CN113025748A - Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus - Google Patents
Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus Download PDFInfo
- Publication number
- CN113025748A CN113025748A CN202110050934.6A CN202110050934A CN113025748A CN 113025748 A CN113025748 A CN 113025748A CN 202110050934 A CN202110050934 A CN 202110050934A CN 113025748 A CN113025748 A CN 113025748A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- sequence
- primer composition
- set forth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer composition and a kit for rapidly detecting 69-70del mutation of a novel coronavirus. The primer composition comprises a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 8 is shown in the specification; the primer group comprises an F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer, and is selected from primers with sequences shown as SEQ ID NO: 3-7, comprising a polypeptide having a sequence as set forth in SEQ ID NO: 9-13, comprising a polypeptide having a sequence as set forth in SEQ ID NO: 14-18 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 15 and 17-20. The invention provides a primer composition and a kit for rapidly detecting the 69-70del mutation of the novel coronavirus based on LAMP technology, has good specificity and high sensitivity, does not need complex and expensive auxiliary equipment, can realize rapid detection of the nucleic acid molecular marker within 30-60min, can directly judge the detection result by a visual method, and has good application prospect.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a primer composition and a kit for rapidly detecting 69-70del mutation of a novel coronavirus.
Background
Coronavirus (CoV), known for its encapsidation surface with a corona coronarium-like spinous process, is a respiratory virus widely found in nature, and its host includes humans, vertebrates and invertebrates. The coronavirus belongs to the order of Toxoviridae, the family of Coronaviridae, the genus of Coronaviridae, is a positive strand single-stranded RNA virus with an envelope, the diameter is 80-120 nm, the coronavirus is composed of about 3 ten thousand basic groups, and the genetic material of the coronavirus is the largest of the known RNA viruses. The international committee for the nomenclature of viral taxonomic classification divided coronaviruses into four groups of α, β, γ, δ in 2012 according to their genetic differences and serological properties, with the β group CoV further divided into A, B, C, D four groups. The alpha and beta groups of susceptible mammals comprise 7 kinds of coronavirus which are pathogenic to human beings and are respectively HCoV-OC43, HCoV-229E, SARS-CoV, HCoV-NL63, HCoV-HKU1, MERS-CoV and SARS-CoV-2; whereas both γ and δ groups primarily infect birds. Coronavirus is a common pathogen which is easy to cause respiratory diseases, and among viruses causing pneumonia acquired in adult communities, the detection rate of coronavirus is similar to that of other respiratory viruses. SARS-CoV-2 infection not only threatens the life safety of human beings, but also causes great loss to the global social economy, and people need to be 'unhatched', actively deal with the unhappy situation, carry out deep research on epidemiology and pathogenic mechanism, actively research and develop novel specific drugs and vaccines, develop more effective detection means, kill coronavirus in 'cradle' stage, and protect and navigate human health.
Due to the structural characteristics of the virus and a plurality of hosts, the virus is easy to mutate to generate a new type of coronavirus mutant, for example, British scientists find a new coronavirus variant called B.1.1.7, the affinity of the variant virus and a human receptor is improved by 1000 times, the transmission capacity of the variant virus is about 70 percent higher than that of an original strain, more than 60 percent of recent new crown infection cases of London come from the variant virus, and a super-propagator is frequently reported, so that great difficulty is brought to the prevention and treatment of diseases. The world health organization of 12/31/2020 has officially announced four main mutants of the new coronavirus, which are: the new coronavirus found in europe showed the D614G mutation, a mink-related "Cluster 5" new coronavirus mutant found in denmark, a VOC 202012/01 new coronavirus mutant found in uk, and a 501y.v2 mutant found in south africa. Currently, variant SARS-CoV-2 is generated in dozens of countries all over the world, and the variant SARS-CoV-2 virus may not increase the severity of the disease, but causes higher morbidity and more hospitalization and death cases, so that stricter public health measures are required to control the spread of the variant virus and ensure that the new coronary pneumonia is 'preventable, controllable and treatable'.
