CN106167836B - Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus - Google Patents
Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus Download PDFInfo
- Publication number
- CN106167836B CN106167836B CN201610767983.0A CN201610767983A CN106167836B CN 106167836 B CN106167836 B CN 106167836B CN 201610767983 A CN201610767983 A CN 201610767983A CN 106167836 B CN106167836 B CN 106167836B
- Authority
- CN
- China
- Prior art keywords
- primer
- plants
- fluorescence
- seq
- beads
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of while 4 plants of rat parvovirus of detection multi-fluorescence analysis methods and kit.The present invention is easy to operate, obtains target amplification segment by PCR, then hybridizes amplified production, fluorescence-encoded micro-beads and Streptavidin phycoerythrin, then reads MFI values by detector, offer an explanation different types of cause of disease.The method of the present invention, can detection and identification rat parvovirus RMV, KRV, H 1 and PRV 1a, and with high specificity simultaneously, high sensitivity, it is reproducible the advantages that, it can be achieved that a variety of different molecules of interest in same sample are carried out at the same time detection.Flexibility of the present invention is good, can add and subtract the type of detection cause of disease on this basis as needed.
Description
Technical field
The invention belongs to the Pathogen test fields of experimental animal, and in particular to a kind of to detect 4 plants of rat parvovirus simultaneously
（RMV, KRV, H1 and RPV-1a）Multi-fluorescence analysis method.
Background technology
Rat parvovirus (Rat parvovirus) is to endanger one of virus the most serious to experimental rat, can
Kind of mouse group's breeding potential is caused to decline, infected mice can also by excrement outside toxin expelling for a long time, pollution feed, drinking-water and ambient enviroment, and
Susceptible animal is re-infected, rat parvovirus is caused persistently to exist in mouse group.Rat parvovirus can also pollute tumour shifting
Plant and cell line generate severe jamming to experimental study.
By current, 4 plants of rat parvovirus RMV, KRV, H-1 and RPV-1a, the KRV of mid-early stage identification are isolated
It is one of SPF grades of latent rat virus essential items for inspection in experimental animal national standard (14922. 2- 2011 of GB) with H-1 plants.Serology
Method is the common method of current diagnosis experimental rat parvovirus infections, serological method packet specified in experimental animal national standard
Include enzyme-linked immunosorbent assay (ELISA), immuno-enzymatic test (IEA), immunofluorescent test (IFA) and hemagglutination-inhibition test
(HIA), ELISA or IFA is commonly used as large-scale screening, and HIA is generally used to do confirmatory test.ELISA and IFA are quick
Perception is higher, but since parvoviral nonstructural proteins are than more conservative, can generate the cross reaction between antibody, thus the spy of method
The opposite sex is poor, can not distinguish the parvovirus of different plant type.Meanwhile there is " window phase " in serological method, also do not apply to disease
Poison acute infection and serum between animal have not occurred the situation that sun turns.PCR method with its higher sensitivity and specificity
Through the detection for being widely used in virus.The PCR method initially set up can identify KRV, but can not be distinguished with H-1, subsequently again
There is the special primer that researcher has separately designed H-1 and KRV, the two can be distinguished, but there is still a need for be divided into two reaction systems
It identifies.There is the PCR detection method that laboratory establishes H-1 plants and KRV plants of rat parvovirus recently, specificity is good, sensitive
Degree is high, can detect simultaneously in same reaction system and distinguish H-1 and KRV, improve detection efficiency.But either substance is also
It is double PCR technology, result judgement is required for gel electrophoresis, time-consuming and laborious, encounters the big feelings of sample size in practical applications
Condition, it is difficult to meet detection demand.
In addition, with the discovery of the new strains of RMV and RPV-1a, to rat parvovirus, day is also put in the detection of each plant type
Journey.The country yet there are no a kind of method that can detect and distinguish simultaneously 4 plants of rat parvovirus at present, also there are no using multiple
Fluorescence analysis method detects the report of rat parvovirus.
Invention content
RMV plants, KRV plants, H1 plants of rat parvovirus and RPV-1a are detected the purpose of the present invention is to provide a kind of simultaneously
The multi-fluorescence analysis primer of strain.
Another object of the present invention is to provide it is a kind of and meanwhile detect RMV plants, KRV plants, H1 plants of rat parvovirus and
RPV-1a plants of multi-fluorescence assay kit.
It is still another object of the present invention to provide it is a kind of detect simultaneously RMV plants, KRV plants, H1 plants of rat parvovirus and
RPV-1a plants of multi-fluorescence analysis method.
The technical solution used in the present invention is：
Multi-fluorescence analysis primer that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
The primer nucleotide sequences are as follows：
Primer M1：ACACCATGCCAACTGCAGATG（SEQ ID NO：1）,
Primer M2：ATTGTTCACTCCCTGTGTTTGTGTT （SEQ ID NO：2）；
Primer K1：AACCAGACGCTGGAATCGCTAA（SEQ ID NO：3）,
Primer K2：TGTAGCAGTCTAGATGCATGA（SEQ ID NO：4）；
Primer H1：CTCTAGCAACTCTGCTGAAG（SEQ ID NO：5）,
Primer H2：CAGTTATTCCTTGGAGGCAT（SEQ ID NO：6）；
Primer P1：GATGATAAGCGGTTCAGGG（SEQ ID NO：7）,
Primer P2：AAGAGCTCCGGTATCTCTGTC（SEQ ID NO：8）.
Further, the 5 ' ends of described wherein one primer of primer M1 and M2 are biotinylated；
5 ' the ends of described wherein one primer of primer K1 and K2 are biotinylated；
5 ' the ends of described wherein one primer of primer H1 and H2 are biotinylated；
5 ' the ends of described wherein one primer of primer P1 and P2 are biotinylated.
Further, the 5 ' of primer not be biotinylated in the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
End is connected with tag sequences, and the tag sequences can be with the anti-tag sequence complementary pairings that are carried in fluorescence-encoded micro-beads.
Further, the tag sequences connected in this 4 groups of primer pairs of the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
Column selection is from SEQ ID NO:Tag sequences shown in 9 ~ 12, and the tag sequences connected in 4 groups of primer pairs are different.
Multi-fluorescence analytical reagent that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus
Box contains primer described above in the kit.
Further, also containing streptavidin-phycoerythrin compound, the different fluorescence of 4 kinds of codings in mentioned reagent box
The fluorescence-encoded micro-beads of color.
Further, also containing the anti-tag sequences with tag sequences complementary pairing in primer in the fluorescence-encoded micro-beads
Row, it is different to encode the anti-tag sequences contained in the fluorescence-encoded micro-beads of different iridescent.
Multi-fluorescence analysis method that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
Include the following steps：
1）Viral DNA is extracted from sample；
2）Using the viral DNA of extraction as template, PCR amplification is carried out with any of the above-described primer；
3）By upper step amplified production, the fluorescence-encoded micro-beads of the different iridescent of 4 kinds of codings, streptavidin-phycoerythrin
Hybridized；
4）After hybridization, analysis is detected hybrid product by Luminex systems, determines the type of its virus；
The above method is used for the diagnose and treat of non-disease.
Further, step 2）The reaction system of middle PCR amplification is：
Premix Ex Taq™ Hot Start Version 7.5µL
2 μ L of primer mixed liquor
1 μ L of DNA profiling
ddH2O 4.5µL
Total 15µL；
Step 2）The response procedures of middle PCR amplification are：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 60 DEG C of 25s that anneal, 72
DEG C extension 15s；Cycle 35 times；72 DEG C extend 7min eventually.
Further, step 3）Described in the reaction system that hybridizes and program be：
3 kinds of 20 μ L of fluorescence-encoded micro-beads
75 μ L of streptavidin-phycoerythrin
5 μ L of amplified production
100 μ L of total volume；42 DEG C of reaction 25min.
The beneficial effects of the invention are as follows：
1）The present invention realizes while RMV plants of parvovirus of 4 plants of rat, KRV plants, H1 plants and RPV-1a plants is examined
Survey, the present invention by specific PCR obtain target amplification segment, then by amplified production, fluorescence-encoded micro-beads and Streptavidin-
Phycoerythrin（SA-PE）Hybridized, when then reading MFI values by detector, differentiate the rat parvovirus of different plant type.
2）The method of the present invention simultaneously can accurately detect, and high specificity 4 plants of parvovirus of rat, sensitivity
Height, it is reproducible.Compared with traditional detection method, the method for the present invention is realized to a variety of different molecules of interest in same sample
Detection is carried out at the same time, sample dosage is few, easy to operate, quick, can substantially reduce testing cost.The present invention can guarantee identical answer
Warm-natured degree and hybridization efficiency, and effectively avoid crisscrossing between the microballoon of different testing sample label.
Description of the drawings
Fig. 1 is the PCR electrophoretograms of 4 plants of RMV, KRV, H-1 and PRV-1a plants of rat parvovirus；
Fig. 2 is the multi-fluorescence analysis method test experience result figure of 4 plants of rat parvovirus；
Fig. 3 is the multi-fluorescence analysis method detection specificity experiments result figure of 4 plants of rat parvovirus；
Fig. 4 is the multi-fluorescence analysis method detection sensitivity experimental result picture of 4 plants of rat parvovirus；
Fig. 5 is the multi-fluorescence analysis method clinical detection experimental result picture of 4 plants of rat parvovirus.
Specific embodiment
Multi-fluorescence analysis primer that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
The primer nucleotide sequences are as follows：
Primer M1：ACACCATGCCAACTGCAGATG（SEQ ID NO：1）,
Primer M2：ATTGTTCACTCCCTGTGTTTGTGTT （SEQ ID NO：2）；
Primer K1：AACCAGACGCTGGAATCGCTAA（SEQ ID NO：3）,
Primer K2：TGTAGCAGTCTAGATGCATGA（SEQ ID NO：4）；
Primer H1：CTCTAGCAACTCTGCTGAAG（SEQ ID NO：5）,
Primer H2：CAGTTATTCCTTGGAGGCAT（SEQ ID NO：6）；
Primer P1：GATGATAAGCGGTTCAGGG（SEQ ID NO：7）,
Primer P2：AAGAGCTCCGGTATCTCTGTC（SEQ ID NO：8）.
Preferably, the 5 ' ends of described wherein one primer of primer M1 and M2 are biotinylated；
5 ' the ends of described wherein one primer of primer K1 and K2 are biotinylated；
5 ' the ends of described wherein one primer of primer H1 and H2 are biotinylated；
5 ' the ends of described wherein one primer of primer P1 and P2 are biotinylated.
Preferably, 5 ' ends of the primer not being biotinylated in the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
It is connected with tag sequences, the tag sequences can be with the anti-tag sequence complementary pairings that are carried in fluorescence-encoded micro-beads.
Preferably, the tag sequences connected in this 4 groups of primer pairs of the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
Selected from SEQ ID NO:Tag sequences shown in 9 ~ 12, and the tag sequences connected in 4 groups of primer pairs are different.
Multi-fluorescence analytical reagent that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus
Box contains any of the above-described primer in the kit.
Preferably, also containing streptavidin-phycoerythrin compound, the different iridescent of 4 kinds of codings in mentioned reagent box
Fluorescence-encoded micro-beads.
Preferably, the anti-tag sequences with tag sequences complementary pairing in primer are also contained in the fluorescence-encoded micro-beads,
It is different to encode the anti-tag sequences contained in the fluorescence-encoded micro-beads of different iridescent.
Multi-fluorescence analysis method that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
Include the following steps：
1）Viral DNA is extracted from sample；
2）Using the viral DNA of extraction as template, PCR amplification is carried out with any of the above-described primer；
3）By upper step amplified production, the fluorescence-encoded micro-beads of the different iridescent of 4 kinds of codings, streptavidin-phycoerythrin
Hybridized；
4）After hybridization, analysis is detected hybrid product by Luminex systems, determines the type of its virus；
The above method is used for the diagnose and treat of non-disease.
Preferably, step 2）The reaction system of middle PCR amplification is：
Premix Ex Taq™ Hot Start Version 7.5µL
2 μ L of primer mixed liquor
1 μ L of DNA profiling
ddH2O 4.5µL
Total 15µL；
Step 2）The response procedures of middle PCR amplification are：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 60 DEG C of 25s that anneal, 72
DEG C extension 15s；Cycle 35 times；72 DEG C extend 7min eventually.
Preferably, step 3）Described in the reaction system that hybridizes and program be：
3 kinds of 20 μ L of fluorescence-encoded micro-beads
75 μ L of streptavidin-phycoerythrin
5 μ L of amplified production
100 μ L of total volume；42 DEG C of reaction 25min.
Preferably, step 3）In 4 kinds of different iridescent of coding fluorescence-encoded micro-beads in also contain and tag sequences in primer
The anti-tag sequences of complementary pairing, the anti-tag sequences contained in 4 kinds of fluorescence-encoded micro-beads are different.
With reference to specific embodiment, the present invention is further illustrated, and however, it is not limited to this.
1 design of primers of embodiment
After being screened to designed a large amount of primers, find primer pair M1 and M2, K1 and K2, H1 and H2, P1 and
The effect that P2 detects multi-fluorescence 4 plants of RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus simultaneously is best, alkali
Basic sequence is as follows.
Primer M1：ACACCATGCCAACTGCAGATG（SEQ ID NO：1）,
Primer M2：ATTGTTCACTCCCTGTGTTTGTGTT （SEQ ID NO：2）；
Primer K1：AACCAGACGCTGGAATCGCTAA（SEQ ID NO：3）,
Primer K2：TGTAGCAGTCTAGATGCATGA（SEQ ID NO：4）；
Primer H1：CTCTAGCAACTCTGCTGAAG（SEQ ID NO：5）,
Primer H2：CAGTTATTCCTTGGAGGCAT（SEQ ID NO：6）；
Primer P1：GATGATAAGCGGTTCAGGG（SEQ ID NO：7）,
Primer P2：AAGAGCTCCGGTATCTCTGTC（SEQ ID NO：8）.
The present invention is using the method for multi-fluorescence analysis to RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus
It distinguishes, therefore above-mentioned primer is made into further modification, to meet corresponding operation requirement.Wherein primer M1, K1, H1 and P1
5 ' end be connected with tag sequences, the tag sequences connected are respectively：
The tag sequences of primer M1 are：TACTTCTTTACTACAATTTACAAC（SEQ ID NO：9）；
The tag sequences of primer K1 are：ATTAAACAACTCTTAACTACACAA（SEQ ID NO：10）；
The tag sequences of primer H1 are：CTAAACATACAAATACACATTTCA（SEQ ID NO：11）；
The tag sequences of primer P1 are：AATAACAACTCACTATATCATAAC（SEQ ID NO：12）.
In addition, 5 ' the ends of primer M2, K2, H2, P2 are also added with biotin labeling.
Embodiment 2：The multi-fluorescence assay kit of 4 plants of rat parvovirus is detected simultaneously
Kit includes following components：
（1）The primer for multi-fluorescence analysis designed by embodiment 1；
（2）The fluorescence-encoded micro-beads for including anti-tag sequences of the different iridescent of 4 kinds of codings, the anti-tag sequences
Row can correspondingly analyze the tag sequence complementary pairings in primer with multi-fluorescence；4 kinds of microballoons are purchased from luminex companies, wherein
The corresponding fluorescence-encoded micro-beads number of RMV, KRV, H-1 and PRV-1a for MTAG-A015, MTAG-A036, MTAG-A062 and
MTAG-077。
（3）Streptavidin-phycoerythrin compound.
Embodiment 3 detects the foundation of the multi-fluorescence analysis method detection method of 4 plants of rat parvovirus simultaneously
（1）The structure of plasmid
Instrument is extracted automatically with the nucleic acid of Tiangeng extracts 4 plants of RMV plants, KRV plants, H1 plants and RPV-1a plants of parvovirus respectively
DNA, primer pair M1 and M2, K1 and K2, H1 and H2, P1 and P2 progress PCR amplifications, agarose is carried out by amplified production respectively respectively
Detected through gel electrophoresis simultaneously cuts glue purification.CDNA after purification is connected in pMD-19T carriers with the kit of Tiangeng again, it will even
Object of practicing midwifery is converted to DH5a competent cells, selects monoclonal, carries out bacterium solution PCR identifications, will be accredited as the bacterium colony of positive bacteria into
Row plasmid extraction send sequencing.
（2）Plasmid PCR expands
Carry out substance, Quadruple- PCR amplification to RMV, KRV, H-1 and PRV-1a primer respectively with primer described in embodiment 1.
The preparation of sense primer mixed liquor：By M1, K1, H1 and P1 with molar ratio 1:1:1:1 ratio is mixed；Draw in downstream
The preparation of object mixed liquor：By M2, K2, H2 and P2 with molar ratio 1:1:1:1 ratio is mixed.Be utilized respectively 4 kinds of cause of disease RMV,
The specific template of KRV, H-1 or PRV-1a and RMV, KRV, H-1 and PRV-1a quadruple template, should to the spy of above-mentioned cause of disease
Property region is expanded.The wherein preparation of quadruple template：By four kinds of plasmids with volume ratio 1:1:1:1 ratio is mixed.
Pcr amplification reaction system is as follows：
Premix Ex Taq™ Hot Start Version 7.5ul
Sense primer mixed liquor 1ul
Downstream primer mixed liquor 1ul
Template 1ul
ddH2O 4.5ul
Total 15ul。
Wherein the final concentration of upstream and downstream primer is between 0.15-0.3 μM.
The response procedures of amplification are：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 25s, 72 DEG C of extension 15s；
Cycle 35 times；72 DEG C extend 7min eventually.
PCR product is analyzed into row agarose gel electrophoresis, and electrophoretogram is as shown in Figure 1.1：RMV, 2：KRV, 3：H-1,4：
RPV-1a, 5：To RMV+KRV+H-1+RPV-1a carry out Quadruple- PCR, 6：PCR blank（PCR blank controls）, M：DL500
DNA marker,
（3）By the PCR product of gained and fluorescence-encoded micro-beads working solution, Streptavidin phycoerythrin（SA-PE）Work
Liquid hybridizes, and includes the following steps：
Be coated with 4 kinds of microballoons of special anti-tag sequences respectively, wherein anti-tag sequences can correspondingly with RMV,
Tag sequence complementary pairings on tetra- kinds of cause of disease primers of KRV, H-1 and PRV-1a.4 kinds of microballoons are purchased from luminex companies, specifically
The corresponding fluorescence-encoded micro-beads number of RMV, KRV, H-1 and PRV-1a be MTAG-A015, MTAG-A036, MTAG-A062
And MTAG-077.
The preparation of fluorescence-encoded micro-beads working solution：By 2500/μ l fluorescence-encoded micro-beads with 1.1 × Tm
Hybrdization Buffer are diluted to 1 μ l and about contain 125/kind fluorescence-encoded micro-beads.
It is prepared by SA-PE working solutions：1mg/ml SA-PE are diluted to 10 μ g/ μ with 1 × Tm Hybrdization Buffer
l。
Fluorescence-encoded micro-beads working solution is fully resuspended, each sample well and background hole add in 20 μ l of microballoon working solution, sample
5 μ l PCR products are added in hole, 5 μ l PCR blank products are added in background hole, the SA-PE working solutions of 75 μ l is added, fills
Divide mixing, 42 DEG C of incubation 25min in metal heater.
The 50 above-mentioned reaction solutions of μ l after hybridization are detected by the explanation according to 200 instruments of detector Luminex, as a result
As shown in Figure 2.When 200 instruments of detector Luminex read MFI values, different types of cause of disease can be significantly offered an explanation.
As a result criterion（Note：The criterion is only for reference, and also result criterion can be adjusted）It is as follows：
Lowest detection threshold value（Cutoff values）Determine：Choose 20 rat tissue's samples without parvovirus infections（Often
A sample is parallel to be repeated 3 times）, MFI values are read respectively and calculate its average value and standard deviation.With average value plus 3 times of standard deviations
MIF values set it as cutoff values.The present invention obtain RMV, KRV, H-1 and PRV-1a cutoff values be respectively 531.5,
234.9th, 405.6,433.9, thus the cutoff values of RMV, KRV, H-1 and PRV-1a of the present invention are set to 550 respectively, 300,
450、450.When only the MFI values of detection sample are higher than the cutoff values set, which could effectively be analyzed.
The analytical judgment of sample to be tested：1）When the MFI value ＞ cutoff values of sample to be tested, it is judged as positive sample；2）
During MFI values≤cutoff values of sample to be tested, it is judged as feminine gender, carry out repeating experiment or takes other detection methods into one
Step is demonstrate,proved.
Embodiment 4 detects the multi-fluorescence analysis detection specificity experiments of 4 plants of rat parvovirus simultaneously
Respectively with rat parvovirus RMV, KRV, H-1 and PRV-1a, mouse cytomegalovirus MCMV, reovirus
Type III Reo-3, mouse adenovirus MAD, MVM plants of MVM of minute parvovirus of mice, polyomavirus POLY, sendai virus SV, Mouse Liver
Inflammation virus MHV carries out multi-fluorescence analysis detection as template.Experimental result as shown in figure 3, only rat parvovirus RMV,
KRV, H-1 and PRV-1a are the positive, and others are feminine gender, illustrate that detection architecture specificity is good.
Embodiment 5：The multi-fluorescence analysis detection sensitivity experiment of rat parvovirus
The plasmid of preparation is quantified, is diluted using 10 times of dilution methods, is diluted to 101Copies/ μ l, use are above-mentioned
The multi-fluorescence analysis method of foundation is detected.The multi-fluorescence analysis detection sensitivity experimental result of rat parvovirus is such as
Shown in Fig. 4, the experimental results showed that, the sensitivity detection limit of RMV, H-1 and PRV-1a are 102Copies/ul, KRV's is sensitive
Degree detection is limited to 103copies/ul。
Embodiment 6：The detection of sample
The regular grade rat that the field rodent captured outside and two units provide, aseptic collection its spleen, caecum, with Tiangeng core
The sour automatic instrument that extracts extracts DNA, is expanded using the Premix Ex Taq Hot Start Version of TAKARA, with
DNA is detected, amplified production and fluorescence as template using the multi-fluorescence analyzing detecting method of above-mentioned rat parvovirus
Coding microball and SA-PE hybridization, the reading on 200 detectors of Luminex.Specific steps are with reference to embodiment 3, and experimental result is such as
Shown in Fig. 5.
Through test experience of the present invention, the result shows that, sample 1,2,3,4,5,7,8,9,11,13,14,15,19,20 is feminine gender
Sample；10th, 12,16,17,18 be RMV positives；6th, 17 be KRV positives；10th, 18 be H-1 positives；12 are
RPV-1a positives.By sequencing analysis, as a result unanimously.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
<110>Experimental Animals Supervising Station, Guangdong Prov.
<120>Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus
<130>
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
acaccatgcc aactgcagat g 21
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence
<400> 2
attgttcact ccctgtgttt gtgtt 25
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence
<400> 3
aaccagacgc tggaatcgct aa 22
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<400> 4
tgtagcagtc tagatgcatg a 21
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
ctctagcaac tctgctgaag 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
cagttattcc ttggaggcat 20
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence
<400> 7
gatgataagc ggttcaggg 19
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence
<400> 8
aagagctccg gtatctctgt c 21
<210> 9
<211> 24
<212> DNA
<213>Artificial sequence
<400> 9
tacttcttta ctacaattta caac 24
<210> 10
<211> 24
<212> DNA
<213>Artificial sequence
<400> 10
attaaacaac tcttaactac acaa 24
<210> 11
<211> 24
<212> DNA
<213>Artificial sequence
<400> 11
ctaaacatac aaatacacat ttca 24
<210> 12
<211> 24
<212> DNA
<213>Artificial sequence
<400> 12
aataacaact cactatatca taac 24
Claims (10)
1. multi-fluorescence analysis primer that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus, institute
It is as follows to state primer nucleotide sequences：
Primer M1：ACACCATGCCAACTGCAGATG(SEQ ID NO：1),
Primer M2：ATTGTTCACTCCCTGTGTTTGTGTT(SEQ ID NO：2)；
Primer K1：AACCAGACGCTGGAATCGCTAA(SEQ ID NO：3),
Primer K2：TGTAGCAGTCTAGATGCATGA(SEQ ID NO：4)；
Primer H1：CTCTAGCAACTCTGCTGAAG(SEQ ID NO：5),
Primer H2：CAGTTATTCCTTGGAGGCAT(SEQ ID NO：6)；
Primer P1：GATGATAAGCGGTTCAGGG(SEQ ID NO：7),
Primer P2：AAGAGCTCCGGTATCTCTGTC(SEQ ID NO：8).
2. primer according to claim 1, it is characterised in that：
5 ' the ends of described wherein one primer of primer M1 and M2 are biotinylated；
5 ' the ends of described wherein one primer of primer K1 and K2 are biotinylated；
5 ' the ends of described wherein one primer of primer H1 and H2 are biotinylated；
5 ' the ends of described wherein one primer of primer P1 and P2 are biotinylated.
3. the primer according to profit requires 2, which is characterized in that in the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
5 ' ends of the primer not being biotinylated are connected with tag sequences, and the tag sequences can be with carrying in fluorescence-encoded micro-beads
Anti-tag sequence complementary pairings.
4. primer according to claim 3, which is characterized in that the primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
The tag sequences connected in this 4 groups of primer pairs are selected from SEQ ID NO:Tag sequences shown in 9~12, and connect in 4 groups of primer pairs
The tag sequences connect are different.
5. multi-fluorescence assay kit that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
It is characterized in that, contain any primer of Claims 1 to 4 in the kit.
6. kit according to claim 5, which is characterized in that also contain Streptavidin-algae red egg in the kit
The fluorescence-encoded micro-beads of white compound, the different iridescent of 4 kinds of codings.
7. kit according to claim 6, which is characterized in that also contain in the fluorescence-encoded micro-beads and claim
The anti-tag sequences of tag sequence complementary pairings, encode what is contained in the fluorescence-encoded micro-beads of different iridescent in 4 primers
Anti-tag sequences are different.
8. multi-fluorescence analysis method that is a kind of while detecting RMV plants, KRV plants, H1 plants and RPV-1a plants of rat parvovirus,
It is characterized in that, includes the following steps：
1) viral DNA is extracted from sample；
2) using the viral DNA of extraction as template, PCR amplification is carried out with any primer of claim 3~4；
3) upper step amplified production, the fluorescence-encoded micro-beads of the different iridescent of 4 kinds of codings, streptavidin-phycoerythrin are carried out
Hybridization；
4) after hybridizing, analysis is detected hybrid product by Luminex systems, determines the type of its virus；
The above method is used for the diagnose and treat of non-disease.
9. according to the method described in claim 8, it is characterized in that：The reaction system of PCR amplification is in step 2)：
The response procedures of PCR amplification are in step 2)：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 25s, 72 DEG C are prolonged
Stretch 15s；Cycle 35 times；72 DEG C extend 7min eventually.
10. according to the method described in claim 8, it is characterized in that：The reaction system and program hybridized described in step 3) be：
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767983.0A CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767983.0A CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106167836A CN106167836A (en) | 2016-11-30 |
| CN106167836B true CN106167836B (en) | 2018-07-06 |
Family
ID=57376800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610767983.0A Active CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106167836B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893786A (en) * | 2017-03-22 | 2017-06-27 | 中国农业科学院上海兽医研究所 | Differentiate primer pair, probe, kit and the method for detection rat piconavirus and rat parvovirus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
| CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
-
2016
- 2016-08-30 CN CN201610767983.0A patent/CN106167836B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
| CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
Non-Patent Citations (3)
| Title |
|---|
| A Bead-Based Multiplex Assay for the Detection of DNA Viruses Infecting Laboratory Rodents;Hofler D et al.;《Plos one》;20140516;第9卷(第5期);摘要、材料和方法，结果，表1-2 * |
| Molecular characterization of three newly recognized rat parvoviruses;Wan CH et al.;《Journal of general virology》;20020801;第83卷(第8期);方法，结果，结论，讨论，表1-3，图1-3 * |
| 大鼠细小病毒H-1株和KRV株双重PCR检测方法的建立及应用;李晓波等;《中国比较医学杂志》;20150630;第25卷(第6期);第46-52页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106167836A (en) | 2016-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105154589B (en) | A kind of multi-fluorescence immunoassay method of quick differentiation PEDV, TGEV, PoRV | |
| CN102154498A (en) | Nucleic acid detecting method | |
| CN108456747A (en) | A kind of multiple PCR detection kit differentiating pig circular ring virus | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| Wang et al. | Development of a recombinase polymerase amplification assay with lateral flow dipstick for rapid detection of feline parvovirus | |
| CN102864226A (en) | LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus | |
| CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
| CN103866048B (en) | The HRM discrimination method of Muscovy duck parvovirus and goose parvovirus, test kit and primer sets | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| Lu et al. | A rapid multiplex nucleic acid detection system of airborne fungi by an integrated DNA release device and microfluidic chip | |
| CN107012260A (en) | Neospora, Brucella and infectious bovine rhinotrachetis virus multiplex-nested PCR detection primer, kit and detection method | |
| CN107447043A (en) | The type PCR detection primers pair of pig circular ring virus 3 and kit | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN104232783A (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN106167836B (en) | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus | |
| CN106011313B (en) | A kind of the multi-fluorescence immunoassay method and reagent of quick differentiation ILTV, IBV, MG and MS | |
| CN107326098A (en) | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses | |
| CN102864229A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni | |
| CN106755589B (en) | The primer sets, kit and Multiple immunizations fluorescence analysis method of five kinds of pathogen of rat are detected simultaneously | |
| CN105349700A (en) | HRM detection method and primer for fasting identifying parvovirus MVM strains and MPV strains of mice | |
| CN106086241B (en) | A kind of primer, kit and the method for the multi-fluorescence immunoassay of 4 kinds of fowl respiratory pathogens of quick differentiation | |
| CN106367530B (en) | A kind of primer sets and detection method of four kinds of rat parvovirus strains of quick discriminating | |
| CN106191312B (en) | A kind of quick multi-fluorescence immunoassay method and reagent for distinguishing AIV, NDV, MG and MS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |