CN110567951A - Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof - Google Patents
Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof Download PDFInfo
- Publication number
- CN110567951A CN110567951A CN201910886954.XA CN201910886954A CN110567951A CN 110567951 A CN110567951 A CN 110567951A CN 201910886954 A CN201910886954 A CN 201910886954A CN 110567951 A CN110567951 A CN 110567951A
- Authority
- CN
- China
- Prior art keywords
- cas12a
- crispr
- aunp
- virus
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plasma & Fusion (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of molecular biology, and relates to an apple stem groove virus visual detection system based on a CRISPR-Cas12a technology and a detection method thereof. Designing crRNA according to an ASGV conserved sequence, manufacturing AuNP-DNA for colorimetric detection, researching the influence of Cas12a protein in-vitro cutting reaction time and linker DNA concentration on detection effect, establishing an optimal ASGV visual detection system and a detection method, wherein the method is a constant-temperature reaction condition, and improves specificity by recognizing virus through a CRISPR-Cas12a-crRNA complex, and the linker DNA has universality and does not need expensive detection methoddouble-labeled probe capable of detecting multiple samples within 40 min by low-speed centrifugation, wherein the lower detection limit is 5.62X 102copies/reaction, sensitivity 100 times higher than RT-PCR.
Description
Technical Field
the invention belongs to the field of molecular biology, relates to a detection method of apple stem groove virus, and particularly relates to a CRISPR-Cas12a technology-based apple stem groove virus visual detection system and a detection method thereof.
background
Apple (A)Malus domesica) Is one of the fruits with the largest cultivation area and yield in the world, is mainly planted in temperate regions in the world, and has high commercial value. 2018-the total yield of the apples in the world in 2019 is expected to be 6860.0 ten thousand t, and the total yield of the apples in China is expected to reach 3100.0 ten thousand t. Meanwhile, the apple industry faces serious apple virus diseases, 17 apple virus diseases are known at present, and latent recessive viruses such as ACLSV, ASPV, ASGV and the like are common in China and have large harm. Latent recessive viruses generally do not show obvious symptoms, but the growth quantity of trees can be reduced by 16% -36% after the trees are sick, the yield is reduced by 17.0% -73.7%, and the likethe absorption and utilization of the root system of the apple to the soil nutrient substances are reduced, the fertilizing amount is increased by 30-40%, and the quality and the yield of the apple are seriously damaged.
For a long time, because people lack knowledge of latent viruses and cannot distinguish and eradicate the latent viruses in cultivation, the harm of the latent viruses of the apples is continuously expanded. Apple virus has no effective chemical or biological preparation, and once infected, the apple virus is toxic for life and is damaged for a long time. Grafting is a main approach for apple virus propagation, so that propagation of virus-free seedlings and enhancement of virus quarantine of seedlings and garden trees are the only approach and the fundamental guarantee for preventing and treating virus diseases.
traditionally, apple virus is often detected by indicator plant method and enzyme-linked immunosorbent assay. With the development of molecular biology, nucleotide-based molecular detection techniques, such as Polymerase Chain Reaction (PCR), have been widely used for detecting major viruses of apple. The detection method provided by patent CN201510051864.0 adopts cDNA of a disease-sensitive material as a template, amplifies a product by a specific primer, and after the product is connected and transformed by a vector, selects a positive clone for propagation culture and performs plasmid extraction and identification (enzyme digestion identification) to obtain a positive recombinant plasmid standard. The PCR detection has strong specificity and high accuracy, but the method is complicated, and not only needs related professional operation training, but also needs to purchase larger and expensive equipment such as a PCR instrument and a gel irradiation instrument.
The CRISPR-Cas technology is a newly emerged genome editing technology and has strong target specificity, and recent research shows that the Cas12a protein can stimulate trans-cutting activity after identifying a target and perform indiscriminate cutting on any single-stranded DNA in a system. This property has been exploited to detect Human Papilloma Virus (HPV) and to accurately distinguish between the two subtypes by observing the fluorescent signal. Meanwhile, by combining the CRISPR technology with a lateral flow test strip, a Zhang Feng team develops a test strip which can detect Zika virus (ZIKV) and dengue fever (DHF) within 2 h. In addition to viruses, CRISPR has been applied to the detection of gut microbes, from which clostridium difficile (clostridium difficile) can be accurately detected. However, the detection method based on CRISPR takes a lot of time and requires a large-scale device such as a microplate reader when using fluorescence detection, and visual detection by a test strip developed later is simple, but requires a lot of expensive fluorescent probes to observe, which is high in cost.
the colorimetric detection of gold nanoparticles (AuNPs) is a simpler and less expensive detection format, moving the absorption peak to longer wavelengths by aggregation of AuNPs and changing the color of the colloidal solution from red to purple. Therefore, the efficient and low-cost virus detection method using the apple tissue crude extract as the template can be developed by using gold nanoparticles (AuNPs) as a color developing agent and combining the CRISPR-Cas12a technology.
disclosure of Invention
in order to solve the problems in the existing apple virus detection method, the invention provides an apple stem groove virus visual detection system based on a CRISPR-Cas12a technology and a detection method thereof.
The technical scheme of the invention is realized as follows:
An apple stem groove virus visual detection system based on CRISPR-Cas12a technology, which comprises Cas12a protein, crRNA, Linker DNA, AuNP-DNA complex and NEBuffer 2.1.
The preparation method of the AuNP-DNA compound comprises the following steps:
(1) adding 2 mu L of 1 wt% Tween20 and 10 mu L of 4 mu M mPEG-SH into 200 mu L of 13 nm AuNP solution to obtain a mixed solution;
(2) Adding 10 mu L of 100 mu M thiolated DNA1 into the mixed solution obtained in the step (1), adding 50 mu L of 4M NaCl, and aging at room temperature for 60 min to obtain a treatment solution;
(3) centrifuging the treated solution in a centrifuge at 14000 rpm at 4 deg.C for 10min to remove supernatant to obtain precipitate;
(4) Resuspending the pellet from step (3) with PBST solution, repeatedly centrifuging and resuspending for three times, and adding 200. mu.L PBST solution to obtain AuNP-DNA 1;
(5) Preparing AuNP-DNA2 with reference to steps (1) to (4);
(6) mu.L of each of AuNP-DNA1 and AuNP-DNA2 was mixed, and 2.8. mu.L of 4M NaCl solution was added to the mixture to obtain an AuNP-DNA complex for colorimetric detection.
The mass concentration of the 13 nm AuNP solution in the step (1) is 0.1 mg/mL.
In the step (2), the sequence of the DNA1 is shown as SEQ ID NO.1, and the sequence of the DNA2 is shown as SEQ ID NO. 2.
The preparation method of the crRNA comprises the following steps: taking ASGV-T7-crRNA-F and ASGV-crRNA-R as primers, recovering products after PCR and carrying out reverse transcription to obtain crRNA; wherein the sequence of ASGV-T7-crRNA-F is shown in SEQ ID NO.4, and the sequence of ASGV-crRNA-R is shown in SEQ ID NO. 5.
The Linker DNA sequence is shown in SEQ ID NO. 3.
The detection method of the apple stem groove virus visual detection system comprises the following steps:
Mixing Cas12a protein and crRNA, adding 14.5 mu of LNEBuffer 2.1, and pre-assembling by warm bath in a heating instrument at 37 ℃ for 5 min;
Secondly, adding linker DNA and a sample to be detected into the reaction tube in the step I, and carrying out warm bath on a heating instrument at 37 ℃ for 30 min;
③ taking 5 mu L of the trans-cutting product obtained in the step II, and adding the trans-cutting product into the AuNP-DNA compound solution;
Standing at room temperature for 10min, centrifuging for 1 min by a micro centrifuge, and observing the result, wherein the positive result is obtained when the color is kept red and the negative result is obtained when the color is pink.
In the step (i), the concentration of the Cas12a protein is 1 muM, the dosage is 4 muL, and the concentration of the crRNA is 10 muM, the dosage is 0.5 muL.
In the second step, the concentration of the linker DNA is 10 mu M, the dosage is 0.5 mu L, and the dosage of the sample to be detected is 0.5 mu L.
the invention has the following beneficial effects:
1. The invention combines CRISPR technology and AuNP-DNA for detecting ASGV, cuts linker DNA after preparing low-cost AuNP-DNA compound solution and recognizing virus sequence by cas12a-crRNA protein complex, prevents the AuNP-DNA from generating cross-linking reaction, and realizes the visual detection of ASGV. The invention does not need expensive double-labeled probes, and the prepared linker DNA has universality and is suitable for detecting any virus, and the detection of a large number of samples can be completed within 40 min under the isothermal reaction condition.
2. The invention establishes a method for rapidly detecting ASGV based on CRISPR-Cas12a technology and AuNP-DNA complex. The method is a constant-temperature reaction condition, improves specificity by CRISPR-cas12a-crRNA recognition, has the advantages of universality of linker DNA, does not need expensive double-labeled probes, can detect a plurality of samples within 40 min by virtue of low-speed centrifugation, and has the lower detection limit of 5.62 multiplied by 102copies/reaction, sensitivity 100 times higher than RT-PCR. When 51 field samples are detected, compared with RT-PCR, the method has the advantages that the positive detection rate consistency rate is 98.04%, the consistency rate is high, and the specificity is good.
3. According to the invention, the synthesis of an expensive fluorescent probe is omitted by preparing a low-cost and universal AuNP-DNA compound solution, and a brand-new and low-cost CRISPR visual detection method is developed. By optimizing the reaction time, the liner DNA concentration and the like of the detection method, the ASGV detection method with low cost, strong specificity and high sensitivity is established. The detection cost of the method is 3 yuan/sample, which is far lower than that of other visual detection methods; in sensitivity, the method is 100 times higher than that of the common RT-PCR; in specificity, the accuracy can be improved to the difference of a single base by means of CRISPR; at the reaction temperature, the method does not need an RT-PCR thermal denaturation process and any precise thermal cycler, and the reaction can be carried out at the constant temperature of 37 ℃; in terms of time, linkerDNA in the system can be completely cut within 30 min by using the trans-cleavage activity of the Cas12a protein, so that the color of an AuNP solution is kept unchanged, and the detection time is shortened. Meanwhile, compared with RT-PCR, the method relies on crRNA and cas12a protein to identify ASGV, so that the steps of repeated screening of primers and the like are omitted, the operation is simple and convenient, and the operation of professionals is not needed.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 shows linker DNA concentration and reaction time (FIGS. A-B); a: 1-6: 0.5. mu.M, 1.0. mu.M, 1.5. mu.M, 2.5. mu.M, 3.5. mu.M, 5.0. mu.M; n: linker DNA was not added; b: 1-5: 10min, 20 min, 30 min, 40 min, 50 min; n: linker DNA was not added.
FIG. 2 is an apple stem groove virus RT-PCR and CRISPR-Cas12a nano-gold colorimetric sensitivity assay (FIGS. A-B); a: RT-PCR; b: CRISPR-Cas12a nano-gold colorimetry; 1-10: 5.62X 109-5.62×102Copy/reaction (plasmid); n: negative control; m: 500 Marker.
FIG. 3 is an apple stem groove virus RT-PCR and CRISPR-Cas12a nano-gold colorimetric assay (A-B); FIG. A: RT-PCR; and B: RT-PCR; m: 500 DNA marker; n: negative control; 1-13: and (4) field samples.
FIG. 4 shows the results of colorimetric detection of three apple growing regions ASGV RT-PCR and CRISPR-Cas12a nanogold in Henan province; n: negative control; 1-51: and (4) field samples.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive effort based on the embodiments of the present invention, are within the scope of the present invention.
experimental Material
Test host plant
in 2018, in 5-8 months, 51 parts of apple leaves are collected from Zhengzhou, Sanmenxia and Luoning, wherein 30 parts of symptomatic leaves are collected, and 21 parts of leaves without obvious symptoms are collected. Collecting basic information such as variety, strain, presence or absence of exterior syndrome, time and place, etc. on sample time scale, taking it back to laboratory, and quickly freezing with liquid nitrogen, and storing in refrigerator at-80 deg.C for use.
Main reagent and instrument
cas12a protein (NEB, Beijing), mPEG-SH (Michael), PBST buffer (Solebao), Tween-20 (Solebao), Universal DNA purification recovery kit (Beijing Tiangen, DP 214), T7 High Yield transfection kit (ThermoFisher Scientific), RNA reverse transcription kit (TAKARA, China), PCR (eppendorf), centrifuge (eppendorf), constant temperature water bath (essence macro), electrophoresis apparatus (Bio-Rad), Vortex apparatus (Vortex-Genie 2), autoclave (Zealway), clean bench (airtech) and nucleic acid detection imaging system (Bio-Rad).
Examples
the detection method of the apple stem groove virus visual detection system based on the CRISPR-Cas12a technology comprises the following steps:
1. AuNP-DNA Complex preparation
Probe DNA and Linker DNA sequences, wherein the DNA1 sequence is shown as SEQ ID NO.1, the DNA2 sequence is shown as SEQ ID NO.2, and the Linker DNA sequence is shown as SEQ ID NO. 3; synthesized by living organisms (Shanghai, China):
② adding 2 mu L of 1 wt% Tween20 and 10 mu L of 4 mu M mPEG ~ SH (MW ~ 5 kDa) into 200 mu L of 0.1 mg/ml 13 nm AuNP solution;
③ Add 10. mu.L 100. mu.M thiolated DNA1 or DNA2 to the mixture and add 50. mu.L 4M NaCl; aging at room temperature for 60 min;
Fourthly, centrifuging the mixture in a centrifuge at 14000 rpm for 10min at 4 ℃ to remove supernatant;
Resuspending the precipitate with PBST solution, repeatedly centrifuging and resuspending for three times, and adding 200 μ L PBST solution to obtain AuNP-DNA1 or AuNP-DNA 2;
Sixthly, 5 mu L of AuNP-DNA1 and 5 mu L of AuNP-DNA2 are mixed, 2.8 mu L of 4M NaCl solution is added into the mixed solution, and the nanogold solution for colorimetric detection is formed.
2. Preparation of crRNA
Design of crRNA: comparing sequences of apple stem groove virus isolates in NCBI database, selecting ASGV highly conserved region as ASGV target to design crRNA transcription template, wherein primers of the crRNA transcription template are ASGV-T7-crRNA-F and ASGV-crRNA-R, sequence of ASGV-T7-crRNA-F is shown in SEQ ID NO.4, and sequence of ASGV-crRNA-R is shown in SEQ ID NO. 5; the ASGV target sequence is shown in SEQ ID NO. 6; synthesized by living creatures (Shanghai, China).
Annealing to prepare crRNA transcription template:
The annealing reaction system is shown in table 1 below:
The PCR reaction program is as follows: 30s at 98 ℃; circulating for 35 times at 98 deg.C for 10 s, 60 deg.C for 30s, and 72 deg.C for 15 s; 10min at 72 ℃; terminating the reaction at 4 ℃;
Purifying the PCR product by using a Universal DNA purification recovery kit, referring to the instruction, and detecting the DNA concentration;
③ 2. mu.g of DNA recovered product was extracted and reverse transcribed into crRNA using T7 High Yield Transcription Kit (ThermoFisher Scientific), the procedure was as described in the specification, and the concentration was measured and diluted to 10. mu.M.
3. CRISPR-Cas12a reaction system
the full-length sequence of the registered ASGV coat protein gene (KY 680265.1) is searched in a GenBank database, specific primers ASGV-F1 (GGCAGAACTCTTTGAACGAAT) and ASGV-R1 (GTATAAAGGCAGGCATGTCAAC) are designed in a relatively conserved region by comparing with a plurality of ASGV coat protein sequences, and the amplified sequence comprises a crRNA target sequence. The leaf cDNA of a local infection plant is taken as a material, and an amplification product is connected to a PMD20-T vector through purification to construct ASGV virus plasmid. The sequence sequencing and Blast alignment analysis showed that the sequence similarity with the Indian plum isolate (accession number: HE 978837.1) was the highest and was 99.26%. CRISPR-Cas12a recognizes viral DNA and activates the trans-cleavage system in vitro as follows:
Mixing Cas12a protein and crRNA, adding NEBuffer 2.1, and pre-assembling by warm bath for 5 min in a heating instrument at 37 ℃;
② adding linker DNA and ASGV virus plasmid into the reaction tube of the first step, and warm-bathing on a heating instrument at 37 ℃ for 30 min.
3.1 Regulation of the reaction time
Determination of the time taken for the CRISPR-Cas12a to completely cleave the linker DNA with ASGV virus standard plasmid (5.62 × 10)9 copies/reaction) as target. The trans-cutting time is respectively set to 10min, 20 min, 30 min, 40 min and 50 min, and the test is repeated to determine the optimal reaction time.
Results and analysis
the linker DNA concentrations of the CRISPR-Cas12a reaction system were set to 0.5. mu.M, 1.0. mu.M, 1.5. mu.M, 2.5. mu.M, 3.5. mu.M, and 5.0. mu.M, respectively. And adding the reaction product into the nano-gold compound solution after the reaction is finished for 30 min at 37 ℃. After 10min at room temperature, observing color change by short centrifugation; when the concentration of linker DNA is 1.5. mu.M, the color change effect is better, and is obviously different from the control (FIG. 1, A). Therefore, 1.5. mu.M was used as the optimum concentration of the linker DNA.
Setting the time of a CRISPR-Cas12a reaction system as 10min, 20 min, 30 min, 40 min and 50 min respectively, and adding a reaction product into an AuNP-DNA solution after the reaction is finished. After 10min at room temperature, observing color change by short centrifugation; when the reaction was 40 min, the color did not change with time, but when the reaction was 30 min, it was already clearly different from the control (FIG. 1, A). Therefore, 30 min was used as the optimal reaction time (FIG. 1, B).
In conclusion, it was determined that the reaction was carried out for 30 min with the addition of 1.5. mu.M linker DNA as the optimum reaction system.
3.2 CRISPR-Cas12a sensitivity assay
Target ASGV plasmid, calculate copy number, and release 5.62×109 for the initial copy number, dilutions were performed sequentially by a factor of 10. RT-PCR and CRISPR-Cas12a binding AuNP-DNA detection were performed separately.
The calculation method of the copy number comprises the following steps:
CRISPR-Cas12a detection by combining with AuNP-DNA colorimetric method:
Referring to a system in a table 2, Cas12a protein and crRNA are mixed, NEBuffer 2.1 is added, and pre-assembly is carried out by warm bath for 5 min in a heating instrument at 37 ℃;
secondly, adding linker DNA and ASGV virus plasmids into the reaction tube in the step I, and carrying out warm bath on a heating instrument at 37 ℃ for 30 min;
③ adding 5 mu L of the reaction solution into AuNP-DNA solution;
Fourthly, standing for 10min at room temperature, centrifuging for 1 min by a micro centrifuge, and observing the result, wherein if the color is kept red and unchanged, the result is positive, and if the color is changed into pink, the result is negative.
ASGV virus plasmid as template, 5.62X 109taking copies/reaction as initial concentration, sequentially diluting by taking 10 times, simultaneously setting negative controls, respectively carrying out RT-PCR amplification detection and CRISPR-Cas12a colorimetric detection, carrying out ASGV-F1 (GGCAGAACTCTTTGAACGAAT) and ASGV-R1 (GTATAAAGGCAGGCATGTCAAC) on RT-PCR amplification primers, carrying out electrophoresis on a 2% agarose gel, and observing the result.
the sensitivity of RT-PCR was 5.62X 104copies/reaction; the sensitivity of the CRISPR-Cas12a colorimetric detection is 5.62 multiplied by 10 copies2Reaction. The colorimetric detection sensitivity of the CRISPR-Cas12a is 100 times higher than that of RT-PCR, the detection rate consistency of the two methods is higher, and the result is reliable (see figure 2).
3.4 specificity test
and (3) taking the cDNAs of the 13 samples as samples to be detected respectively by referring to the optimization conditions, carrying out RT-PCR amplification reaction and a CRISPR-Cas12a combined AuNP-DNA colorimetric method, setting negative control, and comparing, analyzing and detecting the difference of the methods in specificity. The detection result of RT-PCR is shown in figure 3 (A), and the detection result of CRISPR-Cas12a combined with AuNP-DNA colorimetric method is shown in figure 3 (B), and the detection results of the two detection methods are consistent, which shows that the specificity of CRISPR-Cas12a combined with AuNP-DNA colorimetric method is better.
Examples of the effects of the invention
the method comprises the steps of collecting 51 field samples in a field, extracting RNA and carrying out reverse transcription to obtain cDNA, detecting viruses of the sample cDNA by respectively using CRISPR-Cas12a combined with an AuNP-DNA colorimetric method and RT-PCR detection in the embodiment according to the optimized conditions of the embodiment, setting a negative control, carrying out electrophoresis on RT-PCR amplification products on 2% agarose gel, observing results, and comparing, analyzing and detecting differences of the detection method in specificity.
the results show that the number of samples containing ASGV virus detected by CRISPR-Cas12a in combination with AuNP-DNA colorimetric method is 32, the number of samples containing ASGV detected by RT-PCR is 31, and the results show that the CRISPR-Cas12a in combination with AuNP-DNA colorimetric method has higher sensitivity than RT-PCR (FIG. 4). Therefore, the method establishes the CRISPR-Cas12a of the ASGV and combines with the AuNP-DNA colorimetric method, has accurate result, and can be used for detecting field samples with low virus content.
Discussion of the related Art
in the invention, the CRISPR technology and the AuNP-DNA solution are creatively combined for detecting ASGV, so that the combination of the two technologies is realized, the respective cost of the technologies is greatly reduced, the AuNP-DNA colorimetric detection method based on the CRISPR-Cas12a is established, and the blank of the CRISPR technology in the field of plant virus detection is filled. The method improves specificity and sensitivity by means of a CRISPR-cas12a technology, and simultaneously omits the synthesis of an expensive fluorescent probe by preparing a cheap and universal AuNP-DNA solution, thereby developing a brand-new visual detection method with low cost.
By optimizing the reaction time, the liner DNA concentration and the like of the detection method, the ASGV detection method with low cost, strong specificity and high sensitivity is established. The detection cost of the method is 3 yuan/sample, which is far lower than that of other visual detection methods; in sensitivity, the method is 100 times higher than that of the common RT-PCR; in specificity, the target sequence can be accurately recognized by virtue of the CRISPR-cas12a-crRNA complex; at the reaction temperature, the method does not need an RT-PCR thermal denaturation process and any precise thermal cycler, and the reaction can be carried out at the constant temperature of 37 ℃ or even at the normal temperature; in terms of time, the linker DNA in the system can be completely cut within 30 min by utilizing the trans-cleavage activity of the Cas12a protein, so that the color of the AuNP-DNA complex solution is kept unchanged, and the detection time is shortened. Meanwhile, compared with RT-PCR, the method saves the steps of repeatedly screening the primers and the like, is simple and convenient to operate, and does not need professional operation. In conclusion, the CRISPR-Cas12 a-based nanogold colorimetric detection method is very suitable for rapid detection of a field sample, and is helpful for timely eradicating infected plants, so that the risk related to virus transmission is reduced to the maximum extent.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
<110> Henan university of agriculture
<120> apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof
<160> 6
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<221> misc_difference
<222> （1）…（30）
<400> 1
gtgttgcttg tagtattttt aaaaaaaaaa 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<221> misc_difference
<222> （1）…（30）
<400> 2
gtgtttagga tttgcttttt aaaaaaaaaa 30
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<221> misc_difference
<222> 46
<400> 3
tcctaaacac cacaacgaac 20
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> misc_difference
<222> 25
<400> 4
gaaattaata cgactcacta taggg 25
<210> 5
<211> 68
<212> DNA
<213> Artificial sequence
<220>
<221> misc_difference
<222> 68
<400> 5
gaggcaggtt cggaaagtaa cctgatctac aacagtagaa attccctata gtgagtcgta 60
ttaatttc 68
<210> 6
<211> 28
<212> DNA
<213>Virus（Virus）
<220>
<221> misc_difference
<222> 28
<400> 6
caggttactt tccgaacctg cctcgaaa 28
Claims (9)
1. Apple stem groove virus visual detection system based on CRISPR-Cas12a technology, which is characterized in that: the detection system comprises Cas12a protein, crRNA, Linker DNA, AuNP-DNA complex and NEBuffer 2.1.
2. the apple stem groove virus visual detection system based on CRISPR-Cas12a technology as claimed in claim 1, wherein the AuNP-DNA complex preparation method is as follows:
(1) Adding 2 mu L of 1 wt% Tween20 and 10 mu L of 4 mu M mPEG-SH into 200 mu L of 13 nm AuNP solution to obtain a mixed solution;
(2) adding 10 mu L of 100 mu M thiolated DNA1 into the mixed solution obtained in the step (1), adding 50 mu L of 4M NaCl, and aging at room temperature for 60 min to obtain a treatment solution;
(3) Centrifuging the treated solution in a centrifuge at 14000 rpm at 4 deg.C for 10min to remove supernatant to obtain precipitate;
(4) resuspending the pellet from step (3) with PBST solution, repeatedly centrifuging and resuspending for three times, and adding 200. mu.L PBST solution to obtain AuNP-DNA 1;
(5) Preparing AuNP-DNA2 with reference to steps (1) to (4);
(6) mu.L of each of AuNP-DNA1 and AuNP-DNA2 was mixed, and 2.8. mu.L of 4M NaCl solution was added to the mixture to obtain an AuNP-DNA complex for colorimetric detection.
3. the apple stem groove virus visual detection system based on CRISPR-Cas12a technology as claimed in claim 2, wherein: the mass concentration of the 13 nm AuNP solution in the step (1) is 0.1 mg/mL.
4. The apple stem groove virus visual detection system based on CRISPR-Cas12a technology as claimed in claim 2, wherein: in the step (2), the sequence of the DNA1 is shown as SEQ ID NO.1, and the sequence of the DNA2 is shown as SEQ ID NO. 2.
5. The apple stem groove virus visual detection system based on CRISPR-Cas12a technology as claimed in claim 1, wherein the preparation method of the crRNA is as follows: taking ASGV-T7-crRNA-F and ASGV-crRNA-R as primers, recovering products after PCR and carrying out reverse transcription to obtain crRNA; wherein the sequence of ASGV-T7-crRNA-F is shown in SEQ ID NO.4, and the sequence of ASGV-crRNA-R is shown in SEQ ID NO. 5.
6. The apple stem groove virus visual detection system based on CRISPR-Cas12a technology as claimed in claim 1, wherein: the Linker DNA sequence is shown in SEQ ID NO. 3.
7. The method for detecting an apple stem groove virus visual detection system according to any one of claims 1 to 6, characterized by comprising the following steps:
mixing Cas12a protein and crRNA, adding 14.5 mu of LNEBuffer 2.1, and pre-assembling by warm bath in a heating instrument at 37 ℃ for 5 min;
Secondly, adding linker DNA and a sample to be detected into the reaction tube in the step I, and carrying out warm bath on a heating instrument at 37 ℃ for 30 min;
③ taking 5 mu L of the trans-cutting product obtained in the step II, and adding the trans-cutting product into the AuNP-DNA compound solution;
Standing at room temperature for 10min, centrifuging for 1 min by a micro centrifuge, and observing the result, wherein the positive result is obtained when the color is kept red and the negative result is obtained when the color is pink.
8. The method according to claim 7, wherein the visual detection system for apple stem groove virus comprises: in the step (i), the concentration of the Cas12a protein is 1 muM, the dosage is 4 muL, and the concentration of the crRNA is 10 muM, the dosage is 0.5 muL.
9. The method according to claim 7, wherein the visual detection system for apple stem groove virus comprises: in the second step, the concentration of the linker DNA is 10 mu M, the dosage is 0.5 mu L, and the dosage of the sample to be detected is 0.5 mu L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910886954.XA CN110567951B (en) | 2019-09-19 | 2019-09-19 | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910886954.XA CN110567951B (en) | 2019-09-19 | 2019-09-19 | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110567951A true CN110567951A (en) | 2019-12-13 |
| CN110567951B CN110567951B (en) | 2020-06-02 |
Family
ID=68781075
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910886954.XA Active CN110567951B (en) | 2019-09-19 | 2019-09-19 | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110567951B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111187856A (en) * | 2020-02-13 | 2020-05-22 | 上海科技大学 | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof |
| CN111440892A (en) * | 2020-06-08 | 2020-07-24 | 河南农业大学 | Molecular marker closely linked with apple columnar tree gene and application |
| CN112226493A (en) * | 2020-09-23 | 2021-01-15 | 浙江大学 | Method for visual semi-quantitative detection of transgenic crop NOS terminator through CRISPR/Cas12a system |
| CN113025749A (en) * | 2021-02-01 | 2021-06-25 | 天津科技大学 | Visual virus detection method based on CRISPR-Cas12a system and application |
| CN113046450A (en) * | 2021-03-17 | 2021-06-29 | 河南农业大学 | Method for visual detection of phytoplasma based on CRISPR/Cas12a point cutting |
| CN113736853A (en) * | 2021-09-06 | 2021-12-03 | 吉林大学 | Surface-enhanced Raman spectroscopy detection method for gene based on CRISPR/Cas12a protein |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104513866A (en) * | 2014-11-25 | 2015-04-15 | 北京农学院 | Apple stem grooving virus and prunus necrotic ringspot ilarvirus detection specific primers and probes and gene chips |
| CN104561386A (en) * | 2015-02-02 | 2015-04-29 | 河北科技师范学院 | Real-time fluorescent quantitative PCR detection method for apple stem grooving virus |
| CN107794311A (en) * | 2017-11-01 | 2018-03-13 | 扬州大学 | A kind of kit and detection method that apple stem grooving virus is detected in lotus rhizome |
| CN110241266A (en) * | 2019-07-31 | 2019-09-17 | 河南农业大学 | A kind of RPA primer pair, probe and kit and application method detecting Apple stem ditch disease |
-
2019
- 2019-09-19 CN CN201910886954.XA patent/CN110567951B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104513866A (en) * | 2014-11-25 | 2015-04-15 | 北京农学院 | Apple stem grooving virus and prunus necrotic ringspot ilarvirus detection specific primers and probes and gene chips |
| CN104561386A (en) * | 2015-02-02 | 2015-04-29 | 河北科技师范学院 | Real-time fluorescent quantitative PCR detection method for apple stem grooving virus |
| CN107794311A (en) * | 2017-11-01 | 2018-03-13 | 扬州大学 | A kind of kit and detection method that apple stem grooving virus is detected in lotus rhizome |
| CN110241266A (en) * | 2019-07-31 | 2019-09-17 | 河南农业大学 | A kind of RPA primer pair, probe and kit and application method detecting Apple stem ditch disease |
Non-Patent Citations (3)
| Title |
|---|
| 张雨生: ""烟草抗赤星病主效QTL候选基因的初步筛选"", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 王鹏 等: ""利用Real-time RT-PCR方法检测苹果中苹果茎沟病毒"", 《植物保护》 * |
| 颜克如、毛碧增: ""植物病毒脱毒技术进展与展望"", 《分子植物育种》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111187856A (en) * | 2020-02-13 | 2020-05-22 | 上海科技大学 | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof |
| CN111440892A (en) * | 2020-06-08 | 2020-07-24 | 河南农业大学 | Molecular marker closely linked with apple columnar tree gene and application |
| CN112226493A (en) * | 2020-09-23 | 2021-01-15 | 浙江大学 | Method for visual semi-quantitative detection of transgenic crop NOS terminator through CRISPR/Cas12a system |
| CN113025749A (en) * | 2021-02-01 | 2021-06-25 | 天津科技大学 | Visual virus detection method based on CRISPR-Cas12a system and application |
| CN113046450A (en) * | 2021-03-17 | 2021-06-29 | 河南农业大学 | Method for visual detection of phytoplasma based on CRISPR/Cas12a point cutting |
| CN113046450B (en) * | 2021-03-17 | 2024-05-24 | 河南农业大学 | Method for visually detecting phytoplasma based on CRISPR/Cas12a point cutting |
| CN113736853A (en) * | 2021-09-06 | 2021-12-03 | 吉林大学 | Surface-enhanced Raman spectroscopy detection method for gene based on CRISPR/Cas12a protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110567951B (en) | 2020-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110567951B (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN108220475A (en) | Cherry ash arrhizus bacteria detection method and detection primer special based on RPA technologies | |
| CN114350828A (en) | Specific primer for amplifying Pantoea ananatis and application thereof | |
| JP6466725B2 (en) | Assisting identification of eel species | |
| CN111690759B (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN108624702A (en) | A kind of easy quickly discriminating birds property method for distinguishing | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| US11098380B2 (en) | Reagent and method for rapid detection of porcine adenovirus | |
| CN106957915B (en) | Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method | |
| CN113481310B (en) | LAMP primer group and LAMP kit for detecting ginger rot pathogen and application of LAMP primer group and LAMP kit | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| CN112852980B (en) | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof | |
| CN111996274B (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN112280890A (en) | Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof | |
| CN101220390B (en) | Method for rapidly extracting plants sample DNA | |
| CN113151599A (en) | Primer group, reagent, kit and detection method for detecting novel coronavirus | |
| CN112359098A (en) | Method for detecting content of herbicide-tolerant transgenic soybean J12 by real-time fluorescence quantitative PCR | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN111944919B (en) | Banana fusarium wilt tropical No.4 small species visual detection technology system capable of being operated in field and at normal temperature | |
| CN113493846B (en) | Citrus flavedo virus molecular fluorescence RAA detection primer probe set, kit and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |