CN110724763A - Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof - Google Patents
Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof Download PDFInfo
- Publication number
- CN110724763A CN110724763A CN201911010594.3A CN201911010594A CN110724763A CN 110724763 A CN110724763 A CN 110724763A CN 201911010594 A CN201911010594 A CN 201911010594A CN 110724763 A CN110724763 A CN 110724763A
- Authority
- CN
- China
- Prior art keywords
- primer
- quantitative pcr
- probe
- fluorescent quantitative
- bocavirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention provides a primer and a probe for fluorescent quantitative PCR (polymerase chain reaction) for detecting diseases caused by human adenovirus and bocavirus; in one embodiment, the primers and probes have the sequences set forth in SEQ ID NOs: 1-3 or as shown in SEQ ID NOs: 4-6. The invention also provides application of the primer and the probe or the combination thereof in preparing a reagent for detecting the human adenovirus and/or the bocavirus in a sample.
Description
Technical Field
The invention relates to the field of human respiratory viruses, in particular to a fluorescent quantitative PCR detection method and application thereof in the field of disease detection caused by human adenovirus and bocavirus.
Background
Because of the characteristics of multiple respiratory viruses, fast transmission, wide prevalence and the like, the incidence and death rate of respiratory infectious diseases are high, and the method poses great threats to human health, social stability and economic development. The proportion of viral pneumonia has risen to the first in all patients of defined etiological species beyond bacterial pneumonia (see: JAIN S et al, Community-acquired pneumoconial pneumonia amplification U.S. Adults. N Engl J Med, 2015, 373 (5): 415-27; JAIN S et al, Community-acquired pneumoconia requirring amplification U.S. children. N Engl J Med, 2015, 372 (9): 835-45). In a prospective cohort study completed in hong kong in 2018 winter, up to 44.9% of hospitalized patients with symptoms of respiratory tract infection were positive for viral detection; in a population with no symptoms of fever or Respiratory tract infection, 23.4% of hospitalized patients still have Respiratory tract viruses detected (see TO KKW et al, Respiratory virus infection, environmental infection, Respiratory virus infection with an organic Respiratory-Respiratory infection, 2019, pii: S1198-743X (19) 30183-1).
Human adenovirus (HAdV) is a nonenveloped icosahedral virus with a linear double-stranded DNA genome of 26-45kb in length. HAdV plays an important role in a variety of clinical conditions, and can cause diseases including respiratory diseases, gastroenteritis, pharyngitis, keratoconjunctivitis, meningoencephalitis, acute hemorrhagic cystitis, and hepatitis. The HAdV is divided into 6 species (HAdV-A to HAdV-F) according to the genomic DNA sequence homology and biological properties. Different HAdV species are associated with different diseases, while HAdV-B, -C and-E are primarily associated with respiratory tract infections. The Detection rate of human adenovirus is 0.8% when 10310 adult acute respiratory infection samples in 2005-. The clinical manifestations of the human adenovirus infected are more serious, which seriously endangers human health.
Bocavirus (HBoV) is a small non-enveloped virus with a linear single-stranded DNA genome of about 5kb in length. Since 2005, 4 human bocaviruses (HBoV1-4) have been identified. Some reports demonstrate that HBoV1 is very common in respiratory specimens, although there may be many asymptomatic carriers, HBoV1 has been shown to cause respiratory disease (see: Allander T et al, Cloning 0f a Human partial by molecular screening of respiratory tract samples. Proc Natl Acad Sci U S A. 2005; 102: 12891-6; Kesebir D et al, Human bovine infectious in biological in the United States: molecular profiling and clinical characteristics of a Human infectious tissue virus J Infect Dis. 2006; 194: 1276-82). HBOV2 and HBoV3 were also detected in airway samples (see: Guo L et al, Human antibodies responses to influenza underfluenza A (H7N9) virus. emery infection Dis.2014, 20: 192- "200). The detection rate of bocavirus in the acute respiratory tract samples of children in China is about 11.4 percent.
In view of the fact that respiratory tract infection pathogens are numerous, the clinical treatment schemes for viral infection and bacterial infection are different greatly, the bacterial infection needs antibacterial drug treatment, but the antibacterial drug is ineffective for the viral infection, and therefore, the diagnosis of the viral pathogen can be clearly determined, the clinical unnecessary use of the antibacterial drug can be reduced, and the clinical drug-resistant bacterial infection chances can be greatly reduced. Although clinical treatment is mainly supportive treatment under the condition of determining the etiology of corresponding virus infection at present, in addition to influenza virus, research on antiviral drugs is rapidly developed in recent years, and more selection schemes for antiviral treatment can be expected in future. Accurate diagnosis of viral infections may allow patients to receive more accurate treatment.
Traditional methods for detecting viral pathogens include isolation of the virus from respiratory tract samples (e.g., nasopharyngeal swabs, sputum, alveolar lavage, etc.) and culture or detection of viral antigens by immunofluorescence, etc. Although virus isolation and culture and virus antigen detection are the gold standards for virus detection, the method is complicated, and some viruses do not have a cell culture system, so the method is not suitable for popularization and application.
With the progress of molecular biology technology, the development of Polymerase Chain Reaction (PCR) technology has greatly improved the detection sensitivity of viral pathogens, and the technology has strong advantages for viruses which cannot be cultured, are difficult to culture or have long culture time, and are difficult to detect antigens due to antigen diversity or low content of clinical samples. A fluorescent quantitative PCR (real-time PCR) technology is a method for detecting the total amount of products after PCR circulation by using oligonucleotides modified by fluorescent substances (such as FAM and the like) at the 5 'end and quenching substances (such as TAMRA and the like) at the 3' end. The method not only can sensitively detect the virus, but also can quantitatively detect the virus load through the CT value. The fluorescent quantitative PCR technology has unique advantages in nucleic acid detection, such as easy operation, high accuracy, high sensitivity, strong specificity, fast detection time, high flux, difficult pollution and the like, so the fluorescent quantitative PCR technology is widely applied to detection in clinic and scientific research laboratories.
The conventional PCR method designs corresponding primers for each pathogen, and one reaction detects one pathogen, which is limited when it is required to detect a plurality of pathogens. In view of this, multiple pcr (multiplex pcr) technology is used, and multiple target genes can be amplified simultaneously in one system, so as to realize simultaneous detection of multiple viral pathogens and meet clinical requirements. There is still a need to design primers with better performance to detect various respiratory viruses rapidly, specifically, sensitively and accurately.
Disclosure of Invention
In the invention, specific primers and probes aiming at HAdV and HBoV genes are successfully designed, and the HAdV and the HBoV can be successfully detected respectively by extracting nucleic acid from a respiratory tract sample of a patient infected by acute respiratory viruses and then detecting the nucleic acid, thereby proving that the primers and the probes have better sensitivity and specificity. Combining the primers and the probes of the two viruses, and optimizing the template, the probes and the amplification conditions to obtain the optimal scheme for detecting the respiratory viruses HAdV and HBoV.
In a first aspect, the invention provides primers and probes for detecting human adenovirus in a sample by a fluorescent quantitative PCR method, wherein the primers are used for specifically amplifying a human adenovirus hexon gene sequence, and the probes specifically bind to an internal sequence of the human adenovirus hexon gene.
In a second aspect, the invention provides primers and probes for detecting bocavirus in a sample by a fluorescent quantitative PCR method, wherein the primers are used for specifically amplifying a bocavirus NS1 protein gene sequence, and the probes are specifically combined with an internal sequence of a bocavirus NS1 protein gene.
In a third aspect, the present invention provides a primer and probe combination for simultaneous detection of human adenovirus and bocavirus in a sample by a fluorescent quantitative PCR method, the primer and probe combination consisting of the primers and probes of the first and second aspects.
In a fourth aspect, the present invention provides a fluorescent quantitative PCR kit comprising the primers and probes of the first or second aspect, or the primer and probe combination of the third aspect.
In a fifth aspect, the invention provides the use of a primer and probe of the first or second aspect, or a primer and probe combination of the third aspect, for the preparation of a reagent for the detection of human adenovirus and/or bocavirus in a sample.
Drawings
FIG. 1 shows the detection of HAdV by the fluorescent quantitative PCR method.
FIG. 2 shows the detection of HBoV by the fluorescent quantitative PCR method.
FIG. 3 shows simultaneous detection of HAdV and HBoV by fluorescent quantitative PCR.
FIG. 4 shows the detection limit analysis of the fluorescent quantitative PCR method: (A) HAdV; (B) HBoV.
Detailed Description
The invention provides a primer and a probe for detecting human adenovirus in a sample by a fluorescent quantitative PCR method, wherein the primer is used for specifically amplifying a human adenovirus hexon gene sequence, and the probe is specifically combined with an internal sequence of the human adenovirus hexon gene.
Preferably, the nucleotide sequences of the primers and probes for human adenovirus are shown in SEQ ID NOs: 1-3.
The invention also provides a primer and a probe for detecting the bocavirus in a sample by a fluorescent quantitative PCR method, wherein the primer is used for specifically amplifying the gene sequence of the bocavirus NS1 protein, and the probe is specifically combined with the internal sequence of the bocavirus NS1 protein gene.
Preferably, the nucleotide sequences of the primers and probes against bocavirus are as shown in SEQ ID NOs: 4-6.
The invention also provides a primer and probe combination for simultaneously detecting the human adenovirus and the bocavirus in a sample by a fluorescent quantitative PCR method, wherein the primer and probe combination consists of the human adenovirus specific primer and probe and the bocavirus specific primer and probe.
Preferably, the sequence of the primer and probe combination is as shown in SEQ ID NOs: 1-6.
The invention also provides a fluorescent quantitative PCR kit, which comprises the primer and the probe for the human adenovirus or the bocavirus, or the combination of the primer and the probe.
In a specific embodiment, the kit further comprises an enzyme mixture, a PCR buffer, and nuclease-free water.
The invention also provides the application of the primer and the probe for human adenovirus or bocavirus or the combination of the primer and the probe in preparing a reagent for detecting human adenovirus and/or bocavirus in a sample.
In a specific embodiment, the sample is a clinical sample of a patient with a respiratory infection. Preferably, the sample comprises sputum, nasopharyngeal swab, alveolar lavage.
The invention will be further illustrated with reference to preferred embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Specific experimental procedures are not noted in the examples below, and are generally performed according to conventional conditions and methods, such as those described in the molecular cloning laboratory Manual (Sambrook, et al. New York: Cold Spring harbor laboratory Press, 1989) or those provided by the reagent manufacturer.
EXAMPLE 1 detection of adenovirus HAdV by fluorescent quantitative PCR method
1.1 extraction of nucleic acids
Clinical samples of patients with acute respiratory infection, such as sputum, nasopharyngeal swab, alveolar lavage fluid, etc., are taken. The nucleic acid was extracted according to a conventional method, and the obtained nucleic acid was dissolved in 50. mu.l of the eluate. The extracted nucleic acid is quantified and purity checked according to conventional methods. Subpackaging the extracted nucleic acid into small parts, and freezing and storing in a refrigerator at-80 ℃.
1.2 design and Synthesis of specific primers and probes
A Primer 3 software is utilized to respectively design a fluorescent quantitative PCR forward Primer and a fluorescent quantitative PCR reverse Primer aiming at a HAdV Hexon (Hexon) gene sequence, and a probe is designed in the gene. The design method comprises the following steps: aiming at a targeted target gene, a sliding window method is used for designing a TaqMan probe, the window width is set to be 120 nucleotides, the step length is 1 nucleotide, and all possible probe sequences are exhausted. The probes were screened using the following conditions: 1) the length of the probe sequence is 20-35 nucleotides; 2) the Tm value of the probe sequence is 70 +/-2 ℃; 3) the probe does not form a hairpin structure with the virus gene; 4) the GC content of the probe sequence is 40-70%. After the TaqMan probe is determined, a primer matched with the TaqMan probe is designed by using software, and the primer needs to meet the following conditions: 1) the length is 18-35 nucleotides, and the difference between the lengths of the upstream primer and the downstream primer is not more than 4 nucleotides; 2) the Tm value of the primer is 60 +/-2 ℃, and the difference between the Tm values of the upstream primer and the downstream primer is not more than 2 ℃; 3) the primer does not form a circular hairpin structure; 4) the primers do not form dimers by themselves; 5) no dimer is formed between the upstream primer and the downstream primer; 6) the 3' end of the primer is not G or C; 7) the amplicon size of the upstream and downstream primers is 80-180 nucleotides. And designing a plurality of pairs of primers and carrying out a matching experiment on the designed probes, and selecting the primer pair with the lowest Ct value.
Synthesizing a primer and a probe according to a conventional method, and adding a FAM fluorescent group at the 5' end of the probe. The forward, reverse and probe primers are designated ADV Hexon For, ADV Hexon Rev, ADV Hexon FAM, respectively. The primers and probes were made up to 10. mu.M with sterile water without DNase and RNase, aliquoted into small portions and frozen in a freezer at-20 ℃.
1.3 preparation of fluorescent quantitative PCR System
AgPath-ID of ABI Life technologies 1 giesTMThe One-Step RT-PCR Kit was used as an example to prepare a fluorescent quantitative PCR system.
AgPath-IDTMTaking out the One-Step RT-PCR Kit reagent, the primer and the probe from a refrigerator at the temperature of-20 ℃, dissolving the reagent, the primer and the probe, placing the dissolved reagent on ice, and preparing an RT-PCR master mix system in a PCR tube:
| composition of | 1×25(μl) |
| Nuclease-free water | 8 |
| 2 × RT-PCR buffer | 12.5 |
| ADV Hexon For | 0.5 |
| ADV Hexon Rev | 0.5 |
| ADV Hexon FAM | 0.5 |
| 25 × RT-PCR enzyme mixture | 1 |
| Total up to | 23 |
The nucleic acid was removed from the freezer at-80 ℃ and adjusted for concentration, and 2. mu.l (1-50ng) of the nucleic acid was added to the PCR tube.
1.4 fluorescent quantitative PCR reaction procedure
Putting the prepared fluorescent quantitative PCR reaction system into a fluorescent quantitative PCR instrument, and executing the following procedures:
1.5 determination of results
And (3) judging standard: negative control no amplification curve; sample CT< 35 and typical "S" type amplification curves.
The results show that HAdV positive samples can be specifically detected in acute respiratory infection samples, as shown in FIG. 1.
Example 2 detection of bocavirus HBoV by fluorescent quantitative PCR method
2.1 extraction of nucleic acids
Clinical samples of patients with acute respiratory infection, such as sputum, nasopharyngeal swab, alveolar lavage fluid, etc., are taken. The nucleic acid was extracted according to a conventional method, and the obtained nucleic acid was dissolved in 50. mu.l of the eluate. And (4) carrying out quantitative and purity detection on the extracted nucleic acid. Subpackaging the extracted nucleic acid into small parts, and freezing and storing in a refrigerator at-80 ℃.
2.2 design and Synthesis of specific primers and probes
A Primer 3 software is utilized to respectively design a fluorescent quantitative PCR forward Primer and a fluorescent quantitative PCR reverse Primer aiming at an HBoV NS1 protein gene sequence, and a probe is designed in the gene. The procedure is described in 1.2. Synthesizing a primer and a probe according to a conventional method, and adding a HEX fluorescent group at the 5' end of the probe. The forward primer, reverse primer and probe were named BoVNS1 For, BoVNS1Rev, BoVNS1 FAM, respectively. Primers and probes were formulated at 10. mu.M concentration with sterile water without DNase and RNase. Subpackaging into small parts. Freezing and storing in a refrigerator at-20 deg.C.
2.3 preparation of fluorescent quantitative PCR System
AgPath-ID of ABI Life TechnologiesTMThe One-Step RT-PCR Kit was used as an example to prepare a fluorescent quantitative PCR system.
AgPath-IDTMTaking out the One-Step RT-PCR Kit reagent, the primer and the probe from a refrigerator at the temperature of-20 ℃, dissolving the reagent, the primer and the probe, placing the dissolved reagent on ice, and preparing an RT-PCR master mix system in a PCR tube:
the nucleic acid was removed from the freezer at-80 ℃ and adjusted for concentration, and 2. mu.l (1-50ng) of the nucleic acid was added to the PCR tube.
2.4 fluorescent quantitative PCR reaction procedure
Putting the prepared fluorescent quantitative PCR reaction system into a fluorescent quantitative PCR instrument, and executing the following procedures:
2.5 determination of results
And (3) judging standard: negative control no amplification curve; sample CT< 35 and typical "S" type amplification curves.
The results show that HBoV positive samples can be specifically detected in acute respiratory infection samples, as shown in figure 2.
Example 3 fluorescent quantitative PCR method for simultaneous detection of HAdV and HBoV
3.1 extraction of nucleic acids
Clinical samples of patients with acute respiratory infection, such as sputum, nasopharyngeal swab, alveolar lavage fluid, etc., are taken. The nucleic acid was extracted according to a conventional method, and the obtained nucleic acid was dissolved in 50. mu.l of the eluate. The extracted nucleic acid is quantified and purity checked according to conventional methods. Subpackaging the extracted nucleic acid into small parts, and freezing and storing in a refrigerator at-80 ℃.
3.2 primers and probes specific for HAdV and HBoV
The primer and probe sequences specific to HAdV and HBoV were the corresponding primer and probe sequences in examples 1 and 2, respectively, and were dissolved in DNase-and RNase-free sterile water after synthesis, and all the primers and probes were mixed to adjust the final concentration of each primer or probe in the primer-probe mixture to 10. mu.M. Subpackaging the mixed solution into small parts, and freezing and storing in a refrigerator at the temperature of-20 ℃.
3.3 preparation of fluorescent quantitative PCR System
AgPath-ID of ABI Life TechnologiesTMThe One-Step RT-PCR Kit was used as an example to prepare a fluorescent quantitative PCR system.
AgPath-IDTMTaking out the One-Step RT-PCR Kit reagent, the primer and the probe from a refrigerator at the temperature of-20 ℃, dissolving the reagent, the primer and the probe, placing the dissolved reagent on ice, and preparing an RT-PCR master mix system in a PCR tube:
| composition of | 1×25(μl) |
| Nuclease-free water | 8.5 |
| 2 × RT-PCR buffer | 12.5 |
| Primer-probe mixture | 1 |
| 25 × RT-PCR enzyme mixture | 1 |
| Total up to | 23 |
The nucleic acid was removed from the freezer at-80 ℃ and adjusted for concentration, and 2. mu.l (1-50ng) of the nucleic acid was added to the PCR tube.
3.4 fluorescent quantitative PCR reaction procedure
Putting the prepared fluorescent quantitative PCR reaction system into a fluorescent quantitative PCR instrument, and executing the following procedures:
3.5 determination of results
And (3) judging standard: negative control no amplification curve; sample CT< 35 and typical "S" type amplification curves.
The result shows that in the same detection system, the acute respiratory tract infection sample can specifically detect the HAdV positive sample and the HBoV positive sample at the same time, and the result is shown in FIG. 3.
Example 4 specificity and sensitivity assays for the detection of HAdV and HBoV by fluorescent quantitative PCR
The HAdV and HBoV fluorescence quantitative PCR method is compared with a nested PCR method (hereinafter referred to as nested PCR) of a national significant and special infectious disease monitoring platform network laboratory fever respiratory syndrome virus nucleic acid detection scheme as a gold standard. And taking a sample which is positive through gold standard nested PCR detection and has correct sequencing as a positive reference, and randomly selecting and analyzing 500 detection negative samples. The results suggest that the specificity of the HAdV fluorescence quantitative PCR method was 99.5% and the sensitivity was 100% (Table 1), and that the specificity of the HBoV fluorescence quantitative PCR method was 99.6% and the sensitivity was 94% (Table 2), using nested PCR as the gold standard.
TABLE 1 analysis of specificity and sensitivity of the HAdV fluorescent quantitative PCR method
Note: sensitivity is a/(a + b); specificity d/(c + d)
TABLE 2 specificity and sensitivity analysis of HKU1 fluorescent quantitative PCR method
Note: sensitivity is a/(a + b); specificity d/(c + d)
Example 5 repeatability (precision) analysis of the HAdV and HBoV fluorescent quantitative PCR detection methods
Randomly extracting HAdV and HBoV virus positive acute respiratory tract infection samples, extracting nucleic acid, quantifying, and taking 107Copying/reacting on the same test day and repeating 5 holes on the same instrument to perform fluorescent quantitative PCR analysis, and detecting the cycle threshold (CT value); randomly extracting HAdV and HBoV virus positive acute respiratory infection specimen, extracting nucleic acid, quantifying, and taking 107The copy/reaction was analyzed by fluorescent quantitative PCR on different test days, and CT was detected for 5 replicates. The mean and standard deviation were calculated, and the intra-and inter-lot Coefficient of Variation (CV) was calculated from standard deviation/mean, resulting in intra-lot CVs of 0.14% and 0.16% for HAdV and HBoV, respectively, and 0.14% and 0.10% for inter-lot CV values, respectively, and less than 1% for both intra-and inter-lot CV values, indicating good reproducibility (table 3).
TABLE 3 analysis of repeatability (precision) of the HAdV and HBoV fluorescent quantitative PCR detection method
Example 6 analysis of detection limits of the HAdV and HBoV fluorescent quantitative PCR detection methods
Target fragments of the HAdV and HBoV are amplified by PCR, respectively cloned to plasmids containing a T7 promoter, further transcribed into RNA in vitro, residual DNA is digested by DNase, and corresponding copy numbers are respectively calculated according to RNA concentration and fragment size. And performing gradient dilution on the RNA as a template to respectively perform fluorescent quantitative PCR analysis, and preparing a standard curve according to the gradient copy number and the corresponding Ct value. Respectively carrying out fluorescence quantitative PCR analysis on the HAdV positive sample and the HBoV positive sample, and sleeving the Ct value of the sample into a standard curve to obtain virus RThe number of NA copies. Then respectively combine 108And carrying out 10-fold gradient dilution on the copied/reacted HAdV and HBoV positive samples as a template to carry out fluorescent quantitative PCR analysis, wherein the lowest detected copy numbers of the reaction system to the HAdV and the HBoV are respectively 5 and 50. The results are shown in FIG. 4.
Sequence listing
<110> institute of pathogenic biology of Chinese academy of medical sciences
<120> fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof
<130>CP1190742/CB
<141>2019-10-22
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>18
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>1
gaagtcttygacgtsgtc 18
<210>2
<211>18
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>2
tatgtkgtggcgttrccg 18
<210>3
<211>25
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>3
gcgtcatcgaaaccgtgtacctgcg 25
<210>4
<211>21
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>4
atggcctatggrggacgtggt 21
<210>5
<211>27
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>5
ttcaagcataaggagwagktcaggaca 27
<210>6
<211>26
<212>DNA
<213> Artificial sequence (synthetic sequence)
<400>6
agcgcctagctgcgtcttctgttagc 26
Claims (10)
1. The primer and the probe are used for detecting the human adenovirus in a sample by a fluorescent quantitative PCR method, the primer is used for specifically amplifying a human adenovirus hexon gene sequence, and the probe is specifically combined with an internal sequence of the human adenovirus hexon gene.
2. Primers and probes according to claim 1, having the nucleotide sequence shown in SEQ ID NOs: 1-3.
3. The primers and the probes are used for detecting the bocavirus in a sample by a fluorescent quantitative PCR method, the primers are used for specifically amplifying a bocavirus NS1 protein gene sequence, and the probes are specifically combined with an internal sequence of a bocavirus NS1 protein gene.
4. Primers and probes according to claim 3, having the nucleotide sequence shown in SEQ ID NOs: 4-6.
5. A primer and probe combination for simultaneous detection of human adenovirus and bocavirus in a sample by a fluorescent quantitative PCR method, said primer and probe combination consisting of the primers and probes of claims 1 and 3.
6. The primer and probe combination of claim 5, having a sequence as set forth in SEQ ID NOs: 1-6.
7. A fluorescent quantitative PCR kit comprising the primer and probe of any one of claims 1-4, or the primer and probe combination of claim 5 or 6.
8. The kit according to claim 7, further comprising an enzyme mixture, a PCR buffer and nuclease-free water.
9. Use of the primers and probes according to any one of claims 1 to 4, or the primer and probe combination according to claim 5 or 6, for the preparation of a reagent for the detection of human adenovirus and/or bocavirus in a sample.
10. The use of claim 9, wherein the sample is a clinical sample from a patient with a respiratory infection; preferably, the sample comprises sputum, nasopharyngeal swab, alveolar lavage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911010594.3A CN110724763A (en) | 2019-10-22 | 2019-10-22 | Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911010594.3A CN110724763A (en) | 2019-10-22 | 2019-10-22 | Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110724763A true CN110724763A (en) | 2020-01-24 |
Family
ID=69221746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911010594.3A Pending CN110724763A (en) | 2019-10-22 | 2019-10-22 | Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110724763A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549184A (en) * | 2020-06-22 | 2020-08-18 | 深圳市儿童医院 | PCR fluorescence detection kit for respiratory adenovirus and application thereof |
| CN111944923A (en) * | 2020-07-15 | 2020-11-17 | 四川大学华西医院 | Multiplex fluorescence PCR kit for detecting respiratory pathogens, method and application |
-
2019
- 2019-10-22 CN CN201911010594.3A patent/CN110724763A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| JULIA DINA等: "Development of duplex real-time PCR for detection of two DNA respiratory viruses", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| TOBIAS ALLANDER等: "Cloning of a human parvovirus by molecular screening of respiratory tract samples", 《PNAS》 * |
| XIAOYAN LU等: "Real-Time PCR Assays for Detection of Bocavirus in Human Specimens", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549184A (en) * | 2020-06-22 | 2020-08-18 | 深圳市儿童医院 | PCR fluorescence detection kit for respiratory adenovirus and application thereof |
| CN111549184B (en) * | 2020-06-22 | 2021-04-16 | 深圳市儿童医院 | PCR fluorescence detection kit for respiratory adenovirus and application thereof |
| CN111944923A (en) * | 2020-07-15 | 2020-11-17 | 四川大学华西医院 | Multiplex fluorescence PCR kit for detecting respiratory pathogens, method and application |
| CN111944923B (en) * | 2020-07-15 | 2023-10-13 | 四川大学华西医院 | Multiplex fluorescence PCR kit, method and application for detecting respiratory pathogens |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN111004870B (en) | Novel coronavirus N gene nucleic acid detection kit | |
| WO2022095723A1 (en) | Kit and method for detecting sars-cov-2 | |
| Ke et al. | Development of a quantitative Light Cycler real-time RT-PCR for detection of avian reovirus | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110408725B (en) | Kit for multiple detection of respiratory pathogens | |
| CN110724764A (en) | Fluorescent quantitative PCR detection method for human coronavirus and respiratory syncytial virus and application thereof | |
| CN110331232B (en) | Multiple nucleic acid detection kit for respiratory pathogens | |
| CN110273026B (en) | Multiple detection kit and detection method for respiratory tract infection | |
| CN110846438A (en) | Quadruple real-time fluorescent quantitative PCR (polymerase chain reaction) detection of canine adenovirus type II, canine distemper virus, canine parvovirus and canine parainfluenza virus | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN106636454B (en) | Real-time fluorescent multiplex RT-PCR method for simultaneously detecting human coronavirus 229E, OC43, NL63 and HKU1 | |
| Zhang et al. | Development of a one-step multiplex real-time PCR assay for the detection of viral pathogens associated with the bovine respiratory disease complex | |
| Xiao et al. | Simultaneous detection and differentiation of highly virulent and classical Chinese-type isolation of PRRSV by real-time RT-PCR | |
| CN110724763A (en) | Fluorescent quantitative PCR detection method for human adenovirus and bocavirus and application thereof | |
| CN111518959A (en) | Digital PCR detection method and kit for novel coronavirus | |
| Zheng et al. | A TaqMan-MGB real-time RT-PCR assay with an internal amplification control for rapid detection of Muscovy duck reovirus | |
| CN113481325A (en) | Method and kit for detecting novel coronavirus B.1.1.7 mutant strain | |
| CN117025846A (en) | Primer group for detecting novel coronavirus by multiple ddPCR and application thereof | |
| CN114410845A (en) | Locked nucleic acid modified one-step nested PCR (polymerase chain reaction) primer group and kit for detecting African swine fever virus | |
| CN114480726A (en) | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection | |
| CN114262758B (en) | Kit for detecting novel coronavirus mutant strain and detection method | |
| CN114807437B (en) | Quadruple fluorescent quantitative PCR detection kit for detecting porcine epidemic diarrhea virus and porcine rotavirus | |
| CN114085929B (en) | Kit for detecting African swine fever virus wild strain and vaccine strain | |
| CN113801966B (en) | Fluorescent quantitative PCR method and kit for detecting novel coronavirus subgenomic |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200124 |
|
| RJ01 | Rejection of invention patent application after publication |