CN113337638A - Method and kit for detecting novel coronavirus (SARS-CoV-2) - Google Patents
Method and kit for detecting novel coronavirus (SARS-CoV-2) Download PDFInfo
- Publication number
- CN113337638A CN113337638A CN202010140787.7A CN202010140787A CN113337638A CN 113337638 A CN113337638 A CN 113337638A CN 202010140787 A CN202010140787 A CN 202010140787A CN 113337638 A CN113337638 A CN 113337638A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- cas protein
- target nucleic
- acid molecule
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention provides a method and a kit for detecting novel coronavirus (SARS-CoV-2). The detection method comprises the following steps: (a) providing a sample to be checked containing a nucleic acid amplification product; (b) mixing the sample to be checked with a sensitizing reagent or a sensitizing buffer solution containing the sensitizing reagent to form a detection system, wherein the sensitizing reagent comprises: a guide RNA, a Cas protein, and a sensitizing nucleic acid probe; and (c) detecting whether the sensitizing nucleic acid probe in the detection system is cleaved by the Cas protein. According to the characteristics of the method, the method is named SENA (specific Enhancement for Nucleic Acid Amplification assays) and is used for specific sensitization of new coronavirus PCR reaction products.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a detection method and a kit for a novel coronavirus. The invention also relates to a method and a kit for sensitivity-enhancing detection of the nucleic acid molecule amplification product.
Background
Coronavirus is a positive-stranded single-stranded RNA coronavirus with an envelope, which causes an acute respiratory viral disease that has emerged in 2019. On day 11 of 2 months, the international committee for viral classification specified the virus name severe acid respiratory syndrome coronavirus corona 2, abbreviated SARS-CoV-2, i.e., "severe acute respiratory syndrome coronavirus type 2". The diseases caused by the virus are named as 'COVID-19' by the world health organization, namely '2019 coronavirus diseases'.
In clinical examination of COVID-19, nucleic acid detection of samples such as throat swab, nasal swab, lower respiratory lavage, and feces is currently the most effective method for the accurate diagnosis of SARS-CoV-2 virus. However, because of the hasty of epidemic outbreaks, IVD companies are not left with sufficient time to develop and verify the performance and effectiveness of reagents, resulting in the poor key indicators of sensitivity and specificity of the currently used reagents in clinical practice.
In addition, the small amount of SARS-CoV-2 in the throat, nose and upper respiratory tract results in significantly reduced detection accuracy, and makes it more difficult to accurately detect SARS-CoV-2, particularly in the latent or early stage of infection, which further increases the risk of infection by COVID-19.
The qRT-PCR detection of SARS-CoV-2 virus has high sensitivity and specificity, and therefore, is a widely accepted standard for judging virus infection at present. However, when the content of viral nucleic acid in the sample to be tested is very low, and the Ct value of the test result is close to or even greater than 40, the sample is difficult to judge whether the sample is "weak positive" or "true negative".
At present, although deep sequencing can be used for further judgment, the method is time-consuming, labor-consuming and expensive. In addition, although the comprehensive judgment can be made by combining clinical symptoms or treatment effects, the scheme is not only time-consuming, but also unsafe, and the judgment standards cannot be unified, so that the result is not accurate.
Therefore, there is an urgent need in the art to develop a rapid, simple, efficient and accurate method for detecting SARS-CoV-2.
Disclosure of Invention
The invention aims to provide a method and a kit for quickly, simply, efficiently and accurately detecting SARS-CoV-2.
Another object of the present invention is to provide a detection method for further performing high-efficiency sensitization after amplification of a target nucleic acid molecule.
In a first aspect of the present invention, there is provided a method for detecting a target nucleic acid molecule, comprising the steps of:
(a) providing a sample to be tested containing a nucleic acid amplification product, wherein the nucleic acid amplification product is an amplification product obtained by performing specific amplification based on a target nucleic acid molecule on a detection sample suspected of containing the target nucleic acid molecule;
(b) mixing the sample to be checked with a sensitizing reagent or a sensitizing buffer solution containing the sensitizing reagent to form a detection system, wherein the sensitizing reagent comprises: a guide RNA, a Cas protein, and a sensitizing nucleic acid probe, wherein the guide RNA is specific for the nucleic acid amplification product; and
(c) detecting whether the sensitized nucleic acid probe in the detection system is cleaved by the Cas protein, wherein if the sensitized nucleic acid probe is cleaved, the detection sample contains a target nucleic acid molecule; if the sensitization nucleic acid probe is not cut, the detection sample does not contain the target nucleic acid molecule.
In another preferred embodiment, the target nucleic acid comprises a target DNA and a target RNA.
In another preferred embodiment, the nucleic acid amplification product is a DNA product.
In another preferred embodiment, the term "guide RNA specific for the nucleic acid amplification product" means that the complex of guide RNA and Cas protein specifically binds to the positive strand DNA and/or negative strand DNA of the nucleic acid amplification product and does not specifically bind to other nucleic acid species in the detection system.
In another preferred embodiment, the other nucleic acid substances in the detection system include: primer, Taqman fluorescent probe, sensitization nucleic acid probe and nucleic acid molecule without target nucleic acid sequence.
In another preferred embodiment, the detection system further comprises a buffer solution or a buffering agent.
In another preferred embodiment, in step (c), the detection is performed by a method of detecting fluorescence intensity.
In another preferred example, the Cas protein is Cas12a or a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12 a;
alternatively, the Cas protein is Cas12b (i.e., C2C1) or a Cas protein with similar alternative single-stranded DNA cleavage activity as Cas12 b.
Alternatively, the Cas protein is Cas14 or a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas 14.
In another preferred embodiment, the Cas12a is selected from the group consisting of: one of LbaCas12a, FnCas12a, assas 12a, LbaCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12 a; more preferably, Cas12a is LbaCas12 a.
In another preferred example, the guide RNA refers to an RNA that directs the Cas protein to specifically bind to the target DNA.
Preferably, the guide RNA is a guide RNA that directs the Cas protein to specifically bind to a SARS-CoV-2 viral target sequence.
In another preferred example, the sensitization nucleic acid probe is single-stranded DNA or a single-stranded nucleic acid probe containing a partial DNA sequence.
In another preferred embodiment, the sensitization nucleic acid probe is FAM-N12BHQ1, wherein N represents either nucleotide A, T, C, or G.
In another preferred embodiment, the single-stranded DNA is preferably a fluorescently labeled single-stranded DNA.
In another preferred embodiment, the nucleic acid probe is a single-stranded DNA; the single-stranded DNA is preferably a single-stranded DNA with two ends respectively marked with a fluorescent group and a fluorescence quenching group; the single-stranded DNA is preferably a single-stranded probe which is marked with a fluorescent group at the 5 'end and is marked with a quenching group at the 3' end; the single-stranded DNA is preferably a single-stranded probe which is marked with a fluorescent group at the 3 'end and is marked with a quenching group at the 3' end; the single-stranded DNA is preferably a single-stranded probe which contains a fluorescent group label and a quenching group label inside respectively; the single-stranded DNA is preferably a fluorescent probe with a 5 'end labeled with FAM fluorescent group and a 3' end labeled with a quencher BHQ 1.
In another preferred embodiment, the single-stranded DNA is a single-stranded probe labeled with a fluorescent group HEX at the 5 'end and a quencher group BHQ1 at the 3' end.
In another preferred embodiment, the detection method of the nucleic acid probe is a fluorescence detection method.
In another preferred embodiment, the fluorescence detection method is a method using a microplate reader or a fluorescence spectrophotometer.
In another preferred embodiment, the sample to be tested is a reaction system formed after an amplification reaction is performed on the detection sample.
The amplification is selected from the group consisting of: PCR amplification, LAMP amplification, RPA amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription mediated amplification, rolling circle amplification, HDA, SPIA, NEAR, TMA, and SMAP 2.
In another preferred embodiment, the amplification is PCR amplification.
In another preferred embodiment, the amplification is selected from the group consisting of: qPCR, RT-PCR, or a combination thereof.
In another preferred embodiment, the target nucleic acid molecule to be detected in the reaction system is obtained by PCR or qPCR or qRT-PCR amplification.
In another preferred example, the Ct value of qPCR or qRT-PCR in the reaction system is not less than 35, more preferably not less than 40, and more preferably not less than 45.
In another preferred example, the Ct value of qPCR or qRT-PCR of the reaction system is less than or equal to 50.
In another preferred embodiment, the Ct of qPCR or qRT-PCR in the reaction system is 32-45, preferably 35-40.
In another preferred embodiment, the reaction system is a reaction system obtained by amplification using a primer selected from the group consisting of; or the amplification product contains a sequence which has more than 20bp of overlap with the amplification products of the following primer pairs:
in another preferred embodiment, the primer is any one primer pair selected from the group consisting of:
in another preferred embodiment, the target nucleic acid molecule is selected from the group consisting of: nucleic acid molecules of pathogenic microorganisms, genetically mutated nucleic acid molecules, and specific target nucleic acid molecules.
In another preferred embodiment, the pathogenic microorganisms include viruses, bacteria, chlamydia and mycoplasma.
In another preferred embodiment, the virus comprises: coronavirus, influenza virus, HIV, hepatitis virus, parainfluenza virus.
In another preferred embodiment, the coronavirus is selected from the group consisting of: SARS-CoV-2, SARS-CoV.
In another preferred embodiment, the nucleic acid molecule comprises DNA, RNA, or cDNA.
In another preferred embodiment, the sensitizing nucleic acid probe is labeled with a detectable label.
In another preferred embodiment, the label does not emit a detectable signal when the sensitizing nucleic acid probe is in an uncleaved state and emits a detectable signal when the sensitizing nucleic acid probe is in a cleaved state.
In another preferred embodiment, the label emits a detectable signal when the sensitizing nucleic acid probe is in an uncleaved state and the label does not emit a detectable signal or emits a different detectable signal when the sensitizing nucleic acid probe is in a cleaved state.
In another preferred embodiment, the label comprises a fluorescent group and a quenching group, wherein when the sensitizing nucleic acid probe is not cleaved, the quenching group causes the fluorescent group to be quenched, thereby causing no fluorescence to be emitted; when the sensitizing nucleic acid probe is cleaved, the fluorescent group is no longer quenched by the quencher, thereby causing fluorescence to be emitted.
In another preferred embodiment, when the amplification product containing the target sequence, the guide RNA and the Cas protein form a ternary complex, the complex cleaves the sensitized probe in the system, thereby emitting a detectable signal.
In another preferred embodiment, when the target nucleic acid to be detected is amplified, the amplification product is bound by the guide RNA and the Cas protein to form a ternary complex. Once the ternary complex is formed, the complex cleaves the single-stranded, sensitized nucleic acid probe in the system and emits a fluorescent signal that can be detected.
In another preferred example, the Cas12a protein specifically binds to the target DNA present in the amplification system under guide of a guide RNA targeting the SARS-CoV-2 viral genomic sequence to form a ternary complex, and cleaves the single-stranded sensitizing nucleic acid probe in the system to give a detectable fluorescent signal.
In another preferred example, the Cas12b protein specifically binds to the target DNA present in the amplification system under guide of a guide RNA targeting the SARS-CoV-2 viral genomic sequence to form a ternary complex, and cleaves the single-stranded sensitizing nucleic acid probe in the system to give a detectable fluorescent signal.
In another preferred example, under the guide of guide RNA targeting SARS-CoV-2 virus genome sequence, Cas14 protein specifically binds to single-stranded target DNA existing in the amplification system or single-stranded target DNA formed after treatment to form ternary complex, and cuts up single-stranded sensitizing nucleic acid probe in the system to emit detectable fluorescent signal.
In another preferred embodiment, the test sample is a nucleic acid sample prepared from a sample selected from the group consisting of: a throat swab, a nasal swab, urine, feces, body fluid, or a combination thereof.
In another preferred embodiment, the detection method is non-diagnostic and non-therapeutic.
In a second aspect of the invention, there is provided a kit for the detection of a target nucleic acid molecule, the kit comprising:
(a) amplification reagents for amplifying a target nucleic acid molecule, the amplification reagents comprising:
(a1) a primer pair for amplifying a target nucleic acid molecule, the primer pair for performing a specific amplification reaction based on the target nucleic acid molecule, thereby producing a specific nucleic acid amplification product;
(a2) optionally a first probe for binding to a nucleic acid amplification product in the amplification reaction, thereby generating a first detectable signal;
(a3) optionally a polymerase for the amplification reaction;
(b) a sensitizing reagent for sensitizing an amplification reaction, the sensitizing reagent comprising: a guide RNA, a Cas protein, and a sensitizing nucleic acid probe.
In another preferred embodiment, the kit further comprises:
(c) a reverse transcription reagent for use in a reverse transcription reaction, said reverse transcription reagent comprising: reverse transcriptase or a Bst enzyme (or mutant thereof) having reverse transcriptase activity.
In another preferred embodiment, the kit contains the following preferred combinations of reagents:
ORF1ab for SARS-CoV-2:
crRNA: SEQ ID No:11 (guide sequence thereof is SEQ ID No:1)'
And/or, against the SARS-CoV-2N gene:
crRNA7: SEQ ID No:17 (guide sequence is SEQ ID No: 1).
In another preferred embodiment, the sensitizing nucleic acid probe is FAM-N12BHQ1, wherein N represents either nucleotide A, T, C, or G.
In a third aspect of the invention, there is provided an assay system for detecting a target nucleic acid molecule, the assay system comprising:
(a) a Cas protein that is Cas12a or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12a, or Cas12b or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12b, or Cas14 or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas 14;
(b) a guide RNA that guides the Cas protein to specifically bind to a target nucleic acid molecule; and
(c) the nucleic acid probe with the sensitization is single-stranded DNA;
wherein, the target nucleic acid molecule is target DNA;
(d) a sample to be tested containing a nucleic acid amplification product, wherein the nucleic acid amplification product is an amplification product obtained by performing specific amplification based on the target nucleic acid molecule on a test sample suspected of containing the target nucleic acid molecule.
In another preferred embodiment, the detection system further comprises (e) a buffer.
In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected (or the corresponding amplification product) in the detection system is 100 copies/microliter or 1015Copy/microliter, preferably 103-1010Copy/microliter, more preferably 104-108Copy/microliter.
In another preferred embodiment, in the detection system, the molar ratio of the sensitizing nucleic acid probe to the target nucleic acid molecule is 1: 1010To 1010:1, preferably 1: 1 to 1: 100.
in another preferred embodiment, the guide length of said guide RNA is 15-30nt, preferably 17-23 nt.
In another preferred embodiment, the target DNA comprises cDNA.
In another preferred embodiment, the target DNA is selected from the group consisting of: single-stranded DNA, double-stranded DNA, or a combination thereof.
In another preferred embodiment, the sensitization nucleic acid probe has a fluorescent group and a quenching group.
In another preferred embodiment, the fluorescent group and the quenching group are respectively and independently positioned at the 5 'end, the 3' end and the interior of the sensitization nucleic acid probe.
In another preferred embodiment, the length of the nucleic acid sensitizing probe is 3 to 300nt, preferably 5 to 100nt, more preferably 6 to 50nt, and most preferably 2 to 12 nt.
In another preferred embodiment, the target nucleic acid molecule comprises a target nucleic acid molecule derived from a nucleic acid molecule selected from the group consisting of: a plant, an animal, an insect, a microorganism, a virus, or a combination thereof.
In another preferred embodiment, the target DNA is a synthetic or naturally occurring DNA.
In another preferred embodiment, the target DNA comprises a wild-type or mutant DNA.
In another preferred embodiment, the target DNA includes DNA obtained by reverse transcription or amplification of RNA, such as cDNA.
In another preferred embodiment, the Cas12a is selected from the group consisting of: FnCas12a, AsCas12a, LbaCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, or a combination thereof; more preferably, Cas12a is LbaCas12 a.
In another preferred example, the Cas protein having similar alternative single-stranded DNA cleavage activity to Cas12a is selected from the group consisting of: cas12b (i.e., C2C 1).
In another preferred example, the Cas protein having similar alternative single-stranded DNA cleavage activity to Cas12a is selected from the group consisting of: cas 14.
In another preferred embodiment, the sensitizing nucleic acid probe comprises a single-stranded DNA with a detectable label.
In another preferred embodiment, the single-stranded DNA is a fluorescent and biotin-labeled single-stranded DNA.
In another preferred embodiment, the single-stranded DNA is a fluorescently-labeled single-stranded DNA.
In another preferred embodiment, the single-stranded DNA is a fluorescent probe labeled with a fluorescent group FAM at the 5 'end and a quencher group BHQ1 at the 3' end.
In a fourth aspect of the invention, there is provided a kit for detecting a target nucleic acid molecule, the kit comprising:
(i) a first container and a Cas protein within the first container, the Cas protein being Cas12a or having a similar activity as the cleavage of bypass single-stranded DNA of Cas12a, or Cas12b or having a similar activity as the cleavage of bypass single-stranded DNA of Cas12b, or Cas14 or having a similar activity as the cleavage of bypass single-stranded DNA of Cas 14;
(ii) a second container and a guide RNA within the second container that guides the Cas protein to specifically bind to a target nucleic acid molecule;
(iii) a third container and a sensitization nucleic acid probe positioned in the third container;
(iv) a fourth vessel and amplification reagents located within the fourth vessel for amplifying the target nucleic acid molecule; and (v) optionally a fifth container and a buffer in the fifth container;
wherein the target nucleic acid molecule is a target DNA.
In another preferred embodiment, the amplification reagents comprise:
(a1) a primer pair for amplifying a target nucleic acid molecule, the primer pair for performing a specific amplification reaction based on the target nucleic acid molecule, thereby producing a specific nucleic acid amplification product;
(a2) optionally a first probe for binding to a nucleic acid amplification product in the amplification reaction, thereby generating a first detectable signal; and
(a3) optionally a polymerase for the amplification reaction.
In another preferred embodiment, the buffer solution in the fifth container comprises: a buffer for an amplification reaction, and/or a buffer for a sensitization reaction.
In another preferred embodiment, any two, three, four or all of the first container, the second container, the third container, the fourth container and the fifth container may be the same or different containers.
In another preferred embodiment, the sensitization nucleic acid probe has a fluorescent group and a quenching group.
In a fifth aspect of the invention, there is provided a method of detecting the presence or absence of a target nucleic acid molecule in a sample, comprising the steps of:
(a) providing a detection system according to the third aspect of the invention for detecting a target nucleic acid molecule; and
(b) detecting whether the sensitization nucleic acid probe in the detection system is cut by the Cas protein, wherein the cutting is the trans-cutting of the bypass single-stranded DNA;
wherein cleavage of the sensitizing nucleic acid probe by the Cas protein indicates the presence of the target nucleic acid molecule in the sample; and the sensitizing nucleic acid probe is not cleaved by the Cas protein, indicating that the target nucleic acid molecule is not present in the sample.
In another preferred embodiment, in the detection system, the sample to be tested containing the nucleic acid amplification product is prepared by a nucleic acid amplification method selected from the group consisting of: PCR amplification, LAMP amplification, RPA amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription mediated amplification, rolling circle amplification, HDA, SPIA, NEAR, TMA, and SMAP 2.
In another preferred example, the PCR includes high temperature PCR, normal temperature PCR, and low temperature PCR.
In another preferred embodiment, the method is used to detect whether a nucleic acid at a target site is at a SNP, point mutation, deletion, and/or insertion.
In another preferred embodiment, nucleic acid amplification is performed using primers that introduce PAM when the PAM sequence is absent upstream and downstream of the target site (in the range of-20 nt to +20nt, preferably in the range of-15 nt to +15nt, more preferably in the range of-10 nt to +10 nt).
In another preferred embodiment, the PAM introduced primer has a structure of formula I from 5 '-3':
P1-P2-P3 (I)
in the formula (I), the compound is shown in the specification,
p1 is a 5 'segment sequence at the 5' end that is complementary or non-complementary to the sequence of the target nucleic acid molecule;
p2 is a PAM sequence;
p3 is a3 'segment sequence complementary to the sequence of the target nucleic acid molecule at the 3' end.
In another preferred embodiment, the PAM primer specifically binds upstream or downstream of the target nucleic acid molecule.
In another preferred embodiment, P1 is 0-20nt in length.
In another preferred embodiment, P3 is 5-20nt in length.
In another preferred embodiment, the length of the PAM primer is 18 to 50nt, preferably 20 to 35 nt.
In another preferred embodiment, the complementation includes complete complementation and partial complementation.
In another preferred embodiment, at least one primer used in the nucleic acid amplification contains a PAM sequence.
In another preferred embodiment, when the upstream and downstream of the target site (in the range of (-20nt to +20nt, preferably in the range of-15 nt to +15nt, and more preferably in the range of-10 nt to +10 nt) contain a PAM sequence, a primer containing or not containing the PAM sequence may be used, and the amplified product contains the PAM sequence.
In another preferred embodiment, the target nucleic acid molecule is selected from the group consisting of: nucleic acid molecules of pathogenic microorganisms, genetically mutated nucleic acid molecules, and specific target nucleic acid molecules.
In another preferred embodiment, the pathogenic microorganisms include viruses, bacteria, chlamydia and mycoplasma.
In another preferred embodiment, the virus comprises: coronavirus, influenza virus, HIV, hepatitis virus, parainfluenza virus.
In another preferred embodiment, the coronavirus is selected from the group consisting of: SARS-CoV-2, SARS-CoV.
In another preferred embodiment, the detection in step (b) comprises fluorescence detection.
In another preferred embodiment, the fluorescence detection method is performed by using a microplate reader or a fluorescence spectrophotometer.
In a sixth aspect of the invention, there is provided the use of a sensitising agent for the preparation of an agent for enhancing the detection signal of a target nucleic acid molecule to be detected.
In another preferred embodiment, the enhancement is an enhancement of the detection signal of the target nucleic acid molecule by the CRISPR-Cas protein.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 shows the screening of crRNA probe against the sequence of the amplification product of ORF1 ab. Amplification of ORF1ab used primer pair 2. After the amplified product was subjected to the SENA reaction, fluorescence was detected in real time using a fluorescence quantitative PCR instrument (ABI StepOne Plus) for a set time period of 30s per cycle. With crRNA1, Cas12a exhibited the highest trans-cleavage activity.
FIG. 2 shows the screening of crRNA probe for N gene amplification product sequence. The N gene was amplified using primer set 10. After the amplified product was subjected to the SENA reaction, fluorescence was detected in real time using a fluorescence quantitative PCR instrument (ABI StepOne Plus) for a set time period of 30s per cycle. With crRNA7, Cas12a exhibited the highest trans-cleavage activity.
Detailed Description
Through extensive and intensive research, the inventor develops a technical scheme for detecting the sensitized target nucleic acid through the research on the cleavage characteristics of Cas enzymes (such as Cas12a, Cas12b and Cas14 enzymes), and the scheme further detects the target nucleic acid through a sensitization reaction after the target nucleic acid molecule is amplified. Unexpectedly, the experimental result shows that the method can quickly, simply, efficiently and accurately detect pathogens such as SARS-CoV-2 and the like to the detection samples (such as throat swabs, nasal swabs and the like) which are difficult to obtain effective detection results by the detection methods such as qRT-PCR and the like originally, thereby providing powerful detection results for diagnosis or epidemic prevention. The present invention has been completed based on this finding.
According to the characteristics of the method, the special Enhancement for Nucleic Acid Amplification assays is named SENA (specific Enhancement for Nucleic Acid Amplification assays), and can be used for specific sensitization of new coronavirus PCR reaction products. The research shows that the method of the present invention is especially suitable for detecting SARS-CoV-2 virus nucleic acid molecule.
Term(s) for
The term "CRISPR" refers to clustered, regularly interspaced short palindromic repeats (clustered regular interspersed short palindromic repeats) that are the immune system of many prokaryotes.
The term "Cas protein" refers to a CRISPR-associated protein, which is a related protein in a CRISPR system.
The term "guide RNA" refers to an RNA that directs the Cas protein to specifically bind to a target nucleic acid sequence; typically comprising CRISPR RNA (i.e., crRNA) and trans-activating crRNA (i.e., tracrRNA), for some Cas proteins, such as Cas12a, only the crRNA is required to direct the Cas protein to specifically bind to the target nucleic acid.
The term "guide sequence" refers to an RNA sequence in a guide RNA that specifically pairs with a target nucleic acid.
The term "crRNA" refers to CRISPR RNA, a short guide RNA that guides Cas protein to bind to a target nucleic acid sequence.
The term "Cas 12 a" (old referred to as "Cpf 1") refers to a crRNA-dependent endonuclease, which is a type V-a (type V-a) enzyme in CRISPR system classification.
The terms "Cas 12B", "C2C 1" are used interchangeably and refer to a crRNA-dependent endonuclease, which is a type V-B (type V-B) enzyme in the classification of CRISPR systems.
The term "PAM" refers to a pro-spacer-adjacent motif (protospacer-adjacent motif) necessary for cleavage of Cas proteins, e.g., PAM of FnCas12a is TTN sequence, PAM of LbaCas12a is TTTN sequence, and PAM of AacCas12b is TTN.
The term "LAMP" is a Loop-mediated isothermal amplification (Loop-mediated isothermal amplification) technique, which is an isothermal nucleic acid amplification technique suitable for gene diagnosis.
The term "PCR" is a Polymerase chain reaction technique (Polymerase chain reaction), a technique suitable for amplification of target nucleic acids.
Detection method
The invention discloses a detection method of a target nucleic acid molecule, which is to guide RNA, Cas protein, a nucleic acid probe and a buffer solution in a reaction system containing the target nucleic acid molecule to be detected and then carry out fluorescence detection on the guide RNA, the Cas protein, the nucleic acid probe and the buffer solution.
The Cas protein is Cas12a or Cas12b or Cas 14;
the Cas12a is preferably one of FnCas12a, AsCas12a, LbaCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12 a; the Cas12a is preferably LbaCas12 a.
The Cas12b is preferably AaacCas 12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b and AcCas12 b.
The Cas14 is preferably Cas14a, Cas14b or Cas14 c.
Guide RNA refers to RNA that guides Cas protein to specifically target a DNA sequence.
The target nucleic acid molecule to be detected in the reaction system of the target nucleic acid molecule to be detected is obtained after amplification.
The detection method can detect pathogenic microorganisms, gene mutation or specific target DNA.
Use of a Cas protein in a method of detecting a target nucleic acid molecule.
When the target DNA, guide RNA and Cas protein form a ternary complex, the complex cleaves other single-stranded DNA molecules in the system.
Guide RNA refers to RNA that guides Cas protein to specifically target a DNA sequence.
Reagent kit
The invention also provides a kit which comprises a sensitizing reagent (guide RNA, Cas protein and a sensitizing nucleic acid probe). In addition, the kit of the present invention may further comprise a buffer.
The invention provides a detection method for quickly detecting a target nucleic acid molecule with high specificity. Once the target DNA (single-stranded or double-stranded), guide RNA, and trans-cleavage active Cas protein (Cas12a, Cas12b, and Cas14) form a ternary complex, the complex cleaves other single-stranded DNA molecules in the system. By adding a guide RNA and a Cas protein having trans-cleavage activity to a test system; when the target DNA exists, the Cas protein with the trans-cleavage activity, the guide RNA and the target DNA form a ternary complex, and the complex performs the trans-cleavage activity and cleaves single-stranded DNA with a fluorescent signal mark (two ends are respectively connected with a luminescent group and a quenching group, and the luminescent group can emit light after being cut), so that fluorescence is emitted. Therefore, whether the system to be detected contains the target DNA molecule can be known by detecting fluorescence. The method of the invention can be used for rapidly detecting whether the amplification solution of the sample contains the specific DNA amplification product or not, thereby deducing whether the original sample contains the specific nucleic acid sequence or not. Compared with the traditional PCR (including qPCR and qRT-PCR) technology, the detection method can greatly improve the sensitivity of target nucleic acid detection by combining CRISPR trans-cutting with the PCR technology. The nucleic acid probe of the present invention is preferably a fluorescent probe.
SENA analysis
The invention provides application of sensitization in nucleic acid detection based on Cas enzymes such as Cas12a, Cas12b and Cas 14. The following description takes Cas12a as an example.
According to studies, Cas12a has the activity of cleaving in trans, i.e., once the target DNA, crRNA, and Cas12a protein form a ternary complex, other single stranded DNA in the system is randomly cleaved. According to the principle, a SENA specific sensitization method is designed. First, the bypass DNA was designed as a fluorescent probe consisting of a random sequence of 12nt, labeled at the 5 'end with a fluorophore FAM and at the 3' end with a quencher BHQ1 (FAM-N)12-BHQ 1). Mixing a certain volume of PCR (or qPCR or qRT-PCR) amplification product with SENA reaction liquid (protecting specific crRNA and Cas12a protein), and when the system to be detected contains the amplification product of target DNA, forming a ternary complex by the crRNA and the Cas12a protein and the amplification product of the target DNA, activating the trans-cleavage activity of the Cas12a protein, and chopping a fluorescent probe in the system so as to emit fluorescence capable of being detected. The Cas protein-crRNA specific recognition amplified target DNA is used to excite the Cas protein trans-cleavage activity and cut up the single-stranded fluorescent probe to emit detectable fluorescence, which we call this method SENA.
When multiple target nucleic acids are detected simultaneously, multiple crrnas specifically targeting the target nucleic acids need to be mixed with the Cas12a protein, and then PCR (or qPCR or qRT-PCR) amplification products are added to perform the SENA reaction. When any target nucleic acid in the system is specifically amplified, the SENA can emit a fluorescence signal which can be detected.
The main advantages of the invention are:
(1) and (3) fast: when the amplification is completed, the SENA detection result can be obtained in only 10 minutes.
(2) Sensitivity: in the case that the Ct value of q (RT) -PCR is about 40 or even no Ct value is obtained, the SENA can still detect the existence of specific amplification products in the amplification system very specifically and sensitively, i.e. whether the amplification of q (RT) -PCR is specific amplification or not. Furthermore, in cases where Ct values could not be determined by q (RT) -PCR, SENA could still identify a fraction of false negative samples.
(3) Specifically: the invention uses the property of CRISPR-Cas protein to specifically bind to a target nucleic acid. Because the Cas protein has high specificity (can distinguish single-base mismatch), the invention also has very high specificity, and can strictly distinguish specific amplification from non-specific amplification.
(4) The method is simple: no special and complicated steps are needed, and the operation flow of the existing sample detection is not required to be changed; it is only necessary to take out a part of the amplification reagent after the completion of the conventional amplification and perform the SENA reaction. If the SENA is prepared into a kit and the program is set, the operation can be completed by simply adding the nucleic acid amplification product.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.
The experimental materials referred to in the present invention are commercially available without specific reference.
Material
RNAse inhibitors were purchased from TaKaRa; genes or primers(oligonucleotides) or fluorescent probes were synthesized by Shanghai; t7RNA polymerase was purchased from Thermo; rNTPs were purchased from Shanghai Producers; RNA purification and concentration kit (RNA Clean)&Concentrator (TM) -5) was purchased from Zymo Research;
SV Gel and PCR Clean-Up System was purchased from Promega; media (e.g., Tryptone, Yeast Extract, etc.) were purchased from OXOID; SARS-CoV-2RNA standard was purchased from Jingliang Gene technology (Shenzhen) GmbH; the qRT-PCR kit is purchased from Shanghai Berjie medical science and technology Limited company or a qRT-PCR premix is prepared by self-synthesis of primer and probe sequences; the LbaCas12a, Cas12b, and Cas14 proteins were produced by shanghai, open port biotechnology limited.
Guide sequence
| Sequence (5'-3') | SEQ ID No | |
| Guide sequence 1 | UGGCUGUAGUUGUGAUCAACUCC | 1 |
| |
|
2 |
| Guide sequence 3 | GCGGAGUUGAUCACAACUACAGC | 3 |
| |
|
4 |
| Guide sequence 5 | CUCUCAAGCUGGUUCAAUCUGUC | 5 |
| |
|
6 |
| Guide sequence 7 | CUUUGCUGCUGCUUGACAGAUUG | 7 |
Sequences for generating guide RNA
Example 1
1.1 SENA analysis targeting SARS-CoV-2 ORF1ab
In this example, to screen suitable guide RNAs to target the specifically amplified sequence in SARS-CoV-2 ORF1ab, the qRT-PCR amplification interval of ORF1ab was determined based on the primers recommended by Chinese CDC (see primer pair 2, SEQ ID Nos: 20 and 21) and the complementary qRT-PCR amplified Taqman fluorescent probe sequence (5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3', SEQ ID No: 8).
The following crRNA sequences were designed from the amplified sequences:
| sequence (5'-3') | SEQ ID No: | |
| crRNA guide sequence 1: | 5'-UGGCUGUAGUUGUGAUCAACUCC-3' | 1 |
| crRNA guide sequence 2: | 5'-AUCACAACUACAGCCAUAAC-3' | 2 |
| crRNA guide sequence 3: | 5'-GCGGAGUUGAUCACAACUACAGC-3' | 3 |
| crRNA guide sequence 4: | 5'-AAAACACAGUCUGUACCGUCUGC-3' | 4 |
to prepare the crRNA probe, T7-crRNA-F was annealed to a synthetic oligonucleotide to prepare a transcription template. Specifically, paired oligonucleotides (4 μ M) were annealed in 1 × PCR buffer (Tolo Biotech.) in a total volume of 50 μ L, followed by an annealing procedure: initial denaturation at 95 ℃ for 5 minutes, followed by cooling from 95 ℃ to 20 ℃ and a1 ℃ reduction per minute using a thermal cycler. crRNA was synthesized in vitro using T7RNA polymerase, and the reaction was carried out at 37 ℃ for 4-16 hours. DNase I treatment was then used to remove template DNA, and crRNA was purified using an RNA purification and concentration kit and quantified using a NanoDrop 2000C (thermo Fisher scientific). Finally, the purified guide RNA probe was diluted to a concentration of 10. mu.M and stored in a freezer at-80 ℃ for further use.
qPCR amplification was performed using the synthesized ORF1 ab-containing sequence as template and the primers and probes recommended by CDC as described above. mu.L of the qPCR amplification reaction solution was added to 18. mu.L of a pre-mixed SENA reaction system (containing LbaCas12a, different crRNAs, FAM-N) containing different crRNA sequences12BHQ1 and reaction buffer) at 37 degrees for 10 minutes, and FAM fluorescence was continuously measured.
As shown in fig. 1, the test results showed that the cleavage activity of LbaCas12a with crRNA1 was highest, and signal saturation was reached in the shortest time (3 min); the trans-cleavage activity of crRNA 2 and crRNA 3 was less than that of the crRNA, and the signal was saturated within 8 minutes; the trans-cleavage activity of crRNA 4 was minimal and signal saturation was still not achieved at 10 min. Therefore, subsequent trans-cleavage experiments all selected crRNA1 for detection of the amplification product of SARS-CoV-2 ORF1 ab.
1.2 SENA analysis of the Targeted SARS-CoV-2N Gene
Similarly, the amplification region of qRT-PCR of the N gene was determined based on the primers recommended by the Chinese CDC (see primer pair 10, SEQ ID Nos: 36 and 37) and the fluorescent probe sequence of qRT-PCR (5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3', SEQ ID No: 9).
The following guide RNA sequences were designed from the amplified sequences:
| sequence (5'-3') | SEQ ID No: | |
| crRNA guide sequence 5: | 5'-CUCUCAAGCUGGUUCAAUCUGUC-3' | 5 |
| crRNA guide sequence 6: | 5'-CUGCUGCUUGACAGAUUGAACCA-3' | 6 |
| crRNA guide sequence 7: | 5'-CUUUGCUGCUGCUUGACAGAUUG-3' | 7 |
in vitro transcription, purification, and quantification of crRNA were performed in a similar manner as described above.
qRT-PCR amplification was performed using the synthesized N gene-containing sequence as a template and the primers and probes recommended by CDC as described above. mu.L of qRT-PCR amplification reaction solution was added to 18. mu.L of a pre-mixed SENA reaction system (containing LbaCas12a, different crRNAs, FAM-N) containing different crRNA sequences12BHQ1 and reaction buffer) at 37 degrees for 10 minutes, and FAM fluorescence was continuously measured.
As shown in fig. 2, the test results show that Cas12a has the highest cleavage activity with crRNA7, and signal saturation is reached within 10 minutes; the crRNA 6 was less active in trans cleavage than the crRNA 5, and signal saturation was not reached at 10 min. Therefore, subsequent trans-cleavage experiments all selected crRNA7 for detection of the amplification product of SARS-CoV-2N gene.
Thus, based on example 1, preferred combinations of reagents that can be determined are as follows:
ORF1ab for SARS-CoV-2:
crRNA: SEQ ID No. 11 (guide sequence is SEQ ID No. 1)
For SARS-CoV-2N gene:
crRNA7 SEQ ID No. 17 (guide sequence is SEQ ID No:1)
Example 2
In this example, SARS-CoV-2RNA standard control was diluted with HEK293T total RNA in a gradient and subjected to qRT-PCR reaction and SENA sensitization reaction, respectively. Negative control and positive control are water and synthetic SARS-CoV-2 ORF1ab fragment, respectively; the qRT-PCR amplification primers and probes used are primers recommended by Chinese CDC (see primer pair 2) and matched Taqman fluorescent probes.
After qRT-PCR reaction, 2. mu.L of the reaction solution of qRT-PCR was added to 18. mu.L of the prepared SENA reaction system (LbaCas12a, crRNA1, FAM-N)12BHQ1 and reaction buffer) at 37 degrees for 10 minutes.
The results of the qRT-PCR and SENA reactions are shown in Table 1 below. Wherein, the detection sensitivity of qRT-PCR can only detect No. 5 samples, and the SENA can effectively detect No. 8 samples, which is at least 8 times higher than the sensitivity of qRT-PCR. Wherein UD indicates that qRT-PCR did not amplify a curve, and there is no effective Ct value. "-" indicates that the SENA reaction was negative; "+" indicates a positive SENA reaction.
TABLE 1 results of the gradient dilution assay of SARS-CoV-2RNA standards
Example 3
In this example, a synthetic DNA positive control containing SARS-CoV-2N gene fragment was subjected to gradient dilution with an extract from a human pharyngeal swab, and subjected to qPCR reaction and SENA sensitization reaction, respectively. The qPCR amplification primers used were the primers recommended by the Chinese CDC (see primer pair 10) and the matched Taqman fluorescent probe. After the qPCR reaction, 2. mu.L of the reaction solution of qPCR was added to a premixed 18. mu.L of SENA reaction system (LbaCas12a, crRNA7, FAM-N)12BHQ1 and reaction buffer) at 37 degrees for 10 minutes.
The results of qPCR and SENA sensitization experiments performed on the positive control samples after gradient dilution are shown in table 2 below. When the target DNA molecules in the qPCR reaction system are less than 32, the qPCR cannot obtain a stable and effective amplification Ct value. In contrast, the detection limit of SENA can reach 2 target nucleic acid molecules, that is, only 2 or more target molecules are present in the original qPCR reaction system, and SENA can be used for effective detection after amplification. Consequently, SENA is 16 times more sensitive than qPCR for detection of the target gene. Although, when using qPCR and SENA to detect different target nucleic acids, it is possible to obtain different qPCR detection limits and SENA detection limits, the SENA detection sensitivity is significantly higher than that of qPCR.
TABLE 2 results of the gradient dilution test of artificially synthesized DNA positive control of SARS-CoV-2
Discussion of the related Art
The SENA sensitization technology is a high-sensitivity, high-specificity and high-efficiency nucleic acid detection technology developed based on a CRISPR technology, and is used for further sensitization reaction of products after qPCR or qRT-PCR reaction. The detection principle is that after sample amplification is completed, CRISPR-Cas12 and specific crRNA are combined with target DNA in an amplification system to form a ternary complex, and then ssDNA trans-cleavage activity of Cas protein is activated; the trans-cleavage activity rapidly cleaves the ssDNA fluorescent reporter probe in the system to give a detectable fluorescent signal.
The SENA reaction has simple operation process, only a small amount of amplification reaction liquid needs to be taken out and added into the prepared SENA signal enhancement reaction premixed liquid, the fluorescence value is read again, and the whole reaction can be completed within 10-30 minutes. The invention has the advantages of simple operation, obvious signal amplification, high reaction speed and the like.
Through the SENA sensitization reaction, the sample with the qPCR result of 'weak positive' (the Ct value is 37-39) can be diagnosed, and even a small amount of extremely weak positive sample (the Ct value is more than or equal to 39) which is judged to be 'negative' by mistake can be found.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Claims (10)
1. A method for detecting a target nucleic acid molecule, comprising the steps of:
(a) providing a sample to be tested containing a nucleic acid amplification product, wherein the nucleic acid amplification product is an amplification product obtained by performing specific amplification based on a target nucleic acid molecule on a detection sample suspected of containing the target nucleic acid molecule;
(b) mixing the sample to be checked with a sensitizing reagent or a sensitizing buffer solution containing the sensitizing reagent to form a detection system, wherein the sensitizing reagent comprises: a guide RNA, a Cas protein, and a sensitizing nucleic acid probe, wherein the guide RNA is specific for the nucleic acid amplification product; and
(c) detecting whether the sensitized nucleic acid probe in the detection system is cleaved by the Cas protein, wherein if the sensitized nucleic acid probe is cleaved, the detection sample contains a target nucleic acid molecule; if the sensitization nucleic acid probe is not cut, the detection sample does not contain the target nucleic acid molecule.
2. The assay of claim 1, wherein the Cas protein is Cas12a or a Cas protein with similar alternative single-stranded DNA cleavage activity as Cas12 a;
alternatively, the Cas protein is Cas12b (i.e., C2C1) or a Cas protein with similar alternative single-stranded DNA cleavage activity as Cas12 b.
Alternatively, the Cas protein is Cas14 or a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas 14.
3. The detection method of claim 1, wherein the guide RNA is RNA that guides the Cas protein to specifically bind to the target DNA.
4. The detection method according to claim 1, wherein the sensitization nucleic acid probe is a single-stranded DNA or a single-stranded nucleic acid probe containing a partial DNA sequence;
preferably, the sensitization nucleic acid probe is FAM-N12BHQ1, wherein N represents either nucleotide A, T, C, or G.
5. The method according to any one of claims 1 to 4, wherein the sample to be tested is a reaction system formed by an amplification reaction of a test sample.
6. The method of detecting according to claim 5, wherein the target nucleic acid molecule is selected from the group consisting of: nucleic acid molecules of pathogenic microorganisms, genetically mutated nucleic acid molecules, and specific target nucleic acid molecules.
7. The assay of claim 1, wherein the assay sample is a nucleic acid sample prepared from a sample selected from the group consisting of: a throat swab, a nasal swab, urine, feces, body fluid, or a combination thereof.
8. A kit for detecting a target nucleic acid molecule, the kit comprising:
(a) amplification reagents for amplifying a target nucleic acid molecule, the amplification reagents comprising:
(a1) a primer pair for amplifying a target nucleic acid molecule, the primer pair for performing a specific amplification reaction based on the target nucleic acid molecule, thereby producing a specific nucleic acid amplification product;
(a2) optionally a first probe for binding to a nucleic acid amplification product in the amplification reaction, thereby generating a first detectable signal;
(a3) optionally a polymerase for the amplification reaction;
(b) a sensitizing reagent for sensitizing an amplification reaction, the sensitizing reagent comprising: a guide RNA, a Cas protein, and a sensitizing nucleic acid probe.
9. A detection system for detecting a target nucleic acid molecule, the detection system comprising:
(a) a Cas protein that is Cas12a or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12a, or Cas12b or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12b, or Cas14 or has a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas 14;
(b) a guide RNA that guides the Cas protein to specifically bind to a target nucleic acid molecule; and
(c) the nucleic acid probe with the sensitization is single-stranded DNA;
wherein, the target nucleic acid molecule is target DNA;
(d) a sample to be tested containing a nucleic acid amplification product, wherein the nucleic acid amplification product is an amplification product obtained by performing specific amplification based on the target nucleic acid molecule on a test sample suspected of containing the target nucleic acid molecule.
10. A kit for detecting a target nucleic acid molecule, the kit comprising:
(i) a first container and a Cas protein within the first container, the Cas protein being Cas12a or having a similar activity as the cleavage of bypass single-stranded DNA of Cas12a, or Cas12b or having a similar activity as the cleavage of bypass single-stranded DNA of Cas12b, or Cas14 or having a similar activity as the cleavage of bypass single-stranded DNA of Cas 14;
(ii) a second container and a guide RNA within the second container that guides the Cas protein to specifically bind to a target nucleic acid molecule;
(iii) a third container and a sensitization nucleic acid probe positioned in the third container;
(iv) a fourth vessel and amplification reagents located within the fourth vessel for amplifying the target nucleic acid molecule; and (v) optionally a fifth container and a buffer in the fifth container;
wherein the target nucleic acid molecule is a target DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010140787.7A CN113337638A (en) | 2020-03-03 | 2020-03-03 | Method and kit for detecting novel coronavirus (SARS-CoV-2) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010140787.7A CN113337638A (en) | 2020-03-03 | 2020-03-03 | Method and kit for detecting novel coronavirus (SARS-CoV-2) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113337638A true CN113337638A (en) | 2021-09-03 |
Family
ID=77467409
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010140787.7A Pending CN113337638A (en) | 2020-03-03 | 2020-03-03 | Method and kit for detecting novel coronavirus (SARS-CoV-2) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113337638A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699148A (en) * | 2021-07-15 | 2021-11-26 | 四川大学 | Ultrasensitive antibody detection method |
-
2020
- 2020-03-03 CN CN202010140787.7A patent/CN113337638A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699148A (en) * | 2021-07-15 | 2021-11-26 | 四川大学 | Ultrasensitive antibody detection method |
| CN113699148B (en) * | 2021-07-15 | 2024-01-09 | 四川大学 | Ultrasensitive antibody detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111593145B (en) | CRISPR/Cas12 one-step nucleic acid detection method and novel coronavirus detection kit | |
| US20230131421A1 (en) | Application of cas protein, method for detecting target nucleic acid molecule and kit | |
| EP2379753B1 (en) | Single-cell nucleic acid analysis | |
| CN115461476A (en) | Primer for detecting SARS-CoV-2 novel coronavirus and its kit, detection method and application | |
| KR101097560B1 (en) | Nucleic acid detection | |
| US11584955B2 (en) | Application of Cas protein, method for detecting target nucleic acid molecule and kit | |
| CN113512548A (en) | Novel coronavirus detection kit based on CRISPR-Cas12a system and application thereof | |
| JP2020533974A5 (en) | ||
| CN113337638A (en) | Method and kit for detecting novel coronavirus (SARS-CoV-2) | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| US20150140548A1 (en) | Extraction control for rna | |
| CN112980844A (en) | Detection kit for SARS-CoV-2 with transcription activity and use method | |
| US10370731B2 (en) | Compositions and methods for detection of hepatitis C virus genotype 3 | |
| JP5520449B2 (en) | Nucleic acid detection method | |
| CN116083655B (en) | DENV-crRNA for I-IV dengue virus detection, kit and application thereof | |
| EP4265741A1 (en) | Multiplexable crispr-cas9-based virus detection method | |
| WO2023282857A2 (en) | A method for detection of target nucleic acid using isothermal amplification | |
| CN117757990A (en) | Respiratory tract adenovirus typing nucleic acid detection primer combination, kit and detection method | |
| Kabir et al. | Interference of contaminating DNA in the quantification of a toluene-induced tod gene in Pseudomonas putida | |
| CN117126925A (en) | Crispr-Cas nucleic acid detection kit capable of being stored stably for long term | |
| JP2001258569A (en) | Oligonucleotide for detecting vibrio parahaemolyticus | |
| CN116356057A (en) | Bacterial detection method and system based on digital CRISPR | |
| CN114134254A (en) | Molecular logic gate intelligent detection system for detecting coronavirus and application thereof | |
| CN116891909A (en) | Detection primer probe group, kit and detection method for murine norovirus | |
| CN116694816A (en) | Isothermal multiplex detection reagent and detection method for SARS-CoV-2, influenza A virus and influenza B virus nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| CB02 | Change of applicant information |
Address after: 200032 room 246, area a, 2nd floor, 420 Fenglin Road, Xuhui District, Shanghai Applicant after: SHANGHAI TOLO BIOTECHNOLOGY Co.,Ltd. Applicant after: Shenzhen Second People's Hospital (Shenzhen Institute of translational medicine) Address before: 200032 room 246, area a, 2nd floor, 420 Fenglin Road, Xuhui District, Shanghai Applicant before: SHANGHAI TOLO BIOTECHNOLOGY Co.,Ltd. Applicant before: SHENZHEN SECOND PEOPLE'S Hospital |
|
| CB02 | Change of applicant information | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |