CN102864229A - Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni - Google Patents
Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni Download PDFInfo
- Publication number
- CN102864229A CN102864229A CN2012103563752A CN201210356375A CN102864229A CN 102864229 A CN102864229 A CN 102864229A CN 2012103563752 A CN2012103563752 A CN 2012103563752A CN 201210356375 A CN201210356375 A CN 201210356375A CN 102864229 A CN102864229 A CN 102864229A
- Authority
- CN
- China
- Prior art keywords
- primer
- campylobacter jejuni
- lamp
- test kit
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni. The LAMP kit is composed of LAMP reaction liquid, a standard positive template and a negative quality control standard substance. The LAMP reaction liquid contains a Bst DNA polymerase big fragment, a primer, LAMP10*buffer, dNTPs solution, MgSO4 solution and glycine betaine. The primer is divided into a forward primer and a reverse primer. The LAMP kit has the advantages of being good in specificity, high in sensitivity, rapid and convenient, high in repeatability, capable of judging results by using eyes and the like, can conduct rapid qualitative detection on campylobacter jejuni in foods, and can replace continuously-used traditional culture method and serological diagnosis method.
Description
Technical field
The present invention relates to the LAMP agent box of a kind of rapid detection campylobacter jejuni, belong to the food inspection field.
Background technology
Campylobacter jejuni (c.jejuni) thalline hettocyrtosis is like teasing point-like, long 1.5～5 μ m, wide 0.2～0.8 μ m.Thalline one or both ends amphitrichous, motion is active, seemingly flies fly at the dark-field Microscopic observation.Pod membrane is arranged, do not form the brood cell.Microaerobe, growth is best in the environment that contains 2.5～5% oxygen and 10%CO2.Optimum temperuture is 37～42 ℃.In normal atmospheric or oxygen-free environment, all can not grow.The jejunum campylobacter mattress is a kind of infecting both domestic animals and human disease pathogen mattress, can cause the humans and animals many diseases, and is a kind of borne Parasitic Encephalopathy cause of disease mattress, is considered to cause the major cause of the human bacterial diarrhea in the whole world.Campylobacter jejuni has intracellular toxin to attack small intestine and colorectal mucosa causes acute enteritis, also can cause outbreak of epidemic or the mass food poisoning of diarrhoea.Being generally 3～5 days latent period, is jejunum, ileum and colon to people's pathogenic position.Cardinal symptom is diarrhoea and stomachache, sometimes heating, and idol has vomiting and dehydration.Therefore, in the food sanitation Micro biological Tests, must be paid attention to.
The ring mediated isothermal amplification that development in recent years is got up (loop-mediated isothermal amplification, the advantages such as LAMP) technology is highly sensitive with it, speed fast, high specificity are being used widely aspect the gene qualitative detection, and have become one of important method of current viral nucleic acid qualitative detection.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology is a kind of novel isothermal nucleic acid amplification method, this method is for 4 special primers of 6 zone design of target gene, utilize a kind of archaeal dna polymerase (Bst archaeal dna polymerase) with strand displacement activity, at the about 60min of constant temperature (about 65 ℃) insulation, can finish nucleic acid amplification reaction, produce macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.This technology has does not need PCR instrument, amplified production not to need to uncap, and it is short with the naked eye to get final product judged result and reaction times, high specificity, the advantages such as sensitivity height.
The cultural method of traditional detection campylobacter jejuni needs separation, screening and biochemical identification, also needs in case of necessity serological identification, is generally 4～6d, wastes time and energy, and has the shortcomings such as sensitivity is low, poor specificity, false positive, time and effort consuming.Various conventional PCR method have the advantages such as susceptibility is strong, specificity is high, easy, quick, the report that has more application to detect in campylobacter jejuni, but owing to exist the PCR aftertreatment to produce the problem such as false positive that pollution causes and the special plant and instrument of needs has limited its application in grass-roots unit.Yin Ci Qi accurate, sensitive, quick, free of contamination Clinical Laboratory method to be developed.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiency that prior art exists, and LAMP test kit and the using method thereof of a kind of rapid detection campylobacter jejuni is provided.
For achieving the above object, the present invention by the following technical solutions:
The LAMP test kit of a kind of rapid detection campylobacter jejuni, this test kit comprises: a) LAMP reaction solution, b) standard positive template, c) negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 5 group-specific primerses:
(1) upstream outer primer F3:5 '-TGTAATGCATGCTTGCGG-3 '; (SEQ ID No.1)
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 '; (SEQ ID No.2)
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTTCATGATGGACATACTACTTCT-3′；（SEQ ID No.3）
Downstream inner primer BIP:5 '-
TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3′；（SEQ ID No.4）
(2) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 '; (SEQ ID No.5)
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 '; (SEQ ID No.6)
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTGATGGACATACTACTTCTTTATTGC-3′；
（SEQ ID No.7）
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
（SEQ ID No.8）
(3) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 '; (SEQ ID No.9)
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 '; (SEQ ID No.10)
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGC-3′；
（SEQ ID No.11）
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
（SEQ ID No.12）
(4) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 '; (SEQ ID No.13)
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 '; (SEQ ID No.14)
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGCT-3′；
（SEQ ID No.15）
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
（SEQ ID No.16）
(5) upstream outer primer F3:5 '-GCAAAGTATTTAGCAAGTCAGAA-3 '; (SEQ ID No.17)
Downstream outer primer B3:5 '-ACTTCAATGCTATAACTATCCG-3 '; (SEQ ID No.18)
Upstream inner primer FIP:
5′-CATTGCCTTAGCACCACCCAGGCACTCTAAATCTTTATTTTCAAC-3′；（SEQ ID No.19）
Downstream inner primer BIP:5 '-AGTGATTATGTTTTTGGATGGCACAAAGAAGCCATCATCGCAC-3 ';
（SEQ ID No.20）
Specifically,
A) LAMP reaction solution
The LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.In a concrete scheme of the present invention, the LAMP reaction solution is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs3.0 μ l, 50mmol/L MgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
B) standard positive template
Standard positive template is the pMD18-T-hipO carrier that contains the nucleotide fragments formation of 314 base pairs of campylobacter jejuni high conservative gene hipO gene, and this carrier can be bred in bacillus coli DH 5 alpha.
The nucleotides sequence of hipO gene is classified as:
5′-CCTTATAAAAGCAAAAAAGAAAATGTAATGCATGCTTGCGGTCATGATGGACATACTACTTCTTTATTGCTTGCTGCAAAGTATTTAGCAAGTCAGAATTTTAATGGTACTCTAAATCTTTATTTTCAACCTGCTGAAGAGGGCTTGGGTGGTGCTAAGGCAATGATAGAAGATGGATTGTTTGAAAAATTTGATAGTGATTATGTTTTTGGATGGCACAATATGCCTTTTGGTAGCGATAAGAAATTTTATCTTAAAAAAGGTGCGATGATGGCTTCTTCGGATAGTTATAGCATTGAAGTTATTGGAAGAGG-3′。（SEQ ID No.21）
Testing used standard substance is the plasmid pMD18-T-hipO that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
The principle of work of this test kit:
Use quick visualization provided by the invention to detect campylobacter jejuni LAMP test kit, the about 60min of (about 65 ℃) insulation under constant temperature, can finish nucleic acid amplification reaction, and supervene macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.After reaction finishes, the centrifugal 30s of 12000r/min, pipe end white precipitate can detect by an unaided eye.In rapid detection campylobacter jejuni LAMP test kit provided by the invention, for the singularity in the campylobacter jejuni detection, different target fragments is carried out reaction system, such as primer, dNTPs, Mg
2The optimization of+concentration, trimethyl-glycine etc., pass through prioritization scheme, repeatedly experiment, set up the loop-mediated isothermal amplification method that detects campylobacter jejuni, and develop the LAMP test kit that detects campylobacter jejuni, the sensitivity of this test kit can detect 10 copies in each reaction system, can satisfy the requirement of rapid detection campylobacter jejuni.
Use LAMP test kit of the present invention to detect the method for campylobacter jejuni, may further comprise the steps:
1. use buffered peptone water (BPW) to cultivate sample 1-4h to be checked according to National Standard Method;
2. from testing sample, extract DNA with water-boiling method;
3. DNA is joined in the reaction system of LAMP test kit 65 ℃ of insulation 1h;
4. after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
The rapid detection campylobacter jejuni LAMP test kit that provides among the present invention can carry out qualitative detection to campylobacter jejuni, and alternative traditional culture method of always continuing to use and serum method detection method.The present invention compared with prior art has the following advantages and effect:
1, compare with culture-based method, detection speed is fast, and only 1h adds the extraction preparation of sample DNA, altogether is no more than 5h.
2, specificity is good, and is highly sensitive;
3, step is simple, and is repeatable high;
4, can carry out simultaneously a plurality of sample detection.
Description of drawings
Fig. 1 is the centrifugal rear observation white precipitate result of embodiment 1 jejuni, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 2 is embodiment 1 jejuni 1.5% agarose gel electrophoresis detected result figure, among the figure:
M-DNA Marker, 1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 3 is the centrifugal rear observation white precipitate results of embodiment 2 jejunis, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 4 is the centrifugal rear observation white precipitate results of embodiment 3 jejunis, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 5 is the centrifugal rear observation white precipitate results of embodiment 4 jejunis, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 6 is the centrifugal rear observation white precipitate results of embodiment 5 jejunis, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni positive sample, 4-campylobacter jejuni positive sample, 5-campylobacter jejuni positive sample, 6-campylobacter jejuni negative sample, 7-campylobacter jejuni negative sample, 8-campylobacter jejuni negative sample;
Fig. 7 is embodiment 6 jejuni LAMP test kit specificity experimental observation white precipitate results, among the figure:
1-standard positive template, 2-negative control, 3-campylobacter jejuni sample, 4-Listeria Monocytogenes sample, 5-shigella dysenteriae sample, 6-Salmonella paratyphi A sample, 7-streptococcus aureus sample, 8-intestinal bacteria sample;
Fig. 8 is that embodiment 7 jejuni LAMP test kit sensitivity experiments are observed the white precipitate result, among the figure:
1-dilution 10
-1Doubly, 2-dilution 10
-2Doubly, 3-dilution 10
-3Doubly, 4-dilution 10
-4Doubly, 5-dilution 10
-5Doubly, 6-dilution 10
-6Doubly, 7-dilution 10
-7Doubly, 8-dilution 10
-8Doubly, 9-dilution 10
-9Doubly, 10-dilution 10
-10Doubly.
Embodiment
Below in conjunction with the implementation example, further set forth the present invention.Be to be understood that, these embodiments only are used for explanation the present invention and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition such as chief editors such as J. Pehanorm Brookers, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
Embodiment 1: Novel visual rapid detection campylobacter jejuni LAMP test kit forms and preparation
Reagent forms:
A) LAMP reaction mixture
The LAMP reaction mixture is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs 3.0 μ l, 50mmol/LMgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
Wherein primer sequence is as follows:
Upstream outer primer F3:5 '-TGTAATGCATGCTTGCGG-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:5 '-
AGTGCCATTAAAATTCTGACTTGCTTCATGATGGACATACTACTTCT-3′；
Downstream inner primer BIP:5 '-
TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3′；
B) standard positive template
Standard positive template pMD18-T-hipO is the pMD18-T-hipO carrier that contains the nucleotide fragments formation of 314 base pairs of campylobacter jejuni high conservative gene hipO gene, and this carrier can be bred in bacillus coli DH 5 alpha; Testing used standard substance is the plasmid pMD18-T-hipO that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
2. use described PCR test kit based on loop-mediated isothermal amplification technique rapid detection industrial food jejuni to detect the method for campylobacter jejuni, may further comprise the steps:
A, foodstuff samples pre-treatment: get 3 portions of positive food of campylobacter jejuni of identifying through culture-based method, 3 portions of negative food of campylobacter jejuni, take by weighing respectively the 25g sample and put into the aseptic homogeneous cup that fills 225mL BPW, with 8000r/min～10000r/min homogeneous 1min～2min, or place the aseptic homogenizing bag that fills 225mL BPW, pat 1min～2min with slap type homogenizer.If sample is liquid, do not need homogeneous, the vibration mixing gets final product.Aseptic technique goes to sample in the 500mL Erlenmeyer flask, as using homogenizing bag, can directly cultivate, and cultivates 1-4h in 36 ℃ ± 1 ℃.As be frozen prods, should thaw being no more than 15min below 45 ℃.
The preparation of b, bacterium template DNA: get respectively 100 μ L bacterial culturess, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
C, LAMP reaction: get respectively 5 μ l b) the sample supernatant joins in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min in the step.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
D, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 1).Get 5 μ l LAMP products and detect with 1.5% agarose gel electrophoresis, positive sample has band, and negative sample is then without band (seeing accompanying drawing 2).Accompanying drawing 1 is centrifugal rear observation white precipitate result, and accompanying drawing 2 is 1.5% agarose gel electrophoresis detected result.
E, conclusion: revision test is 3 times repeatedly, and the gained detected result is identical, and experimental group all has precipitation or electrophoretic band, and control group is all without precipitation or electrophoretic band, and is consistent with expected results.It is respond well to illustrate that this test kit detects campylobacter jejuni, and the precipitation observation is consistent with electrophoresis detection method effect, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 2:
1. novel quick visualization detects campylobacter jejuni LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTGATGGACATACTACTTCTTTATTGC-3′；
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on loop-mediated isothermal amplification technique rapid detection industrial food jejuni to detect campylobacter jejuni are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 3), and is consistent with expected results.It is respond well to illustrate that this test kit detects campylobacter jejuni, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 3:
1. novel quick visualization detects campylobacter jejuni LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:5 '-
AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGC-3′；
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on loop-mediated isothermal amplification technique rapid detection industrial food jejuni to detect campylobacter jejuni are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 4), and is consistent with expected results.It is respond well to illustrate that this test kit detects campylobacter jejuni, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 4:
1. novel quick visualization detects campylobacter jejuni LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGCT-3′；
Downstream inner primer BIP:5 '-TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on loop-mediated isothermal amplification technique rapid detection industrial food jejuni to detect campylobacter jejuni are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 5), and is consistent with expected results.It is respond well to illustrate that this test kit detects campylobacter jejuni, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 5:
1. novel quick visualization detects campylobacter jejuni LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-GCAAAGTATTTAGCAAGTCAGAA-3 ';
Downstream outer primer B3:5 '-ACTTCAATGCTATAACTATCCG-3 ';
Upstream inner primer FIP:
5′-CATTGCCTTAGCACCACCCAGGCACTCTAAATCTTTATTTTCAAC-3′；
Downstream inner primer BIP:5 '-AGTGATTATGTTTTTGGATGGCACAAAGAAGCCATCATCGCAC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on loop-mediated isothermal amplification technique rapid detection industrial food jejuni to detect campylobacter jejuni are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 6), and is consistent with expected results.It is respond well to illustrate that this test kit detects campylobacter jejuni, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 6: based on the specificity experiment of the PCR test kit of loop-mediated isothermal amplification technique rapid detection industrial food jejuni
The preparation of a, dna profiling: the campylobacter jejuni of the DNA validation verification of learning from else's experience respectively, Listeria Monocytogenes, shigella dysenteriae, Salmonella paratyphi A, streptococcus aureus, colibacillary bacterium liquid 10 μ l, the centrifugal 2min of 12000r/min, remove supernatant, add 50 μ L sterilized waters, abundant mixing, 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get respectively 5 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
C, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 7).Accompanying drawing 7 is campylobacter jejuni LAMP test kit specificity experimental observation white precipitate result.
D, conclusion: the result shows to only have positive controls and campylobacter jejuni adularescent precipitation, and Listeria Monocytogenes, shigella dysenteriae, Salmonella paratyphi A, streptococcus aureus, intestinal bacteria and negative control do not have white precipitate.
Above-mentioned this test kit of description of test has good specificity.
Embodiment 7: rapid detection campylobacter jejuni LAMP test kit sensitivity experiment
A, the jejunum campylobacter bacteria culture fluid of getting the 1ml incubated overnight are done 10 times of doubling dilutions, are diluted to 10
-9Get each dilution bacterium liquid 10 μ l, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get 5 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.
C, result judge: whether reaction produces white precipitate at the bottom of the centrifugal 30s observation tube of 12000r/min after finishing, and the result shows 10
-1-10
-8Equal adularescent precipitation at the bottom of the sample tube, 10
-9-10
-10Then there is not white precipitate (seeing accompanying drawing 8) at the bottom of the sample tube.Accompanying drawing 8 is that campylobacter jejuni LAMP test kit sensitivity experiment is observed the white precipitate result.
D, conclusion: the result shows that working as bacterium liquid is diluted to 10
-8In time, still can detect, and the lowest detection limit is 50CFU/ml.
Above-mentioned this test kit of description of test has good sensitivity.
Can illustrate from above-mentioned example, LAMP detection method specificity is good, highly sensitive, good reproducibility, easy and simple to handle, and the LAMP detection kit only needs just can finish less than 5 hours to the detection of sample, and traditional culture method just can be finished about 1 week of need approximately, therefore, use this test kit greatly to shorten detection time.
The operation of this test kit only needs 1 people can finish whole operating process, once can detect a plurality of (being needed to determine by the reality detection) sample, has so also reduced the waste of manpower.
SEQUENCE LISTING
＜110〉the true good fortune medical sci-tech in Wuhan Development Co., Ltd
＜120〉the LAMP test kit of rapid detection campylobacter jejuni
<130>
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 1
tgtaatgcat gcttgcgg 18
<210> 2
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 2
gccatccaaa aacataatca ct 22
<210> 3
<211> 47
<212> DNA
＜213〉artificial sequence
<400> 3
agtgccatta aaattctgac ttgcttcatg atggacatac tacttct 47
<210> 4
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 4
ttcaacctgc tgaagagggt caaacaatcc atcttctatc attg 44
<210> 5
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 5
taatgcatgc ttgcggtc 18
<210> 6
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 6
gccatccaaa aacataatca ct 22
<210> 7
<211> 50
<212> DNA
＜213〉artificial sequence
<400> 7
agtgccatta aaattctgac ttgctgatgg acatactact tctttattgc 50
<210> 8
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 8
ttcaacctgc tgaagagggt caaacaatcc atcttctatc attg 44
<210> 9
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 9
taatgcatgc ttgcggtc 18
<210> 10
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 10
gccatccaaa aacataatca ct 22
<210> 11
<211> 49
<212> DNA
＜213〉artificial sequence
<400> 11
agtgccatta aaattctgac ttgctatgga catactactt ctttattgc 49
<210> 12
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 12
ttcaacctgc tgaagagggt caaacaatcc atcttctatc attg 44
<210> 13
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 13
taatgcatgc ttgcggtc 18
<210> 14
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 14
gccatccaaa aacataatca ct 22
<210> 15
<211> 50
<212> DNA
＜213〉artificial sequence
<400> 15
agtgccatta aaattctgac ttgctatgga catactactt ctttattgct 50
<210> 16
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 16
ttcaacctgc tgaagagggt caaacaatcc atcttctatc attg 44
<210> 17
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 17
gcaaagtatt tagcaagtca gaa 23
<210> 18
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 18
acttcaatgc tataactatc cg 22
<210> 19
<211> 45
<212> DNA
＜213〉artificial sequence
<400> 19
cattgcctta gcaccaccca ggcactctaa atctttattt tcaac 45
<210> 20
<211> 43
<212> DNA
＜213〉artificial sequence
<400> 20
agtgattatg tttttggatg gcacaaagaa gccatcatcg cac 43
<210> 21
<211> 314
<212> DNA
＜213〉campylobacter jejuni
<400> 21
ccttataaaa gcaaaaaaga aaatgtaatg catgcttgcg gtcatgatgg acatactact 60
tctttattgc ttgctgcaaa gtatttagca agtcagaatt ttaatggtac tctaaatctt 120
tattttcaac ctgctgaaga gggcttgggt ggtgctaagg caatgataga agatggattg 180
tttgaaaaat ttgatagtga ttatgttttt ggatggcaca atatgccttt tggtagcgat 240
aagaaatttt atcttaaaaa aggtgcgatg atggcttctt cggatagtta tagcattgaa 300
gttattggaa gagg 314
Claims (4)
1. the LAMP test kit of a rapid detection campylobacter jejuni is characterized in that: be comprised of LAMP reaction solution, standard positive template, negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 5 group-specific primerses:
(1) upstream outer primer F3:5 '-TGTAATGCATGCTTGCGG-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTTCATGATGGACATACTACTTCT-3′；
Downstream inner primer BIP:5 '-
TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3′；
(2) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTGATGGACATACTACTTCTTTATTGC-3′；
Downstream inner primer BIP:5 ' TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
(3) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGC-3′；
Downstream inner primer BIP:5 ' TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
(4) upstream outer primer F3:5 '-TAATGCATGCTTGCGGTC-3 ';
Downstream outer primer B3:5 '-GCCATCCAAAAACATAATCACT-3 ';
Upstream inner primer FIP:
5′-AGTGCCATTAAAATTCTGACTTGCTATGGACATACTACTTCTTTATTGCT-3′；
Downstream inner primer BIP:5 ' TTCAACCTGCTGAAGAGGGTCAAACAATCCATCTTCTATCATTG-3 ';
(5) upstream outer primer F3:5 '-GCAAAGTATTTAGCAAGTCAGAA-3 ';
Downstream outer primer B3:5 '-ACTTCAATGCTATAACTATCCG-3 ';
Upstream inner primer FIP:
5′-CATTGCCTTAGCACCACCCAGGCACTCTAAATCTTTATTTTCAAC-3′；
Downstream inner primer BIP:5 '-AGTGATTATGTTTTTGGATGGCACAAAGAAGCCATCATCGCAC-3 '.
2. LAMP test kit according to claim 1 is characterized in that, the LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.
3. LAMP test kit according to claim 1 and 2.It is characterized in that positive template is the pMD18-T-hipO carrier that contains the nucleotide fragments formation of 314 base pairs of campylobacter jejuni high conservative gene hipO gene, the nucleotide sequence of hipO gene is shown in SEQ ID No.21.
4. right to use requires 1～3 described LAMP test kit to detect the method for campylobacter jejuni, it is characterized in that, may further comprise the steps:
1. cultivate sample 1-4h to be checked with buffered peptone water according to National Standard Method;
2. from testing sample, extract DNA with water-boiling method;
3. DNA is joined in the reaction system of LAMP test kit 65 ℃ of insulation 1h;
4. after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103563752A CN102864229A (en) | 2012-09-21 | 2012-09-21 | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103563752A CN102864229A (en) | 2012-09-21 | 2012-09-21 | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102864229A true CN102864229A (en) | 2013-01-09 |
Family
ID=47443354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103563752A Pending CN102864229A (en) | 2012-09-21 | 2012-09-21 | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102864229A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104846078A (en) * | 2015-04-14 | 2015-08-19 | 江苏出入境检验检疫局动植物与食品检测中心 | Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative |
| CN106367516A (en) * | 2016-09-28 | 2017-02-01 | 扬州大学 | Loop-mediated isothermal amplification kit detecting campylobacter jejuni and detection method |
| CN111020044A (en) * | 2020-01-10 | 2020-04-17 | 上海海关动植物与食品检验检疫技术中心 | Primer combination and kit for detecting campylobacter jejuni |
| CN115679007A (en) * | 2022-11-24 | 2023-02-03 | 贵州省畜牧兽医研究所 | On-site visual RPA-LFD rapid detection kit for bovine-derived campylobacter in beef cattle slaughter house |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101255459A (en) * | 2008-03-25 | 2008-09-03 | 山东出入境检验检疫局检验检疫技术中心 | Preparation and detection method of jejunum vibrio coli rapid detection reagent kit |
-
2012
- 2012-09-21 CN CN2012103563752A patent/CN102864229A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101255459A (en) * | 2008-03-25 | 2008-09-03 | 山东出入境检验检疫局检验检疫技术中心 | Preparation and detection method of jejunum vibrio coli rapid detection reagent kit |
Non-Patent Citations (2)
| Title |
|---|
| 徐义刚等: "应用DNA环介导恒温扩增技术快速检测空肠弯曲菌", 《中国农业科技》 * |
| 王艳玲: "空肠弯曲菌检测方法研究进展", 《职业与健康》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104846078A (en) * | 2015-04-14 | 2015-08-19 | 江苏出入境检验检疫局动植物与食品检测中心 | Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative |
| CN106367516A (en) * | 2016-09-28 | 2017-02-01 | 扬州大学 | Loop-mediated isothermal amplification kit detecting campylobacter jejuni and detection method |
| CN106367516B (en) * | 2016-09-28 | 2019-08-23 | 扬州大学 | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni |
| CN111020044A (en) * | 2020-01-10 | 2020-04-17 | 上海海关动植物与食品检验检疫技术中心 | Primer combination and kit for detecting campylobacter jejuni |
| CN115679007A (en) * | 2022-11-24 | 2023-02-03 | 贵州省畜牧兽医研究所 | On-site visual RPA-LFD rapid detection kit for bovine-derived campylobacter in beef cattle slaughter house |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102864228A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus | |
| CN106967816B (en) | RPA specific primer for detecting vibrio parahaemolyticus in food, kit and application | |
| CN102864226A (en) | LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN102851381A (en) | LAMP kit for rapid detection of Listeria monocytogenes | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN102851382A (en) | LAMP kit for rapid detection of Shigella | |
| CN102864229A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN104342496B (en) | A kind of quick detection, identify that Liszt belongs to the method for bacterium | |
| Zhang et al. | Rapid and sensitive detection of Staphylococcus aureus via an all-in-one staggered strand exchange amplification platform | |
| CN109355407A (en) | A kind of primer, kit and its method of PSR isothermal amplification detection pseudomonas aeruginosa | |
| Mu et al. | Detection of Brucella S2 vaccine strain by a loop-mediated isothermal amplification (LAMP) method | |
| CN109355408A (en) | A kind of primer, kit and its method of PSR detection Escherichia coli type I shiga toxin | |
| CN104561263A (en) | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification | |
| CN106987644A (en) | A kind of LAMP detections primer sets and detection method for being used to detect staphylococcus aureus | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| Vera-Salmoral et al. | Optimization of real-time PCR protocols from lymph node bovine tissue for direct detection of Mycobacterium tuberculosis complex | |
| CN105200045A (en) | Nucleotides specific to vibrio fluvialis O11, O14, O16 and O17 as well as application of nucleotides | |
| CN105200044A (en) | Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides | |
| CN106167836B (en) | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130109 |