CN112852980B - Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof - Google Patents
Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof Download PDFInfo
- Publication number
- CN112852980B CN112852980B CN202110442351.8A CN202110442351A CN112852980B CN 112852980 B CN112852980 B CN 112852980B CN 202110442351 A CN202110442351 A CN 202110442351A CN 112852980 B CN112852980 B CN 112852980B
- Authority
- CN
- China
- Prior art keywords
- crispr
- detection
- nucleic acid
- atlantic salmon
- fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection kit for detecting Atlantic salmon nucleic acid based on a CRISPR fluorescence method, which comprises a CRISPR fluorescence detection system suitable for rapid nucleic acid detection of Atlantic salmon, wherein the CRISPR fluorescence detection system comprises: specific crRNA aiming at the Atlantic salmon mitochondrial target sequence, high-efficiency isothermal amplification primer combination, CRISPR protein and ssDNA report system. The invention also discloses a rapid detection method for detecting the Atlantic salmon nucleic acid based on the CRISPR fluorescence method, which is to detect by adopting the detection kit for detecting the Atlantic salmon nucleic acid based on the CRISPR fluorescence method. The detection kit can utilize fluorescence detection of an enzyme-labeling instrument and can also utilize fluorescence detection by naked eyes, and has good sensitivity and specificity.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a detection method for detecting nucleic acid of Atlantic salmon based on a CRISPR fluorescence method and a detection kit thereof.
Background
The salmon cultivation capacity in China is insufficient, the number of real high-quality salmon is limited, the price is high, the demand is large, and a large amount of salmon depends on import, so that a plurality of merchants and enterprises can stare at the salmon which is fat meat and play a game of 'stealing and changing concepts' with consumers. The Salmon (in particular to Atlantic Salmon, Salmon salar) is a cold water fish in the true sense, is suitable for living in water at 16-18 ℃, has very high requirement on water quality, and can cause death by carelessness in culture. For cost reasons, the selling price is always high. The major physical replacement species for Atlantic salmon is rainbow trout (Oncorhynchus mykiss), a fish of the Salmonidae genus Atlantic salmon (Pacific salmon), known under the English name rainbowwn trout. Native to north america and the pacific west, most populations live in low temperature freshwater environments for life. The upper and lower jaws of the male fish in the reproductive period become curved, and the rainbow pink longitudinal bands of the body side from the cheek part to the tail part are more gorgeous, and the name of the rainbow trout is also derived from the curvature. The physical properties of sliced raw rainbow trout and Atlantic salmon are very similar and are difficult to distinguish by common people from the appearance.
At present, salmon consumption in China enters a freeway, the market demand scale of salmon in China is close to 90 billion yuan by 2018, the market demand is unprecedentedly huge, and the species identification methods or kits for Atlantic salmon and rainbow trout are not distinguished by the current standard in China, so that serious technical faults are caused. The technical fault ensures that related food is safe, and the market supervision and supervision department cannot take the basis of the current effective detection technology when meeting the identification requirement of the species of the related products of Atlantic salmon or rainbow trout. In the face of sudden public sentiment, huge market demand and price difference, the lack of related detection technologies will inevitably generate serious food safety supervision loopholes. It is a major challenge to the industry how to perform biological monitoring on related animal-derived products by using technical means. Therefore, the species identification of the Atlantic salmon and products thereof by establishing an accurate, rapid and high-sensitivity Atlantic salmon specific detection technical system is urgently needed.
At present, the identification technology for fish species mainly depends on the traditional morphological identification technology, protein electrophoresis, real-time fluorescence quantitative detection technology and amplicon sequencing and DNA barcode detection-based technology. The morphological identification technique relies on the long-term research accumulation of professionals and can rapidly distinguish species, but the identification depends heavily on complete characteristic morphology, and the identification cannot be completed for related products, particularly processed samples, such as canned foods, meat, blood and other samples without morphological characteristics. Protein-related assays also fail to detect and identify samples that have been heated to denature proteins. While molecular biology methods based on DNA show significant detection advantages. However, both the fluorescence quantitative PCR technology and the sequencing and DNA barcode detection technology based on amplicons rely heavily on high-level molecular biology laboratories and relatively large instruments and equipment, and have the disadvantages of high detection cost and long detection period, which cannot meet the actual scene requirements of rapid field detection.
CRISPR-Cas (Clustered regulated short palindromic repeats, CRISPRs) is an adaptive immune system in bacteria, and Cas proteins target degradation of foreign nucleic acids through RNA-guided nucleases. Wherein, CRISPR-CRISPR belongs to Cas enzyme second family and is used for guiding RNA to guide double-stranded DNA to crack single RuvC catalytic structural domain. CRISPR enzymes recognize a Thymine (T) nucleotide rich spacer adjacent motif (PAM), catalyze their own directed CRISPR RNA (crRNA) maturation, and specifically recognize and cleave complementary paired double-stranded dna (dsdna). Strong non-specific single-stranded DNA (ssdna) trans-cleavage activity can be induced when the CRISPR-CRISPR protein recognizes cleavage of a target double-stranded DNA in a sequence-specific manner.
Disclosure of Invention
The invention aims to solve the problem of species specificity on-site rapid detection and identification of Atlantic salmon, and provides a CRISPR fluorescence visual kit for detecting Atlantic salmon specificity rapid nucleic acid, which has high sensitivity, strong specificity and rapid visualization, and a detection method thereof. Therefore, the invention develops a rapid and accurate detection method based on the characteristics of CRISPR, and the method is used for detecting the specific target sequence of Atlantic salmon. First, the sample is nucleic acid released and enriched and simultaneously Recombinase Polymerase Amplification (RPA) and CRISPR-crRNA complex binding and cleavage of the target dsDNA under isothermal conditions, which activates trans-cleavage of ssDNA, with fluorescent reporter molecules coupled to the ssDNA generating a fluorescent signal upon cleavage. The novel method called DNA endonuclease targeting CRISPR trans-reporter gene provides a powerful platform for quickly and accurately detecting the Atlantic salmon specific nucleic acid. Therefore, the first purpose of the invention is to provide a detection kit for detecting nucleic acid of Atlantic salmon based on a CRISPR fluorescence method. The second purpose of the invention is to provide a rapid detection method for detecting nucleic acid of Atlantic salmon based on a CRISPR fluorescence method.
In order to achieve the purpose, the invention adopts the following technical scheme:
as a first aspect of the present invention, a detection kit for detecting an atlantic salmon nucleic acid based on CRISPR fluorescence method, comprising a CRISPR fluorescent detection system suitable for rapid nucleic acid detection of atlantic salmon, the CRISPR fluorescent detection system comprising: specific crRNA for a target sequence on the mitochondrial gene of Atlantic salmon, a high-efficiency isothermal amplification primer combination, CRISPR protein, and a single-stranded DNA (ssDNA) reporter system.
According to the invention, the specific crRNA is obtained by screening 12 crRNAs designed aiming at the Atlantic salmon mitochondrial gene, and the sequence of S158-cr1 is shown as SEQ ID NO: 2, respectively.
According to the invention, the high-efficiency isothermal amplification primer combination is a primer combination which is selected after screening and has a sequence shown as SEQ ID NO: 1, the sequences of amplification primers S158-RPA-F2 and S158-RPA-R3 at the positions of the Atlantic salmon mitochondrial gene 9439-9840 and the sequences of the amplification primers S158-RPA-F2 and S158-RPA-R3 are respectively shown as SEQ ID NO: 13 and SEQ ID NO: shown at 17.
According to the invention, the ssDNA reporter system comprises a ssDNA FQ reporter which can be detected by a microplate reader in a fluorescent manner or directly read by naked eyes under a fluorescent lamp, and the sequence is shown as SEQ ID NO: 18, respectively.
As a second aspect of the invention, the rapid detection method for detecting the nucleic acid of the Atlantic salmon based on the CRISPR fluorescence method is used for detecting the nucleic acid of the Atlantic salmon by adopting the detection kit for detecting the nucleic acid of the Atlantic salmon based on the CRISPR fluorescence method.
According to the invention, the rapid detection method for detecting the nucleic acid of the Atlantic salmon based on the CRISPR fluorescence method comprises the following steps:
step a: taking a meat sample to be detected with the diameter of about 10mm by using a sampler, and shearing the meat sample to a sample tube;
step b: releasing nucleic acid from leukocytes using a rapid nucleic acid releasing agent;
step c: amplifying nucleic acid in a sample to be detected by using an isothermal amplification primer: and c, mixing the product obtained in the step b and a polypeptide with the sequence shown in SEQ ID NO: 13 and SEQ ID NO: 17, adding the high-efficiency isothermal amplification primer combination shown in the specification into an RPA isothermal amplification system, and reacting for 10min at 37 ℃ to obtain a specific product;
step d: when the CRISPR detection system is used for recognizing and cutting the Atlantic salmon specific nucleic acid fragments: adding the specific product in the step c into a CRISPR detection system, and reacting for 10min at 37 ℃;
step e: and directly detecting and interpreting whether the Atlantic salmon specific nucleic acid exists in the sample to be detected by utilizing a fluorescent microplate reader or a fluorescent lamp.
As a third aspect of the present invention, a specific crRNA for a target sequence on the mitochondrial gene of atlantic salmon has a sequence shown in SEQ ID NO: 2, respectively.
The detection kit for detecting the nucleic acid of the Atlantic salmon based on the CRISPR fluorescence method has the beneficial effects that: the fluorescence detection can be carried out by using an enzyme-labeling instrument, and the fluorescence can also be used for naked eye detection, so that the kit has good sensitivity and specificity.
The quick detection method for detecting the nucleic acid of the Atlantic salmon based on the CRISPR fluorescence method has the beneficial effects that:
1. the method for specifically detecting the Atlantic salmon by using the CRISPR fluorescence method for the first time has the advantages of higher sensitivity, strong specificity, short time, low operation difficulty, no dependence on large-scale experimental instruments and expensive reagents and the like, and the detection result can be directly interpreted by naked eyes under a fluorescent lamp.
2. A CRISPR reaction system and specific crRNA for detecting specific nucleic acid of Atlantic salmon are disclosed, which can be used to quickly detect and identify the components of animal origin.
Drawings
Fig. 1 is a schematic diagram of the rapid detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method.
FIG. 2 shows the detection specificity and effectiveness of crRNA;
FIG. 3 screening PRA high efficiency amplification primers;
FIG. 4 CRISPR fluorescence detection Atlantic salmon sensitivity assay;
FIG. 5 fluorescent detection CRISPR rapid detection of Atlantic salmon specificity and other species specificity;
FIG. 6 direct visual detection of CRISPR for rapid detection of Atlantic salmon specificity;
FIG. 7 shows the results of fluorescence detection of a nucleic acid sample from Atlantic salmon sampled at the site;
FIG. 8 direct visual examination of a sample of Atlantic salmon nucleic acid sampled in situ.
Detailed Description
The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not specified, in the following examples are generally conducted under conventional conditions, or under conditions provided by the manufacturers.
In the invention: the RPA amplification kit Twistampp Basic kit is purchased from Twistampp company; conventional reagents such as Tris-Base, NaCl, Tris-HCl, MgCl2BSA and glycerol, etc. were purchased from Thermo Fisher; the nucleic acid fragment for detection, the ssDNA probe and the RNA synthesis were completed by Nanjing Kinsley; the invention uses a rapid nucleic acid releasing agent of the expressed gene to obtain the pretreatedA nucleic acid.
The ssDNA FQ reporter which can be detected by a microplate reader or directly read by naked eyes under a fluorescent lamp is ssDNA marked by 6-carboxyfluorescein (6-FAM) and a fluorescence quencher (BHQ1), and the marked products are as follows: (SEQ ID NO: 18)/5 '6 FAM/TTTATTT/3' BHQ1, designated ssDNA FQ reporter. When the fluorescence detection of a microplate reader is used, setting the detection exciting light to be 485 nm-520 nm; when the direct detection is carried out by naked eyes, a light emitter capable of generating a 485nm wavelength light source is selected for detection.
When using fluorescence detection, the presence of an Atlantic salmon-specific nucleic acid in the CRISPR detection system results in the specific activation of the endonuclease activity of the CRISPR protein mediated by an Atlantic salmon-specific crRNA. The activated CRISPR protein can cut ssDNA FQ reporter marked by a fluorescent group and a quenching group, so that the activated fluorescent group is released, and a fluorescence reading or a green reaction visible to the naked eye can be detected by using a microplate reader. Correspondingly, when the Atlantic salmon nucleic acid does not exist in the sample to be detected, no fluorescence reading or no fluorescence reaction can be seen by naked eyes.
The genetic bioinformatics analysis of the invention designs specific detection crRNA aiming at Atlantic salmon by using the Atlantic salmon mitochondrial gene sequence and the Salmonidae species sequence in the NCBI database. To ensure detection specificity, it was determined that there was no high homology match between the designed crRNA sequence and the mitochondrial genes of the NCBI nucleic acid database including species of mammals, freshwater marine fish, birds, plants, and microorganisms. According to the characteristics of CRISPR (clustered regularly interspaced short palindromic repeats) for recognizing a specific PAM (pulse amplitude modulation) sequence, 9 pieces of specific crRNA are designed on a mitochondrial gene target sequence. S158-cr1 is screened by detection, and the sequence is SEQ ID NO: 2, the method can specifically recognize the mitochondrial gene of Atlantic salmon and can accurately and efficiently complete detection.
The general technical schematic diagram of the invention is shown in the attached figure 1, and comprises the following 3 parts: preparing a nucleic acid sample to be detected, detecting CRISPR and detecting fluorescence.
Example 1 screening of specific crRNA against Atlantic salmon
1.1 nucleic acid preparation
In this example, the Atlantic salmon-specific mitochondrial-specific target gene fragment was designed with reference to the NCBI sequence Atlantic salmon mitochondrial DNA (Salmo salar mitochondrial DNA, GenBank: LC 012541.1), synthesized by Nanjing Kinsry, and designated S158, SEQ ID NO: 1.
ccacatggttgacccaagcccctgacccctaactggcgcaattgctgcccttctacttacatcaggcactgcagtctgatttcacttccactcacttacgctactaaccataggaaatattttattacttctcaccatatatcaatgatgacgagacattatccgagaaggcaccttccaagggcaccacacacctccagtccaaaaaggactacgctatggaataatct，（SEQ ID NO：1）。
1.2 preparation of a mitochondrial Gene-specific crRNA for Atlantic salmon
Preparation of mitochondrial-specific crRNA for atlantic salmon was performed according to the following protocol: the sequence is shown as SEQ ID NO: 1, searching a targeting sequence containing a CRISPR recognition sequence (PAM) TTTN, and designing a crRNA with the length of 23 bp. Named as S158-cr1, S158-cr2, S158-cr3, S158-cr4, S158-cr5, S158-cr6, S158-cr7 and S158-cr8, and the sequences are respectively SEQ ID NO: 2-SEQ ID NO: 9. after the design is finished, the cell is handed to Nanjing Kinshire company to directly synthesize RNA corresponding to the crRNA sequence.
The specific sequence information of crRNA of the Atlantic salmon mitochondrial specific gene provided by the present invention is shown in Table 1.
TABLE 1 Atlantic salmon-specific nucleic acid-specific crRNA
1.3 screening for specific crRNA
The corresponding nucleic acid products Atlantic salmon S158 and rainbow trout O158 fragments were obtained by PCR amplification of Atlantic salmon and rainbow trout nucleic acid samples using PCR primers (SEQ ID NO: 10 and SEQ ID NO: 11, see Table 2), and PCR products purified by AxyPrep PCR Clean-up Kit (Axygen, Calif., USA) were applied with ddH2And adjusting the O dilution to 1 × e10 copy/μ L, and taking 1 μ L as a detection sample to carry out CRISPR fluorescence detection reaction.
TABLE 2 PCR primer sequences
1.4 in this case, the Atlantic salmon CRISPR assay is shown in Table 3 using a 20. mu.L system, but is not limited thereto, and includes the adjustment of the ratio of the respective components.
TABLE 3 Atlantic salmon CRISPR assay System
For each crRNA, the detection samples were designed to be S158, O158 and ddH, respectively2O, to detect and compare cross-reactivity, sensitivity, and background signals. The mixed system was left to react at 37 ℃ for 20 min.
1.5 full-wavelength ELIASA fluorescence detection
And (4) carrying out fluorescence detection on the reacted product by using a full-wavelength microplate reader. Wherein the excitation wavelength is 485nm, the emission wavelength is 520 nm, and the fluorescence value of the reaction at 37 ℃ for 10min is read and detected. The results of the reaction measurements are shown in FIG. 2.
The result shows that the specificity and the sensitivity of the detection of S158-cr1 are good, so that S158-cr1 is selected as the detection of crRNA.
Example 2 screening of RPA primers for high Performance isothermal amplification
2.1 RPA primer design and Synthesis
The invention utilizes isothermal amplification technology to pre-amplify the Atlantic salmon detection target region for subsequent CRISPR fluorescence detection reaction. According to the design requirement of isothermal amplification primers, 3 upstream primers and 3 downstream primers are designed, and the sequences are SEQ ID NO: 12 to SEQ ID NO: 17 (see table 4) were directly synthesized by the company jinsley, tokyo. The upstream primer and the downstream primer are matched in pairs, and the most efficient primer combination is screened out.
2.2 RPA isothermal amplification reaction
(1) Construction of Atlantic salmon mimic plasmid: vector PUC57 and the sequence shown in SEQ ID NO: 1 is obtained by carrying out the whole gene synthesis of the specific mitochondrial gene of the Atlantic salmon.
(2) And (3) screening an RPA amplification primer by using the Atlantic salmon mimic plasmid as a template. Copy number was calculated from plasmid size and molecular weight and plasmid samples were diluted in a 10-fold gradient to obtain samples containing 1 × e4 copies per microliter. The specific operation steps are as follows: uniformly mixing 2.5 mu L S158-RPA-F, 2.5 mu L S158-RPA-R, 1 mu L simulation plasmid sample and 42 mu L reaction buffer solution in a reaction tube, finally adding 2 mu L activator and uniformly mixing, and reacting at 37 ℃ for 10min to obtain an RPA amplification reaction product. The reaction product can be directly used for the next detection.
TABLE 4 nucleic acid specific RPA primer sequences for Atlantic salmon
2.3 CRISPR fluorescent detection reaction
According to the invention, a 20 muL detection system is adopted, the components are shown in Table 3, wherein a sample is a reaction product of 2.2 of example 2, and 5 muL is adopted for detection. The fluorescence detection result of the full-wavelength microplate reader is shown in FIG. 3.
The results showed that the amplification efficiency of the combination of the S158-RPA-F2 and S158-RPA-R3 primers was the best, and therefore S158-RPA-F2 and S158-RPA-R3 were selected as primers for the subsequent sample amplification.
Example 3 detection of Atlantic salmon-specific nucleic acids with high sensitivity based on CRISPR fluorescence
In this case, in order to determine the detection sensitivity of CRISPR fluorescence method for nucleic acid specific to Atlantic salmon, the following detection was performed.
First, the molecular weight of the test fragment was calculated from DNA samples corresponding to mitochondrial gene fragments of atlantic salmon, and 10-fold gradient dilution was performed to obtain test samples containing copy numbers (copy/μ L) of 2 × e7, 2 × e6, 2 × e5, 2 × e4, 2 × e3, 2 × e2, 2 × e1, and 2 × e0 per microliter. Quantitative detection was performed using digital PRC.
The diluted samples were subjected to CRISPR-specific reaction using fluorescence, detection and interpretation of fluorescence results according to the detection procedure in example 1. The operation is briefly described as follows: the sample was diluted in 2. mu.L gradient and added to 50. mu.L of the RPA isothermal amplification reaction system for amplification. And adding 10 mu L of isothermal amplification product into a 20 mu L of CRISPR fluorescent nucleic acid detection system, uniformly mixing, and reacting at 37 ℃ for 10min to judge the fluorescence result.
In this case, the CRISPR fluorescence method was used to detect the specificity of the atlantic salmon, and the detection by the microplate reader (fig. 4) allowed high sensitivity detection of 2 copies.
Example 4 highly specific detection of Atlantic salmon nucleic acid based on CRISPR fluorescence method
In this embodiment, in order to determine whether the CRISPR fluorescence method can perform a highly specific reaction on the atlantic salmon and can effectively distinguish mitochondrial nucleic acids of mammals, birds, freshwater fishes, marine fishes and various salmonidae fishes, the following determination was performed.
First, genetic information of representative species of various freshwater marine fishes and salmonidae fishes is collected and analyzed using a sequencing technique, and a nucleic acid sample library is established on the basis of the data.
Second, referring to example 1, samples of Atlantic salmon and other species were prepared by RPA amplification, respectively.
In the fluorescence detection, 2 muL of Buffer, 1 muL of RNase Inhibitors, 1 muL of CRISPR, 1 muL of ssDNA FQ reporter, 1 muL of crRNA and 10 muL of detection sample are sequentially added into a CRISPR detection system. The components are mixed evenly and reacted for 10min at 37 ℃. In the detection system, the concentration of RNase Inhibitors is 40U/muL, the concentration of CRISPR is 200 ng/muL, the concentration of ssDNA DB reporter is 25 pM/muL, and the concentration of crRNA is 1 nM/muL.
In this embodiment, the detection activity of the CRISPR detection system is determined by fluorescence detection. And (3) measuring the fluorescence of the detection reaction by using a full-wavelength microplate reader, wherein the excitation wavelength is 485nm, the emission wavelength is 520 nm, and the fluorescence value at the time of detection for 10min is taken as the reaction value. The detection results are shown in FIG. 5. The CRISPR fluorescence method can detect the Atlantic salmon nucleic acid with high specificity and has no reaction to other species nucleic acids.
Fluorescence shows direct interpretation by naked eyes. Meanwhile, the product obtained after the CRISPR detection reaction is carried out for 10min is placed under a 485nm laser lamp, and the result can be directly interpreted by naked eyes. When the crRNA specifically recognizes the target nucleic acid fragment, the color of the reaction product changes from colorless to fluorescent green; correspondingly, if no corresponding target nucleic acid is to be detected, the color of the reaction product remains uncolored. After the CRISPR detection reaction is carried out for 10min, the macroscopic interpretation is carried out under fluorescence, and the photographic record is carried out. As shown in FIG. 3, the detection system can efficiently and specifically carry out rapid visual detection on the Atlantic salmon detection target sequence.
In the embodiment, after the CRISPR detection system reacts for 5 min, the fluorescence reaction of the detection product can be interpreted by naked eyes under a 485nm laser lamp. The detection result is shown in FIG. 6, and the CRISPR fluorescence method can detect the Atlantic salmon nucleic acid with high specificity and has no response to other species.
Example 5 quick field detection of Atlantic salmon samples by CRISPR fluorescence
This embodiment relates to the rapid detection of a field Atlantic salmon tissue sample.
In this case, first, field (refrigerated container, port checkpoint, dish market, etc.) sample collection is performed. Then the sample is subjected to nucleic acid release treatment by using a rapid nucleic acid release kit. This example uses a rapid nucleic acid release agent from suzhou sudao gene corporation to obtain pre-treated nucleic acid. The method comprises the following steps: adding about 20mg of fish samples into 150 mul of 20mg solid samples, carrying out water bath at 65 ℃ for 1 minute, shaking briefly and slightly to mix uniformly, and taking lysates to directly carry out constant temperature amplification. In CRISPR detection, 5 μ L of each sample to be detected was taken for RPA pre-amplification, the procedure was the same as in example 1, and a CRISPR detection sample was obtained.
In a CRISPR detection system, 2 mu L of Buffer, 1 mu L of RNase Inhibitors, 1 mu L of CRISPR, 1 mu L of ssDNA FQ reporter, 10 mu L of RPA sample and 1 mu L of crRNA are sequentially added. The components are mixed evenly and reacted for 10min at 37 ℃.
In the embodiment, the CRISPR detection result can be directly judged by naked eyes under a microplate reader or a fluorescent lamp. As shown in FIG. 7, the CRISPR fluorescence method can be used for effectively and rapidly judging the Atlantic salmon component in the animal products collected on site by detecting the components through a microplate reader. Similarly, the rapid determination of the content of Atlantic salmon in animal products was effectively carried out visually under fluorescent light (FIG. 8).
The foregoing is merely an example of the embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Shanghai customs animal and plant and food inspection and quarantine technology center
<120> detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof
<130> 211024
<141> 2021-03-17
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 253
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggcacacc aagcacacgc ataccacatg gttgacccaa gcccctgacc cctaactggc 60
gcaattgctg cccttctact tacatcaggc actgcagtct gatttcactt ccactcactt 120
acgctactaa ccataggaaa tattttatta cttctcacca tatatcaatg atgacgagac 180
attatccgag aaggcacctt ccaagggcac cacacacctc cagtccaaaa aggactacgc 240
tatggaataa tct 253
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tttcacttcc actcacttac gctacta 27
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tttcctatgg ttagtagcgt aagtgag 27
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttttattact tctcaccata tatcaat 27
<210> 5
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tttattactt ctcaccatat atcaatg 27
<210> 6
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tttggactgg aggtgtgtgg tgccctt 27
<210> 7
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttttggactg gaggtgtgtg gtgccct 27
<210> 8
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tttttggact ggaggtgtgt ggtgccc 27
<210> 9
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tttattacct ccgaagtatt ctttttc 27
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atggcacacc aagcacacgc ata 23
<210> 11
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
agattattcc atagcgtagt cc 22
<210> 12
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
acgcatacca catggttgac ccaagcccct ga 32
<210> 13
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ataccacatg gttgacccaa gcccctgacc ccta 34
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
atggttgacc caagcccctg acccctaact 30
<210> 15
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
actggaggtg tgtggtgccc ttggaaggtg cc 32
<210> 16
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
atagcgtagt cctttttgga ctggaggtgt gt 32
<210> 17
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
cttggaaggt gccttctcgg ataatgtctc gtc 33
<210> 18
<211> 7
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tttattt 7
Claims (5)
1. A detection kit for detecting Atlantic salmon nucleic acid based on a CRISPR fluorescence method, which is characterized by comprising an RPA isothermal amplification primer combination and a CRISPR fluorescence detection system for rapid nucleic acid detection of Atlantic salmon, wherein the CRISPR fluorescence detection system comprises: specific crRNA, CRISPR-Cas12a protein and ssDNA reporter system for Atlantic salmon mitochondrial target sequence,
the sequence of the specific crRNA is shown as SEQ ID NO: as shown in figure 2, the first and second,
the sequences of the RPA isothermal amplification primer combination are respectively shown as SEQ ID NO: 13 and SEQ ID NO: shown at 17.
2. The detection kit for detecting Atlantic salmon nucleic acid based on CRISPR fluorescence method according to claim 1, wherein the ssDNA reporter system comprises a ssDNA FQ reporter which can be detected by a microplate reader in fluorescence or can be directly read by naked eyes under a fluorescent lamp, and the sequence of the ssDNA FQ reporter is shown as SEQ ID NO: 18, respectively.
3. A rapid detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence, which comprises carrying out detection using the detection kit for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence according to any one of claims 1 to 2.
4. The rapid detection method according to claim 3, comprising the steps of:
step a: releasing nucleic acid from the cell using a rapid nucleic acid releasing agent;
step b: amplifying nucleic acid in a sample to be detected by using an isothermal amplification primer: and c, mixing the nucleic acid obtained in the step a and the nucleic acid with the sequence shown as SEQ ID NO: 13 and SEQ ID NO: 17 adding the RPA isothermal amplification primer combination shown in the specification into an RPA isothermal amplification system for RPA isothermal amplification, and reacting at 37 ℃ for 10min to obtain a specific product;
step c: recognizing and cutting the nucleic acid fragment specific to the Atlantic salmon by using a CRISPR detection system: adding the specific product obtained in the step b into a CRISPR detection system, and reacting for 10min at 37 ℃; wherein, the CRISPR detection system comprises CRISPR-Cas12a, ssDNA FQ reporter and crRNA;
step d: and directly detecting and interpreting whether the Atlantic salmon specific nucleic acid exists in the sample to be detected by utilizing a fluorescent microplate reader or a fluorescent lamp.
5. A specific crRNA for a target sequence on a mitochondrial gene of Atlantic salmon, wherein the sequence of the specific crRNA is as shown in SEQ ID NO: 2, respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110442351.8A CN112852980B (en) | 2021-04-23 | 2021-04-23 | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110442351.8A CN112852980B (en) | 2021-04-23 | 2021-04-23 | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112852980A CN112852980A (en) | 2021-05-28 |
| CN112852980B true CN112852980B (en) | 2021-11-26 |
Family
ID=75992727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110442351.8A Active CN112852980B (en) | 2021-04-23 | 2021-04-23 | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112852980B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113358633B (en) * | 2021-06-25 | 2022-07-22 | 中国海洋大学 | Tracing technology for salmonidae fishes from seawater and fresh water |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
| WO2018111946A1 (en) * | 2016-12-12 | 2018-06-21 | Integrated Dna Technologies, Inc. | Genome editing detection |
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
| CN111635948A (en) * | 2020-06-05 | 2020-09-08 | 江苏海洋大学 | Atlantic salmon specific forward and reverse primers, probe, detection kit and application thereof |
-
2021
- 2021-04-23 CN CN202110442351.8A patent/CN112852980B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
| WO2018111946A1 (en) * | 2016-12-12 | 2018-06-21 | Integrated Dna Technologies, Inc. | Genome editing detection |
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
| CN111635948A (en) * | 2020-06-05 | 2020-09-08 | 江苏海洋大学 | Atlantic salmon specific forward and reverse primers, probe, detection kit and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| DNA技术在海洋食品物种鉴定中的应用;张丽等;《遗传》;20100630;第32卷(第6期);第555-560页 * |
| The application of CRISPR-Cas for single species identification from environmental DNA;Molly-Ann Williams et al.;《Molecular Ecology Resources》;20191231;第19卷;第1107页第2节，第1110页第3.3至第1111页第3.5节，表S4，图2-4 * |
| The complete mitochondrial DNA sequence of the Atlantic salmon,Salmo salar;Carolyn D.Hurst et al.;《Gene》;19991231;第239卷;第237-242页 * |
| 成簇的规律间隔的短回文重复序列（CRISPR）介导的基因组编辑技术研究进展;单琳琳等;《细胞与分子免疫学杂志》;20181231;第34卷(第9期);第856-862页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112852980A (en) | 2021-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111187856B (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| Quinteiro et al. | Use of mtDNA direct polymerase chain reaction (PCR) sequencing and PCR− restriction fragment length polymorphism methodologies in species identification of canned tuna | |
| JP7565643B2 (en) | Nucleic acid detection kit, method and application thereof | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| CN110567951B (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN101974524B (en) | Primer, probe, kit and method used for authenticating truth of spotted deer antler | |
| CN111187862A (en) | Recombinase-based micropterus salmoides rhabdovirus isothermal amplification detection kit | |
| CN107475458A (en) | Goose astrovirus ring mediated isothermal amplification detection primer group and kit | |
| CN110616272A (en) | Primer group for detecting prawn enterocytozoon hepatica and kit containing primer group | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| CN105176989A (en) | Primers and method for identifying takifugu obscurus fry and takifugu xanthopterus fry | |
| CN112852980B (en) | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof | |
| CN116479094A (en) | Method for simultaneously detecting drug-resistant bacteria by double targets based on Pfago combined LAMP amplification one-tube method and application | |
| CN107227377B (en) | RPA-IAC primer and method for detecting vibrio vulnificus | |
| CN110607376B (en) | Patinopecten yessoensis living body sex identification method based on DNA molecular marker | |
| CN115058522B (en) | Molecular marker for identifying broiler breeds containing white roc blood margin and application thereof | |
| CN107385057B (en) | RPA-IAC primer and method for detecting vibrio cholerae | |
| CN116479093A (en) | Rhinoceros nucleic acid rapid detection method and detection kit based on CRISPR fluorescence method | |
| CN106868185A (en) | A kind of specific primer group and its application for detecting rat derived component | |
| CN111621576B (en) | RPA primer and probe for detecting oil fish and detection method | |
| CN116024361B (en) | Primer and kit for detecting pathogenic vibrio of prawn glass seedlings | |
| CN111793696B (en) | RPA primer, probe and detection method for detecting bare-cover fish | |
| CN116064868B (en) | Method for detecting aquatic pathogenic vibrio splendidus | |
| CN117535428A (en) | Rapid detection method and kit for tiger-derived component nucleic acid based on RPA-CRISPR-fluorescence method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20211112 Address after: 200135 No. 1208, Minsheng Road, Pudong New Area, Shanghai Applicant after: Shanghai Customs animal, plant and food inspection and Quarantine Technology Center Applicant after: Shanghai University of science and technology Address before: 200135 No. 1208, Minsheng Road, Pudong New Area, Shanghai Applicant before: Shanghai Customs animal, plant and food inspection and Quarantine Technology Center |
|
| TA01 | Transfer of patent application right |