identifying the novel coronavirus mutant strain is relatively high, and cross reaction to the wild novel coronavirus is easy to occur. For example, the present inventors have performed extensive screening and combination of detection targets for novel coronavirus N gene mutations of subtype B.1.1.7 (28280 GAT- > CTA, D3L). A part of the typical primer sequence designed is as follows:

Control upstream primer NCOV-N-F1: TTAGATTTCATCTAAACGAACAAACTA (SEQ ID NO.: 13)

Control downstream primer NCOV-N-R1: TGAACCAAGACGCAGTATT (SEQ ID NO.: 14)

Control upstream primer NCOV-N-F2: ATCTAAACGAACAAACTAAA (SEQ ID NO.: 15)

Control downstream primer NCOV-N-R2: TTATTGGGTAAACCTT (SEQ ID NO.: 16)

The specific detection steps, detection conditions and probe sequences were the same as in the above examples, and PCR detection tests were performed.

The detection results of detecting the wild type strain of the novel coronavirus by using NCOV-N-F1 and NCOV-N-R1 are shown in figure 11, and the detection results show that the primer pair has cross reaction against the wild type novel coronavirus, and the subtype B.1.1.7 novel coronavirus cannot be accurately identified.

The detection results of NCOV-N-F2 and NCOV-N-R2 show that the primer pair has better specificity and sensitivity to N gene target nucleic acid in a single detection system, but the amplification of N gene target low-concentration nucleic acid in a triple detection system is obviously inhibited, the amplification curve is not good, and the detection results of the single and triple systems are shown in figures 12 and 13 respectively. Indicating that the control primer pairs NCOV-N-F2 and NCOV-N-R2 cannot be used in a triple detection system.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Sequence listing

<110> Guangzhou da An Gene Co., ltd

<120> Method and kit for detecting novel coronavirus B.1.1.7 mutant strain

<130> 020089

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

cgttgttcgt tctatgaaga cttt 24

<210> 2

<211> 17

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

tgattttggg gtccatt 17

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

catgacgttc gtgttgtt 18

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

gtattatgac atggttggat atg 23

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

cctagcacca tcatcataca cagtt 25

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

tatgtatgca tcagctgtag tgttactaat cc 32

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

tacttggttc catgctat 18

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

tgttagactt ctcagtgga 19

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

accaatggta ctaagaggtt 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

ttgagatagg gtctttgtac 20

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

attgagccca ggattgagc 19

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

cagtggcata atcacagc 18

<210> 13

<211> 27

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 13

ttagatttca tctaaacgaa caaacta 27

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 14

tgaaccaaga cgcagtatt 19

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 15

atctaaacga acaaactaaa 20

<210> 16

<211> 16

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 16

ttattgggta aacctt 16

Claims

1. A kit for detecting a novel coronavirus b.1.1.7 mutant, characterized in that the kit comprises a primer set and a probe set;

The primer pair set consists of a first primer pair, a second primer pair, a third primer pair and an inner index primer pair:

The first primer pair comprises:

a forward primer shown as SEQ ID NO.1 and a reverse primer shown as SEQ ID NO. 2;

the second primer pair comprises:

A forward primer shown as SEQ ID NO.4 and a reverse primer shown as SEQ ID NO. 5;

the third primer pair comprises:

a forward primer shown as SEQ ID NO.7 and a reverse primer shown as SEQ ID NO. 8;

the pair of internal primers comprises:

a forward primer shown as SEQ ID NO.10 and a reverse primer shown as SEQ ID NO. 11;

The probe set consists of a first probe with a nucleotide sequence shown as SEQ ID NO.3, a second probe with a nucleotide sequence shown as SEQ ID NO.6, a third probe with a nucleotide sequence shown as SEQ ID NO.9 and an internal standard probe with a nucleotide sequence shown as SEQ ID NO. 12.

2. The kit according to claim 1, wherein the concentration of the probe shown as 10pmol,SEQ ID NO.3 is 4pmol in the primer concentration shown as SEQ ID NO.1 and SEQ ID NO.2 in the RT-PCR reaction system;

preparing a primer concentration shown as SEQ ID NO.4 and SEQ ID NO.5 in an RT-PCR reaction system, wherein the concentration of a probe shown as 15pmol,SEQ ID NO.6 is 8pmol;

Preparing a probe with the primer concentration shown as 12pmol,SEQ ID NO.9 in SEQ ID NO.7 and SEQ ID NO.8 in an RT-PCR reaction system, wherein the concentration of the probe is 6pmol;

The concentration of the probe shown as 4pmol,SEQ ID NO.12 was 2pmol in the primer concentration shown as SEQ ID NO.10 and SEQ ID NO.11 in the RT-PCR reaction system.

3. The kit of claim 1, further comprising one or more components selected from the group consisting of: hot start Taq abzymes, taq enzymes, reverse transcriptases, UDG enzymes, dNTPs.

4. The kit of claim 1, further comprising a negative quality control.

5. The kit of claim 1, wherein, the kit further comprises a positive quality control.

6. A method for detecting a novel coronavirus b.1.1.7 mutant for non-diagnostic purposes, the method comprising the steps of:

(1) Providing a nucleic acid sample of an object to be detected;

(2) Preparing an RT-PCR reaction system and carrying out RT-PCR detection:

Wherein, the RT-PCR reaction system comprises: the nucleic acid sample, primer pair set and probe set provided in step (1);

The first primer pair comprises:

the second primer pair comprises:

the third primer pair comprises:

the pair of internal primers comprises:

7. The method of claim 6, wherein the nucleic acid sample is from an environmental sample.

8. The method according to claim 6, wherein in the step (2), the concentration of the probe represented by SEQ ID NO.1 and SEQ ID NO.2 as the primer concentration 10pmol,SEQ ID NO.3 in the RT-PCR reaction system is set to 4pmol;

9. The primer pair set and the probe set are used for preparing a PCR detection kit for detecting the novel coronavirus B.1.1.7 mutant strain;

The first primer pair comprises:

the second primer pair comprises:

the third primer pair comprises:

the pair of internal primers comprises: