CN115094060A

CN115094060A - Kit and method for visual detection of PCV2 nucleic acid based on LAMP-CRISPR/Cas12a

Info

Publication number: CN115094060A
Application number: CN202210727672.7A
Authority: CN
Inventors: 王爱兵; 谭磊; 廖帆; 雷磊; 段德勇; 杨毅; 湛洋; 王乃东; 雷红宇; 邓治邦; 王玉格; 胡意
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2022-06-23
Filing date: 2022-06-23
Publication date: 2022-09-23

Abstract

A kit for visual detection of PCV2 nucleic acid based on LAMP-CRISPR/Cas12a comprises a CRPSPR-Cas12 detection system and LAMP amplification primers, and is a method for visual detection of porcine circovirus type 2 nucleic acid established by combining an LAMP detection method and a CRPSPR-Cas12 detection method. The detection method has the advantages of excellent specificity, sensitivity and repeatability, simple and convenient operation, no need of expensive instruments and equipment, visualization advantage, popularization and application of the detection method to pig farms and detection units, and contribution to realizing rapid diagnosis of porcine circovirus type 2 related diseases.

Description

Kit and method for visual detection of PCV2 nucleic acid based on LAMP-CRISPR/Cas12a

Technical Field

The invention belongs to the technical field of biology, relates to detection of porcine circovirus type 2, and particularly relates to a kit and a method for realizing rapid visual detection of porcine circovirus type 2 nucleic acid by combining a LAMP detection method and a CRPSPR-Cas12 detection method.

Background

Porcine circovirus type 2 (PCV 2) is the leading cause of diseases such as postweaning multisystemic wasting syndrome, porcine respiratory disease syndrome, porcine dermatitis and nephrotic syndrome. PCV2 infection can inhibit the immune system of live pigs, so that PCV2 is mixed with other pathogens, and the clinical characteristics caused by mixed infection are greatly different, thereby causing the difficulty in clinical diagnosis of PCV2 and causing great economic loss to the pig industry. The rapid, accurate and timely early diagnosis is particularly important for the prevention and control of PCV2, but the traditional detection method not only needs expensive instruments and equipment, but also is complex, needs operation of professionals, cannot realize visual detection, and is not beneficial to pathogen field diagnosis. Therefore, establishing a detection method suitable for in situ diagnosis of PCV2 nucleic acid would be beneficial for the prevention and control of the disease.

Short Palindromic Repeats (CRISPR) with regularly Clustered spacers are composed of a series of repeated DNA sequences and spacer sequences, and form a CRISPR/Cas system with CRISPR associated proteins (Cas), which are widely present in archaea and many bacteria and are an important immune mechanism for prokaryotes to invade foreign nucleic acids. Recent research shows that the CRISPR/Cas system is not only widely applied to gene editing, but also can be used as a novel method for nucleic acid detection, and has strong applicability in the aspect of pathogen detection. At present, a plurality of Cas proteins can effectively cleave a target gene sequence under the guidance of sgRNA, wherein the Cas12a protein also has excellent target gene sequence specific recognition capability and efficient trans-cleavage activity. Therefore, specific detection of target single-stranded DNA can be achieved by utilizing the property that Cas12a protein is targeted for activation. The existing rapid nucleic acid detection methods comprise a loop-mediated isothermal amplification (LAMP) method, a Recombinase Polymerase Amplification (RPA) method and the like, and the methods need expensive instruments or special isothermal instruments, and false positive is easily caused in the high-speed amplification process. And the CRISPR/Cas12a system adds specific cleavage detection on the basis of the isothermal amplification method, so that the sensitivity of the detection method is improved and false positive can be avoided.

Therefore, the LAMP technology and the CRISPR/Cas12a technology are utilized to realize a method for rapidly detecting PCV2 related diseases.

Disclosure of Invention

The invention aims to provide a kit and a detection method for visually detecting porcine circovirus type 2 based on LAMP-CRISPR/Cas12a aiming at the defects of the prior art, so as to realize early prevention and control of PCV2 related diseases.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows: a crRNA for detecting porcine circovirus type 2 nucleic acid comprises a crRNA2-F/R and a crRNA3-F/R, wherein the sequences of the crRNA2-F/R are shown as SEQ ID NO.9 and SEQ ID NO.10, and the sequences of the crRNA3-F/R are shown as SEQ ID NO.11 and SEQ ID NO. 12.

The invention also provides a porcine circovirus type 2 CRISPR/Cas12a detection system, which comprises LbCas12a protein, the crRNA and a ssDNA probe, wherein the ssDNA sequence is shown as SEQ ID NO. 13.

In the CRISPR/Cas12a detection system, the concentration ratio of LbCas12a protein to crRNA is 1:1, ssDNA probe concentration was 2. mu.M.

The invention also provides a kit for visually detecting the porcine circovirus type 2 nucleic acid, which comprises the CRISPR/Cas12a detection system.

Further, the kit also comprises primers for amplifying the nucleic acid, wherein the primers comprise: F3/B3 as shown in SEQ ID NO.1 and SEQ ID NO.2, FIP/BIP as shown in SEQ ID NO.3 and SEQ ID NO.4, and LF/LB as shown in SEQ ID NO.5 and SEQ ID NO. 6.

The invention also provides a method for visually detecting the porcine circovirus type 2 nucleic acid, which comprises the steps of amplifying the nucleic acid by using the LAMP amplification primer, and adding an amplification product into the CRISPR/Cas12a detection system to detect the nucleic acid.

Compared with the prior art, the invention has the advantages or beneficial effects that: the LAMP-CRISPR/Cas12a detection system is adopted, an expensive thermal cycler is not needed, the method has the characteristics of high sensitivity and strong specificity, the reaction condition is simple, and the purpose of rapid visual detection can be achieved.

Drawings

FIG. 1 shows the optimization result of the LAMP detection system; wherein, A: temperature-optimized gel electrophoresis image, M: DNA molecular mass standard; 1, negative control; 2-8, respectively corresponding to 58, 60, 62, 63, 64, 65 and 66 ℃; b: time-optimized gel electrophoresis image, M: DNA molecular mass standard, 1: negative control; 2-6, respectively corresponding to 40, 45, 50, 55 and 60 min; c: bst DNA enzyme amount optimization gel electrophoresis result, M: DNA molecular mass standard; 1-3 corresponding to 0.5, 1.0 and 1.5 mul, respectively, 4: negative control; d: optimizing a gel electrophoresis chart according to the concentration ratio of the inner primer to the outer primer, wherein M: DNA molecular mass standard; 1-5, respectively corresponding to 4: 1. 6: 1. 8: 1. 10: 1 and 12: 1; 6: and (5) negative control.

FIG. 2 shows the comparison of LAMP and general PCR detection sensitivity; wherein, A: detecting the LAMP sensitivity; b: detecting the PCR sensitivity; c: visualizing the detection result; m: DNA molecular mass standard; 1: negative ofComparison; 2-8: are respectively 1 × 10 ⁰ ～1×10 ⁶ copies/. mu.L 10-fold gradient diluted recombinant plasmid.

FIG. 3 shows the result of LAMP specificity test; wherein, A: detecting LAMP specificity; b: detecting a visual result of LAMP specificity; m: DNA molecular mass standard; 1. 2: porcine circovirus type 2; 3: porcine circovirus type 1; 4: porcine circovirus type 3; 5: porcine parvovirus; 6: porcine pseudorabies virus; 7: porcine reproductive and respiratory syndrome virus; 8: porcine epidemic diarrhea virus; 9: and (5) negative control.

FIG. 4 shows the screening results of crRNA; wherein, A: screening a visualization result by crRNA; b: fluorescence data histogram.

Fig. 5 shows the results of the Cas12a protein to crRNA ratio optimization; wherein, A: the visualization result is optimized by the ratio of the Cas12a protein to the crRNA; b: fluorescence data histogram.

FIG. 6 shows the results of the concentration optimization of ssDNA probes; wherein, A: optimizing the visualized result of the concentration of the ssDNA probe; b: fluorescence data histogram.

FIG. 7 is a sensitivity evaluation of the PCR-CRISPR detection system; wherein, A: analyzing a visual result by using sensitivity; b: fluorescence data histogram.

FIG. 8 is a sensitivity evaluation of the LAMP-CRISPR detection system; wherein, A: analyzing a visual result by using sensitivity; b: fluorescence data histogram.

FIG. 9 is a specificity evaluation of the LAMP-CRISPR detection system; wherein, A: analyzing a visual result by using sensitivity; b: fluorescence data histogram.

FIG. 10 shows the detection result of the LAMP-CRISPR system for 30 DNA samples; wherein, 1-30: DNA sample, NC: and (5) negative control.

Fluorescence intensity (a.u.) is plotted on the ordinate in FIGS. 4 to 10, Positive is Positive, and Negative is Negative.

Detailed Description

Main test materials: t7 in vitro rapid transcription Kit (HiScribe T7 Quick highyieldRNA Synthesis Kit, NEB), RNase inhibitor (Biyunshi), Dnase/RNase-Free ddH2O (Solebao), PUCm-T vector and 2 XTAMP Master Mix were purchased from Shanghai Biotech service Limited, and common 2 XPCR premix and primers were purchased from Changsha Scienke Biotech Limited; the DNA/RNA extraction kit is purchased from Aisijin biotechnology (Hangzhou) Co., Ltd; the cDNA reverse transcription kit is purchased from Novovovoxel Biotechnology Co., Ltd; LbCas12a protein was purchased from the university of Hunan agriculture.

The main apparatus is as follows: fluorescent quantitative PCR instruments (Applied biosystems, USA), common PCR instruments (Thermo Fisher, USA), constant temperature water bath (Shanghai flying experiment instruments Co., Ltd.), nucleic acid electrophoresis instruments (six instruments of Beijing), ultraviolet gel imaging instruments (Beijing Suizhizhi Chuangshi Co., Ltd.), etc.

Extracting total DNA/RNA genome of the sample by adopting a DNA/RNA nucleic acid extraction kit; a cDNA reverse transcription kit is used for reverse transcribing a part of the tissue sample RNA into cDNA.

Example 1 establishment of LAMP-CRISPR/12a detection System

1. Positive standard plasmid pUCm-T-rep

And (3) amplifying the Rep gene sequence of PCV2, connecting the Rep gene sequence to a PUCm-T vector, and obtaining a pUCm-T-Rep plasmid with GenBank accession number KU317473 after transformation, identification and sequencing are carried out without errors.

Establishment of LAMP detection System

2.1 primer design

LAMP amplification primers are designed according to the Rep gene sequences (AY686764, AF055394, FJ598044, AY686763, AY256459, HM038034, EU148503-EU148505, AF055392, KU756238, KP975444, HF142260, KX161675, MF142260, KX161675, HF142260, KP 836994, JX535236 and KX61683) of different genotypes PCV2, the primer sequences are shown in Table 1, and the primers are synthesized by Changshan department biotechnology Limited.

TABLE 1 PCV2 Rep Gene LAMP primers

Name(s)	Sequence (5' →)3’)
		F3	GGGAGTCTGGTGACCGTT(SEQ ID NO.1)
B3	GGTGGTTTCCAGTATGTGGT(SEQ ID NO.2)
		FIP	ACGCTTCTGCATTTTCCCGCTC-GAGCAGCACCCTGTAACG(SEQ ID NO.3)
BIP	ATGTACACGTCATTGTGGGGCC-CCGGGTCTGCAAAATTAGCA(SEQ ID NO.4)
		LF	TTCAAAAGTTCAGCCAGCCC(SEQ ID NO.5)
LB	ACCTGGGTGTGGTAAAAGCA(SEQ ID NO.6)

2.2 LAMP detection method establishment

The LAMP amplification system was set up as in Table 2, and the reaction was performed on ice. After the reaction system is prepared, the mixture is vortexed, shaken and mixed evenly, and then is subjected to instantaneous centrifugation, the mixture reacts for 1 hour at 64 ℃, and is inactivated for 10min at 80 ℃. After the reaction, the reaction mixture was centrifuged instantaneously, 5. mu.L of the sample was added to 1. mu.L of 6 Xloading Buffer, and the reaction results were observed by 2% agarose gel electrophoresis.

TABLE 2 LAMP reaction amplification System

The temperature, the amplification time, the Bst DNA polymerase (8000U/mL) and the ratio of the inner primer and the outer primer in the reaction amplification system are respectively optimized. The system optimization is carried out by adopting the principle of controlling single variable in the LAMP system, the result is shown in figure 1, and the determined optimal reaction system (25 mu L) is as follows: 2 × LAMP Master Mix 12.5 μ L, inner primers FIP and BIP (40 μmol/L) each 1.25 μ L, outer primers F3 and B3(5 μmol/L) each 1 μ L, loop primers LF and LB (20 μmol/L) each 1 μ L, DNA polymerase 1 μ L, DNA template 2 μ L, and purified water to make up to 25 μ L. The optimal reaction condition is 60min at 63 ℃; 10min at 80 ℃.

2.3 sensitivity test of LAMP detection method

pUCm-T-rep positive standard plasmid was diluted (initial concentration 285 ng/. mu.L) to a copy number of 1X 10 ⁹ copies/. mu.L, diluted 10-fold to 10 ⁰ And (3) copies/mu L, determining the lowest detection limit of the LAMP detection method by adopting the optimized LAMP amplification system and conditions, and comparing the sensitivity with the conventional PCR method. And (3) adopting SYBR Green I dye to develop the LAMP amplification product. As shown in FIG. 2, the minimum concentration of the plasmid for conventional PCR detection was 1X 10 ³ copies/. mu.L, whereas the detection limit of the LAMP method is 1X 10 ¹ copies/. mu.L, 100-fold higher sensitivity than conventional PCR.

2.4 specificity test of LAMP detection method

PCV1, PCV2, PCV3, PRV and PPV genomic DNA and PRRSV and PEDV cDNA samples are taken as templates to explore the specificity of the LAMP detection method. After the reaction is finished, 5 mu L of LAMP amplification product is taken and identified by 2% agarose gel electrophoresis, and the rest product is added with SYBR Green I for visual detection. The result is shown in FIG. 3, only the PCV2 sample is subjected to LAMP amplification to form a trapezoid band which is visualized to be green, and the rest samples are negative, so that the method is proved to have excellent specificity.

3. Establishment of detection system for CRISPR/Cas12a of targeted PCV2 Rep gene

3.1CrRNA primer design, ligation and purification

Design of crRNA: selecting a sequence rich in T base as a detection target site according to the LAMP amplification product sequence, and designing a detection site of 20-23bp behind PAM through an http:// bioinfolab. The T7 promoter (TAATACGACTCACTATAGG) + the scaffold sequence (AATTTCTACTAAGTGTAGAT) + the target sequence (20-23 bp after the target DNA PAM sequence) of LbCas12a is used to form crRNA-F, and reverse complementation is crRNA-R, wherein the T7 promoter enables the annealed DNA double strand to be recognized and transcribed by T7 polymerase, and the scaffold sequence can be combined with LbCas12 a. The two synthesized crRNA-F/R oligonucleotides are shown in Table 3, annealed to obtain a DNA double strand, and subjected to T7 in vitro transcription to obtain the required crRNA.

TABLE 3 crRNA information detected for PCV2

Oligonucleotide strand annealing: annealing the crRNA1, crRNA2 and crRNA3 oligonucleotides to form double-stranded DNA, centrifuging the synthesized crRNA-F, crRNA-R dry powder at 12000rpm for 5min, diluting to 10 μ M working concentration, and performing the annealing process of the oligonucleotides as shown in Table 4, wherein the annealing process comprises the following steps: 30min at 37 ℃; 95 ℃ for 5 min; 1min at 90 ℃; at 85 ℃ for 1 min; at 80 ℃ for 1 min; at 75 ℃ for 1 min; 1min at 70 ℃; at 65 ℃ for 1 min; 60 ℃ for 1 min; at 55 deg.C for 1 min; 50 ℃ for 1 min; at 45 ℃ for 1 min; 1min at 40 ℃; 35 ℃ for 1 min; at 30 ℃ for 1 min; at 25 ℃ for 1 min; 4 ℃ and infinity.

TABLE 4 annealing System for crRNA oligonucleotide strands

crRNADNA double strand concentration was measured by Nanodrop.

T7 in vitro transcription: t7 in vitro transcription system is shown in Table 5, and the reaction program is 37 ℃ overnight.

TABLE 5T 7 in vitro transcription System

Composition (I)	Volume (30 μ L)
		T7polymerase	2μL
NTPmix	10μL
		Annealed double stranded DNA	1μg
RNase-FreeddH ₂ O	Make up to 30 mu L

Removing the DNA template in the system: after completion of T7 in vitro transcription, 20. mu.L RNAse-Free ddH was added ₂ O and 2 mu LDNase I (RNase-Free) into the system, and reacting for 15min at 37 ℃.

crRNA purification (phenol-chloroform extraction and ethanol precipitation method):

(1) mu.L of the post-transcriptional product was transferred to a 1.5mL centrifuge tube and RNase-Free ddH was added ₂ O to the system volume of 180 mu L;

(2) adding 20 mu L of 5M ammonium acetate, and uniformly mixing by vortex oscillation;

(3) adding an equal volume (200 μ L) of a phenol-chloroform mixture at 1: 1;

(4) centrifuging at 12000rpm for 15min at 4 deg.C, transferring supernatant (water phase) to a new 1.5mL centrifuge tube;

(5) adding chloroform with the same volume, centrifuging at 4 ℃ and 12000rpm for 15min, and taking the supernatant to a new 1.5mL centrifuge tube;

(6) adding 2 times volume of ethanol, and precipitating RNA at-20 deg.C for 35 min;

(7) centrifuging at 4 deg.C and 12000rpm for 30min, and collecting precipitate;

(8) adding 500 μ L of precooled 70% ethanol, washing the precipitate, centrifuging at 7500rpm at 4 deg.C for 5 min;

(9) repeating the step (8) once;

(10) add 50. mu.L RNase-free water containing 0.1mM EDTA to dissolve the pellet.

3.2 design and Synthesis of ssDNA probes

TABLE 6 ssDNA probes

The probe sequences are shown in Table 6, synthesized by Scophthal technologies, Ltd, and stored in dark place at 13000rpm for 5min, diluted to 10. mu.M working solution concentration, and stored at-20 ℃ for further use.

3.3 optimization of CRISPR-Cas12a fluorescence detection System

3.3.1 selection of crRNA

To ensure the maximum efficiency of the CRISPR-Cas12a detection system, we optimized the screening of crRNA in the reaction system. Based on three crrnas against the PCV2 target sequence, six sets of crRNA controls were provided, including a single crRNA-containing assay set (crRNA1, crRNA2, and crRNA3), and a dual crRNA assay set (crRNA1&2, crRNA1&3, and crRNA2&3), each set including positive (positive) and negative (negative) controls. The remaining components of the assay system are shown in Table 7. After the system is prepared, the eight-connected tube is placed in an ABI Quantstudio 5qPCR instrument for reaction at 37 ℃ for 30min, the fluorescence value data is read, and after the reaction is finished, fluorescence is observed by using an ultraviolet lamp under a gel imaging system.

TABLE 7 detection system component table

The crRNA screening optimization result is shown in fig. 4, wherein a graph a is a visualization result of the CRISPR-Cas12a detection system under an ultraviolet lamp after reacting for 30min at 37 ℃, and a graph B is a bar graph of fluorescence value data measured by a qPCR instrument, and as can be seen from the graph, the fluorescence value generated by the crRNA2&3 dual fluorescence group is high, the background fluorescence value of the group is relatively low, and strong fluorescence can be excited under ultraviolet light, so the crRNA2&3 is selected as the crRNA combination in the detection system based on PCV2 CRISPR-Cas12 a.

3.3.2 Cas12a ratio to crRNA

Theoretically, LbCas12a and crRNA are bound in a 1:1 ratio, but we chose to determine the optimal LbCas12a protein to crRNA ratio by design experiments for reasons of crRNA stability and efficiency of assembly of LbCas12a protein and crRNA. Optimization experiment of LbCas12a protein to crRNA ratio three groups of controls were set, namely LbCas12 a: crRNA was 1:1(250:250nM), 2:1(500:250nM) and 1:2(250:500nM), each group containing positive (positive) and negative (negative) controls. The detection system is shown in table 7, the eight-connected tube is placed in an ABI Quantstudio 5qPCR instrument for reaction at 37 ℃ for 30min, the fluorescence value data is read, and after the reaction is finished, fluorescence is observed by using an ultraviolet lamp under a gel imaging system.

The result of optimizing the ratio of Cas12a protein to crRNA is shown in fig. 5, and it can be seen that the CRISPR-Cas12a detection system is Cas12 a: the fluorescence intensity generated was maximal at 1:1(250:250nM) for crRNA, which correlates with 1:1 binding of Cas12a protein to crRNA in the detection system, so Cas12a protein was selected in subsequent experiments: the crRNA was 1:1(250:250 nM).

3.3.3 concentration of ssDNA Probe

In order to achieve the best effect of the analysis performance of the detection system, the concentration of the ssDNA probe in the CRISPR detection system is optimized, and 0.1, 0.4, 1.0, 2.0, 4.0 and 6.0 muL of ssDNA probe with the concentration of 10 muM are respectively added into the system, so that the final concentrations of the ssDNA probe in the system are respectively 50nM, 200nM, 500nM, 1 muM, 2 muM and 3 muM. After the detection and preparation of the PCR amplification product containing Cas12a protein, crRNA2&3 and target sequences, buffer solution and ssDNA probes with different volumes are finished, the components are fully and uniformly mixed, the eight connecting pipes are placed in an ABI Quantstudio 5qPCR instrument for reaction at 37 ℃ for 30min, the fluorescence value data are read, and after the reaction is finished, fluorescence is observed by using an ultraviolet lamp under a gel imaging system. Experiments were performed to verify Cas12a trans-cleavage activity based on fluorescence intensity results.

Theoretically, the fluorescence intensity is in direct proportion to the ssDNA probe concentration, and the higher the ssDNA concentration in the detection system, the stronger the fluorescence. However, it has been reported that due to the technical disadvantages of the current commercially synthesized ssDNA probes, the fluorescent group and the quenching group are not stable enough, which results in background fluorescence generated when the probes are not cleaved. The results of the ssDNA probe concentration optimization experiments are shown in FIG. 6, and it can be seen that the higher the fluorescence value of the probe is, the higher the fluorescence intensity of the probe under ultraviolet light is, the higher the fluorescence value is, the higher the fluorescence intensity is, and the higher the fluorescence intensity is, the higher the fluorescence intensity is, and the higher the fluorescence intensity is, the higher the fluorescence intensity is, and the higher the fluorescence intensity is, the higher the fluorescence intensity is, and the higher the fluorescence intensity is, the higher the fluorescence intensity is, and the fluorescence is, the fluorescence intensity is, the fluorescence is, and the higher, the fluorescence intensity is, and the fluorescence is, and the fluorescence intensity is, and the fluorescence is, and the fluorescence. Since 2 μ M probe already produces strong fluorescence under UV lamp, 2 μ M was chosen as the ssDNA probe concentration in the detection system in the subsequent experiments.

4, establishment of LAMP-CRISPR/12a detection system

4.1 LAMP-CRISPR detection System sensitivity test

To evaluate the sensitivity of LAMP-CRISPR-based PCV2 detection system, a standard plasmid pUCm-T-rep (copy number 1X 10) after gradient dilution was first applied ⁰ ～1×10 ⁶ copies/. mu.L) was amplified by LAMP method, and then LAMP amplification products of different reactions were added to a detection system containing LbCas12a protein, crRNA, 10 XT 4 ligase Buffer and ssDNA probe, and reacted in ABI qPCR instrument at 37 ℃ for 30 min. After the reaction, the reaction was observed under an ultraviolet lamp to see whether or not strong fluorescence was generated. The results are shown in FIG. 8, where 10 is visible ¹ ～10 ⁶ The fluorescence signal generated by the copies/mu L group is very different from that of the NC group without the target sequence, and strong fluorescence can be observed under ultraviolet, 10 ⁰ The fluorescence signal of the copies/mu L group begins to decline obviously, has no obvious difference with the NC group, and the fluorescence signal generated under an ultraviolet lamp is weaker. The result shows that the LAMP-CRISPR detection sensitivity is 1-10 copies/mu L.

4.2 LAMP-CRISPR detection System specificity test

In order to verify the specificity of the LAMP-CRISPR detection system on PCV2 detection and avoid the situation of crossing with other porcine viruses, the specificity of the detection system is evaluated. In the detection system, the target DNAs of different groups are respectively virus DNA genomes of PCV2, PCV1, PCV3 and PPV, virus cDNAs of CSFV, PRRSV and PEDV, and RNase-free H2O are used as negative controls, and the process of the detection system is carried out with reference to 4.1.

The specific evaluation result of the LAMP-CRISPR detection system is shown in FIG. 9, and it can be seen that when the target DNA is PCV2, the generated fluorescence signal value has extremely significant difference compared with that of the NC group, and obvious green fluorescence can be seen under ultraviolet light, while in other groups, because the target DNA in the system is not matched with crRNA, the fluorescence signal has no difference compared with that of the NC group, and the LbCas12a protein cannot complete non-specific cleavage of the ssDNA probe. The result shows that the LAMP-CRISPR detection system has high specificity to PCV 2.

Example 3 clinical sample testing

And respectively comparing the LAMP-CRISPR detection system established by the invention with the real-time fluorescence PCR (qPCR) detection result based on the fluorescent probe on 30 pig farm clinical DNA samples, and verifying the conformity of the LAMP-CRISPR and the qPCR detection. The results of 30 clinical DNA samples detected by LAMP-CRISPR are shown in FIG. 10, and the results show that 20 positive DNA samples and 10 negative DNA samples are detected by the LAMP-CRISPR method, the positive rate is 66.67%, and the results are consistent with the qPCR detection results shown in Table 8, which shows that the method has good sensitivity and specificity.

TABLE 8 qPCR assay results

SEQUENCE LISTING

<110> Hunan agriculture university

<120> kit and method for visual detection of PCV2 nucleic acid based on LAMP-CRISPR/Cas12a

<130> 001

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 1

gggagtctgg tgaccgtt 18

<210> 2

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 2

ggtggtttcc agtatgtggt 20

<210> 3

<211> 40

<212> DNA

<213> Artificial Synthesis

<400> 3

acgcttctgc attttcccgc tcgagcagca ccctgtaacg 40

<210> 4

<211> 42

<212> DNA

<213> Artificial Synthesis

<400> 4

atgtacacgt cattgtgggg ccccgggtct gcaaaattag ca 42

<210> 5

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 5

ttcaaaagtt cagccagccc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 6

acctgggtgt ggtaaaagca 20

<210> 7

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 7

taatacgact cactatagga atttctacta agtgtagata aaagttcagc cagcccgcg 59

<210> 8

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 8

cgcgggctgg ctgaactttt atctacactt agtagaaatt cctatagtga gtcgtatta 59

<210> 9

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 9

taatacgact cactatagga atttctacta agtgtagatt cagaaatttc cgcgggctg 59

<210> 10

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 10

cagcccgcgg aaatttctga atctacactt agtagaaatt cctatagtga gtcgtatta 59

<210> 11

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 11

taatacgact cactatagga atttctacta agtgtagatc gcgggctggc tgaactttt 59

<210> 12

<211> 59

<212> DNA

<213> Artificial Synthesis

<400> 12

aaaagttcag ccagcccgcg atctacactt agtagaaatt cctatagtga gtcgtatta 59

<210> 13

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 13

ccggaaaaaa aaaaaaccgg 20

Claims

1. A crRNA is characterized by being a crRNA for detecting porcine circovirus type 2 nucleic acid and comprising a crRNA2-F/R and a crRNA3-F/R, wherein the sequences of the crRNA2-F/R are shown as SEQ ID NO.9 and SEQ ID NO.10, and the sequences of the crRNA3-F/R are shown as SEQ ID NO.11 and SEQ ID NO. 12.

2. A porcine circovirus type 2 CRISPR/Cas12a detection system, which is characterized by comprising LbCas12a protein, crRNA and ssDNA probe, wherein the crRNA sequence is as in claim 1, and the ssDNA sequence is as shown in SEQ ID NO. 13.

3. The detection system of claim 2, wherein the concentration ratio of LbCas12a protein to crRNA is 1: 1.

4. the detection system of claim 2, wherein the ssDNA probe is at a concentration of 2 μ Μ.

5. A kit for visually detecting porcine circovirus type 2 nucleic acid, which comprises the CRISPR/Cas12a detection system of any one of claims 2 to 4.

6. The kit of claim 5, further comprising primers for amplifying said nucleic acid.

7. The kit of claim 6, wherein the primers comprise the following primer pairs:

F3/B3 as shown in SEQ ID NO.1 and SEQ ID NO. 2;

FIP/BIP as shown in SEQ ID NO.3 and SEQ ID NO. 4;

LF/LB, shown as SEQ ID NO.5 and SEQ ID NO. 6.

8. A method for visually detecting porcine circovirus type 2 nucleic acid is characterized in that LAMP amplification primers are used for amplifying the nucleic acid, and then the amplification product is added into a CRISPR/Cas12a detection system to detect the nucleic acid.

9. The method of claim 8, wherein the LAMP amplification primers comprise the following primer pairs:

F3/B3 as shown in SEQ ID NO.1 and SEQ ID NO. 2;

FIP/BIP as shown in SEQ ID NO.3 and SEQ ID NO. 4;

LF/LB is shown in SEQ ID NO.5 and SEQ ID NO. 6.

10. The method of claim 8, wherein the CRISPR/Cas12a detection system comprises LbCas12a protein, crRNA and ssDNA probe, the crRNA sequence is as set forth in claim 1, and the ssDNA sequence is as set forth in SEQ ID No. 13.