69-70del is a deletion mutation of histidine 69 (H69) and valine 70 (V70) in the N-terminal domain (NTD) of the emerging new coronavirus spike protein (S protein), and the 69-70del mutation may cause a conformational change of the spike protein, facilitate the immune response of the host for escape of the virus, and even may cause vaccine and drug to lose the effect on the spike protein. Therefore, the rapid detection of SARS-CoV-2 can timely solve the main stream mutation condition of the virus strain, and has important significance for the prevention and control of epidemic situation, the diagnosis and treatment of diseases, the research and development of vaccines and the like.
The reverse transcription real-time PCR technology is considered as a 'gold standard' for SARS-CoV-2 detection at present, however, the technology is complex to operate, has a slow amplification speed (2-3 hours), can be carried out in a laboratory with high requirements, requires expensive detection equipment, and needs trained professional technicians to carry out detection, so that the technology is difficult to popularize, and is particularly difficult to popularize in regions with weak infrastructure and remote laggard sites. The loop-mediated isothermal amplification (LAMP) technology is used for specifically, efficiently and rapidly amplifying target nucleic acid under the constant temperature condition of 60-65 ℃ by utilizing four pairs of designed special primers and Bst DNA polymerase (with strand displacement property) with continuous displacement activity. However, there is no report of detection of the 69-70del mutation of the novel coronavirus by LAMP technology.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a primer composition and a kit for rapidly detecting the 69-70del mutation of a novel coronavirus.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer composition for rapidly detecting 69-70del mutation of a novel coronavirus, which comprises a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 8 is shown in the specification;
the primer group comprises a F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer, and is selected from primers with sequences shown as SEQ ID NO: 3-7, comprising a polypeptide having a sequence as set forth in SEQ ID NO: 9-13, comprising a polypeptide having a sequence set forth in SEQ ID NO: 14-18 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 15 and 17-20.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 3-7 and the sequence is shown as SEQ ID NO: PNA probe shown in figure 8.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 9-13 and the sequence of the primer is shown as SEQ ID NO: PNA probe shown in figure 8.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 14-18, and the sequence of the primer is shown as SEQ ID NO: PNA probe shown in figure 8.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 15 and 17-20 and the sequences are shown as SEQ ID NO: PNA probe shown in figure 8.
In a second aspect, the present invention provides an amplification system for rapid detection of 69-70del mutation of a novel coronavirus, which comprises the above primer composition, and further comprises a template, a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
Further, in the above amplification system, the final concentration of the F3 primer and the B3 primer was 0.2. mu. mol/L; the final concentration of the FIP primer and the BIP primer is 1.6 mu mol/L; the final concentration of the LB primer is 0.8. mu. mol/L; the final concentration of PNA probe was 0.8. mu. mol/L.
Further, the amplification system with a total volume of 25. mu.L comprised the following components: 2 × reaction buffer 12.5 μ L, F3 primer 1 μ L, B3 primer 1 μ L, FIP primer 1 μ L, BIP primer 1 μ L, LB primer 1 μ L, PNA probe 1 μ L, 8U enzyme solution 1 μ L, neutral red dye 1 μ L, deionized water 2.5 μ L, template 2 μ L.
Further, the reaction condition of the amplification system is 58-68 ℃ and 30-60 min; the equipment used is a common PCR instrument or a constant temperature metal bath.
In a second aspect, the present invention provides a kit for rapidly detecting a 69-70del mutation of a novel coronavirus, which comprises the above primer composition, and further comprises a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:
the invention provides a primer composition and a kit for rapidly detecting 69-70del mutation of a novel coronavirus based on LAMP technology, has good specificity and high sensitivity, does not need complex and expensive auxiliary equipment, can realize rapid detection of a nucleic acid molecular marker within 30-60min, can directly judge the detection result by a visual method, and has good application prospect.
Drawings
FIG. 1 shows a result graph of the sensitivity of the detection LAMP detection system in one embodiment of the present invention; blank control, negative control, 5 × 10 control in sequence from right to left1copies/ml、5×102copies/ml、5×103copies/ml、 5×104copies/ml、5×105copies/ml and 5X 106Positive mock samples of copies/ml;
FIG. 2 is a graph showing the results of fluorescence detection of the sensitivity of the LAMP detection system in one embodiment of the present invention;
FIG. 3 is a graph showing the results of detecting the specificity of the LAMP detection system in one embodiment of the present invention; from right to left are: influenza a virus RNA, influenza b virus RNA, rhinovirus RNA, respiratory syncytial virus RNA, weak positive control, and positive control;
FIG. 4 is a diagram showing the result of specific fluorescence detection of the LAMP detection system in one embodiment of the present invention.
Detailed Description
The present invention is directed to a polypeptide as set forth in SEQ ID NO: 1 (wild type) and SEQ ID NO: 2 (mutant) and provides a primer composition for rapid detection by LAMP technology; wherein the sequence of the target fragment is as follows:
TTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCT TACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGG TGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCA GGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACAT GTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTT AATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGC TGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTT AATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCA(SEQ ID NO： 1)；
TTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCT TACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGG TGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCA GGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATATCT GGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGA TGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGAT TTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAA CGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCA(SEQ ID NO：2)。
specifically, the primer composition comprises a PNA probe, a F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer, and the PNA probe is adopted to seal a non-specific template (wild nucleic acid) in an amplification system so as to improve the specificity of the LAMP detection system; specific sequence information is shown in table 1 below:
TABLE 1 sequence information of primer compositions for rapid detection of 69-70del mutations in novel coronaviruses
The present invention will be described in detail and specifically with reference to the following examples and drawings so as to better understand the present invention, but the following examples do not limit the scope of the present invention.
In the examples, the conventional methods were used unless otherwise specified, and the reagents used were, for example, conventional commercially available reagents or reagents prepared by conventional methods without specifically specified.
Example 1
This example provides a kit for rapid detection of 69-70del mutation of a novel coronavirus containing the primer composition, which further comprises a template, a reaction buffer, an enzyme solution, a neutral red dye and deionized water.
The total volume of the LAMP amplification system prepared by the kit in use is 25 muL, and the kit comprises the following components in volume: 2 × reaction buffer (RM)12.5 μ L, F3 primer (final concentration 0.2 μmol/L)1 μ L, B3 primer (final concentration 0.2 μmol/L)1 μ L, FIP primer (final concentration 1.6 μmol/L)1 μ L, BIP primer (final concentration 1.6 μmol/L)1 μ L, LB primer (final concentration 0.8 μmol/L)1 μ L, PNA probe (final concentration 0.8 μmol/L)1 μ L, enzyme solution (EM, 8U)1 μ L, neutral red dye 1 μ L, deionized water 2.5 μ L, template 2 μ L.
The LAMP reaction conditions of the LAMP amplification system are as follows: at 58-68 ℃ for 30-60 min; the used equipment is equipment which can stably provide constant temperature of 65 ℃ such as a common PCR instrument or a constant temperature metal bath.
Judging the result of detecting the 69-70del mutation of the novel coronavirus by using the kit: after the reaction, the reaction solution was judged to be positive when the color of the reaction solution changed from pale yellow to red.
Verification examples
This example examined the sensitivity and specificity of the amplification system (wherein, the primer composition used in the primer system of group 1 in table 1) and the kit provided in example 1, and the specific steps and experimental results are as follows:
1. sensitivity: the TA cloning plasmid containing the target fragment is constructed, the recombinant plasmid is mixed with a pharynx swab sample of a healthy person, a simulation sample with gradient concentration is prepared, the LAMP amplification system is used for detection, and the obtained result is shown in figure 1.
In addition, SYBR was added to the amplification system of the above-mentioned mock samples of different concentrations at the same time, and real-time fluorescence detection was performed on an AB 7300PCR instrument, and the results are shown in fig. 2.
As can be seen from FIGS. 1-2, the detection sensitivity can reach 5X 102copies/ml。
2. Specificity: the established LAMP amplification system is adopted to treat common clinical respiratory tract pathogens: the results of the amplification of influenza A virus RNA, influenza B virus RNA, rhinovirus RNA and respiratory syncytial virus RNA are shown in FIG. 3.
SYBR was added to the amplification system for each viral RNA and the positive control simultaneously, and real-time fluorescence detection was performed on an AB 7300PCR instrument, the results of which are shown in FIG. 4.
As can be seen from FIGS. 3 to 4, none of the viral RNAs undergoes non-specific amplification, indicating that the established LAMP detection system has good specificity.
The embodiments of the present invention have been described in detail, but the embodiments are only examples, and the present invention is not limited to the above-described embodiments. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Therefore, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
Sequence listing
<110> North yard of Huashan Hospital affiliated to Fudan university
<120> primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 397
<212> DNA
<213> target Gene sequence (wild type)
<400> 1
ttgtttttct tgttttattg ccactagtct ctagtcagtg tgttaatctt acaaccagaa 60
ctcaattacc ccctgcatac actaattctt tcacacgtgg tgtttattac cctgacaaag 120
ttttcagatc ctcagtttta cattcaactc aggacttgtt cttacctttc ttttccaatg 180
ttacttggtt ccatgctata catgtctctg ggaccaatgg tactaagagg tttgataacc 240
ctgtcctacc atttaatgat ggtgtttatt ttgcttccac tgagaagtct aacataataa 300
gaggctggat ttttggtact actttagatt cgaagaccca gtccctactt attgttaata 360
acgctactaa tgttgttatt aaagtctgtg aatttca 397
<210> 2
<211> 391
<212> DNA
<213> target Gene sequence (mutant type)
<400> 2
ttgtttttct tgttttattg ccactagtct ctagtcagtg tgttaatctt acaaccagaa 60
ctcaattacc ccctgcatac actaattctt tcacacgtgg tgtttattac cctgacaaag 120
ttttcagatc ctcagtttta cattcaactc aggacttgtt cttacctttc ttttccaatg 180
ttacttggtt ccatgctata tctgggacca atggtactaa gaggtttgat aaccctgtcc 240
taccatttaa tgatggtgtt tattttgctt ccactgagaa gtctaacata ataagaggct 300
ggatttttgg tactacttta gattcgaaga cccagtccct acttattgtt aataacgcta 360
ctaatgttgt tattaaagtc tgtgaatttc a 391
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<400> 4
ggactgggtc ttcgaatc 18
<210> 5
<211> 48
<212> DNA
<213> Artificial sequence
<400> 5
atcaaacctc ttagtaccat tggtcctttc ttttccaatg ttacttgg 48
<210> 6
<211> 43
<212> DNA
<213> Artificial sequence
<400> 6
aaccctgtcc taccatttaa tgatgaccaa aaatccagcc tct 43
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence
<400> 7
ttttgcttcc actgagaagt ctaac 25
<210> 8
<211> 14
<212> DNA
<213> Artificial sequence
<400> 8
<210> 9
<211> 18
<212> DNA
<213> Artificial sequence
<400> 9
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence
<400> 10
agtggaagca aaataaacac c 21
<210> 11
<211> 48
<212> DNA
<213> Artificial sequence
<400> 11
aggtaagaac aagtcctgag ttgattatta ccctgacaaa gttttcag 48
<210> 12
<211> 45
<212> DNA
<213> Artificial sequence
<400> 12
tcttttccaa tgttacttgg ttccagacag ggttatcaaa cctct 45
<210> 13
<211> 22
<212> DNA
<213> Artificial sequence
<400> 13
tgctatatct gggaccaatg gt 22
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence
<400> 14
gtgtttatta ccctgacaaa gt 22
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence
<400> 15
gtaccaaaaa tccagcctc 19
<210> 16
<211> 47
<212> DNA
<213> Artificial sequence
<400> 16
tggaaccaag taacattgga aaagatcaga tcctcagttt tacattc 47
<210> 17
<211> 44
<212> DNA
<213> Artificial sequence
<400> 17
tatctgggac caatggtact aagaggactt ctcagtggaa gcaa 44
<210> 18
<211> 24
<212> DNA
<213> Artificial sequence
<400> 18
gtttgataac cctgtcctac catt 24
<210> 19
<211> 21
<212> DNA
<213> Artificial sequence
<400> 19
ctgacaaagt tttcagatcc t 21
<210> 20
<211> 45
<212> DNA
<213> Artificial sequence
<400> 20
gcatggaacc aagtaacatt ggaagtttta cattcaactc aggac 45
Claims (10)
1. A primer composition for rapidly detecting 69-70del mutation of a novel coronavirus is characterized by comprising a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 8 is shown in the specification;
the primer group comprises an F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer, and is selected from primers with sequences shown as SEQ ID NO: 3-7, comprising a polypeptide having a sequence as set forth in SEQ ID NO: 9-13, comprising a polypeptide having a sequence as set forth in SEQ ID NO: 14-18 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 15 and 17-20.
2. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 3-7 and the sequence is shown as SEQ ID NO: PNA probe shown in figure 8.
3. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 9-13 and the sequence of the primer is shown as SEQ ID NO: PNA probe shown in figure 8.
4. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 14-18, and the sequence of the primer is shown as SEQ ID NO: PNA probe shown in figure 8.
5. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 15 and 17-20 and the sequences are shown as SEQ ID NO: PNA probe shown in figure 8.
6. An amplification system for rapid detection of 69 to 70del mutations of a novel coronavirus comprising the primer composition according to any one of claims 1 to 5, further comprising a template, a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
7. The amplification system of claim 6, wherein the final concentration of the F3 primer and the B3 primer in the amplification system is 0.2 μmol/L; the final concentration of the FIP primer and the BIP primer is 1.6 mu mol/L; the final concentration of the LB primer is 0.8. mu. mol/L; the final concentration of PNA probe was 0.8. mu. mol/L.
8. The amplification system of claim 7, wherein the amplification system comprises the following components in a total volume of 25 μ L: 2 × reaction buffer 12.5 μ L, F3 primer 1 μ L, B3 primer 1 μ L, FIP primer 1 μ L, BIP primer 1 μ L, LB primer 1 μ L, PNA probe 1 μ L, 8U enzyme solution 1 μ L, neutral red dye 1 μ L, deionized water 2.5 μ L, template 2 μ L.
9. The amplification system of claim 6, wherein the reaction conditions of the amplification system are 58-68 ℃ for 30-60 min; the equipment used is a common PCR instrument or a constant temperature metal bath.
10. An amplification system kit for rapid detection of a 69-70del mutation of a novel coronavirus comprising the primer composition as defined in any one of claims 1 to 5, wherein the kit further comprises a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110050934.6A CN113025748A (en) | 2021-01-14 | 2021-01-14 | Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110050934.6A CN113025748A (en) | 2021-01-14 | 2021-01-14 | Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113025748A true CN113025748A (en) | 2021-06-25 |
Family
ID=76459320
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110050934.6A Pending CN113025748A (en) | 2021-01-14 | 2021-01-14 | Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113025748A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113637798A (en) * | 2021-08-09 | 2021-11-12 | 南昌大学 | Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe |
| CN113755644A (en) * | 2021-09-24 | 2021-12-07 | 中国科学院武汉病毒研究所 | Kit for detecting novel coronavirus Alpha and Delta mutant and application |
| CN113846184A (en) * | 2021-07-07 | 2021-12-28 | 复旦大学附属华山医院北院 | Primer composition and kit for rapidly detecting SARS-CoV-2Delta variant strain variation |
| CN113881806A (en) * | 2021-09-23 | 2022-01-04 | 华南理工大学 | Method and kit for detecting novel coronavirus and 69/70 mutant strain based on CRISPR/Cas12a technology |
| CN114107574A (en) * | 2022-01-27 | 2022-03-01 | 深圳联合医学科技有限公司 | Kit and method for detecting novel coronavirus and Omicron mutant strain thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111378784A (en) * | 2020-03-06 | 2020-07-07 | 齐鲁工业大学 | Novel coronavirus SARS-CoV-2 nucleic acid visual detection kit |
| CN111518947A (en) * | 2020-03-06 | 2020-08-11 | 齐鲁工业大学 | RT-LAMP primer group and kit for detecting novel coronavirus SARS-CoV-2 |
-
2021
- 2021-01-14 CN CN202110050934.6A patent/CN113025748A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111378784A (en) * | 2020-03-06 | 2020-07-07 | 齐鲁工业大学 | Novel coronavirus SARS-CoV-2 nucleic acid visual detection kit |
| CN111518947A (en) * | 2020-03-06 | 2020-08-11 | 齐鲁工业大学 | RT-LAMP primer group and kit for detecting novel coronavirus SARS-CoV-2 |
Non-Patent Citations (2)
| Title |
|---|
| ALEJANDRO LOPEZ-RINCON ET AL.: "Design of Specific Primer Set for Detection of B.1.1.7 SARS-CoV-2 Variant using Deep Learning", 《BIORXIV PREPRINT》 * |
| GUOJUN CAO等: "Rapid detection of CALR type 1 and type 2 mutations using PNA-LNA clamping loop-mediated isothermal amplification on a CD-like microfluidic chip", 《ANALYTICA CHIMICA ACTA》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846184A (en) * | 2021-07-07 | 2021-12-28 | 复旦大学附属华山医院北院 | Primer composition and kit for rapidly detecting SARS-CoV-2Delta variant strain variation |
| CN113846184B (en) * | 2021-07-07 | 2024-06-04 | 复旦大学附属华山医院 | Primer composition and kit for rapidly detecting variation of SARS-CoV-2 Delta variant |
| CN113637798A (en) * | 2021-08-09 | 2021-11-12 | 南昌大学 | Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe |
| CN113881806A (en) * | 2021-09-23 | 2022-01-04 | 华南理工大学 | Method and kit for detecting novel coronavirus and 69/70 mutant strain based on CRISPR/Cas12a technology |
| CN113755644A (en) * | 2021-09-24 | 2021-12-07 | 中国科学院武汉病毒研究所 | Kit for detecting novel coronavirus Alpha and Delta mutant and application |
| CN113755644B (en) * | 2021-09-24 | 2024-05-03 | 中国科学院武汉病毒研究所 | Kit for detecting novel coronavirus Alpha and Delta mutant and application thereof |
| CN114107574A (en) * | 2022-01-27 | 2022-03-01 | 深圳联合医学科技有限公司 | Kit and method for detecting novel coronavirus and Omicron mutant strain thereof |
| CN114107574B (en) * | 2022-01-27 | 2023-05-12 | 深圳联合医学科技有限公司 | Kit and method for detecting novel coronavirus and Omicron mutant strain thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113025748A (en) | Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus | |
| WO2021233480A2 (en) | Nucleic acid test kit, test method, and use | |
| CN113046475B (en) | Primer composition and kit for rapidly detecting mutant novel coronavirus | |
| Clerc et al. | Comparison of randomly amplified polymorphic DNA with amplified fragment length polymorphism to assess genetic diversity and genetic relatedness within genospecies III of Pseudomonas syringae | |
| CN112322764B (en) | Detection kit and detection method for brucella | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| CN113881812B (en) | Composition, kit and method for detecting SARS-CoV-2 mutant strain and use thereof | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| JP7374377B2 (en) | Test kit for Salmonella typhi, its manufacturing method, and its uses | |
| CN113005228B (en) | Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof | |
| CN110724769A (en) | PCR primer group, kit and detection method for detecting African swine fever virus MGF360-505R gene | |
| CN111748651B (en) | Kit for detecting nucleic acid of respiratory tract pathogen, detection method and application | |
| CN113249522A (en) | Method for detecting SARS-CoV-2variant strain nucleic acid and its application | |
| CN113046476A (en) | Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus | |
| CN113846185A (en) | Primer composition and kit for rapid detection of new coronavirus E484K/Q, K417N/T variation | |
| CN113151585A (en) | Primer composition and kit for rapidly detecting mutation of novel coronavirus D614G | |
| CN111534636A (en) | Primer pair, probe, kit and detection method for detecting 2019-nCoV and application thereof | |
| CN114350854B (en) | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR | |
| KR20180125141A (en) | Primer set for detection of MERS-coronavirus and uses thereof | |
| KR102267326B1 (en) | Method and kit for detecting coronavirus | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| Wang et al. | Visual and label-free ASFV and PCV2 detection by CRISPR-Cas12a combined with G-quadruplex | |
| Wang et al. | Fast and sensitive differential diagnosis of pseudorabies virus-infected versus pseudorabies virus-vaccinated swine using CRISPR-Cas12a | |
| CN113684311A (en) | Primer, probe and method for specifically and rapidly detecting GII type norovirus | |
| CN111647683A (en) | New coronavirus 2019-nCoV nucleic acid detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |