CN106167836A - A kind of multi-fluorescence simultaneously detecting 4 strain rat parvoviruses analyzes method and test kit - Google Patents
A kind of multi-fluorescence simultaneously detecting 4 strain rat parvoviruses analyzes method and test kit Download PDFInfo
- Publication number
- CN106167836A CN106167836A CN201610767983.0A CN201610767983A CN106167836A CN 106167836 A CN106167836 A CN 106167836A CN 201610767983 A CN201610767983 A CN 201610767983A CN 106167836 A CN106167836 A CN 106167836A
- Authority
- CN
- China
- Prior art keywords
- primer
- strain
- fluorescence
- seq
- beads
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a kind of multi-fluorescence simultaneously detecting 4 strain rat parvoviruses and analyze method and test kit.The present invention is simple to operate, obtains target amplification fragment by PCR, then amplified production, fluorescence-encoded micro-beads and Streptavidin phycoerythrin is hybridized, and then reads MFI value by detector, offers an explanation different types of cause of disease.The inventive method, it is possible to detection and identification rat parvovirus RMV, KRV, H 1 and PRV 1a simultaneously, and have high specificity, highly sensitive, the advantage such as reproducible, the multiple different molecules of interest that can realize in same sample detect simultaneously.Motility of the present invention is good, can add and subtract the kind of detection cause of disease the most on this basis.
Description
Technical field
The invention belongs to the Pathogen test field of laboratory animal, be specifically related to one and detect 4 strain rat parvoviruses simultaneously
The multi-fluorescence of (RMV, KRV, H1 and RPV-1a) analyzes method.
Background technology
Rat parvovirus (Rat parvovirus) is one of virus the most serious to experimental rat harm, can
Causing kind of Mus group's breeding potential to decline, infected mice, also by feces outside toxin expelling for a long time, pollutes feedstuff, drinking-water and surrounding, and
Re-infection susceptible animal, causes rat parvovirus sustainable existence in Mus group.Rat parvovirus also can pollute tumor and move
Plant and cell line, produce severe jamming to experimentation.
By currently, it is divided into and separates out 4 strain rat parvovirus RMV, KRV, H-1 and RPV-1a, the KRV that its mid-early stage is identified
It is one of SPF level latent rat virus essential items for inspection in laboratory animal GB (GB 14922. 2-2011) with H-1 strain.Serology
Method is the common method of current diagnosis experimental rat parvovirus infections, the serological method bag of regulation in laboratory animal GB
Include elisa (ELISA), immunoenzyme test (IEA), immunofluorescence test (IFA) and hemagglutination inhibition test
(HIA), ELISA or IFA is commonly used as large-scale examination, and HIA is generally used to do confirmatory test.ELISA and IFA is quick
Perception is higher, but owing to parvoviral nonstructural proteins ratio is more conservative, can produce the cross reaction between antibody, thus the spy of method
The opposite sex is poor, can not distinguish the parvovirus of different plant type.Meanwhile, there is " window phase " in serological method, the most inapplicable disease
Poison actute infection and serum between animal have not occurred the situation that sun turns.PCR method is with its higher sensitivity and specificity
Through being widely used in the detection of virus.The PCR method initially set up can identify KRV, but cannot distinguish with H-1, follow-up again
There is researcher to separately design the special primer of H-1 and KRV, the two can be distinguished, but remain a need for being divided into two reaction systems
Identify.Having laboratory to establish rat parvovirus H-1 strain and the PCR detection method of KRV strain recently, specificity is good, sensitive
Degree height, it is possible to detect in same reaction system simultaneously and distinguish H-1 and KRV, improve detection efficiency.But either substance is also
Being double PCR technology, its result judges to be required for gel electrophoresis, wastes time and energy, runs into the feelings that sample size is big in actual applications
Condition, is difficult to meet detection demand.
It addition, along with the discovery of the new strain of RMV and RPV-1a, day is also put in the detection of plant type each to rat parvovirus
Journey.The most domestic yet there are no a kind of method that can detect simultaneously and distinguish 4 strain rat parvoviruses, also there are no application multiple
The report of fluorescence analysis method detection rat parvovirus.
Summary of the invention
It is an object of the invention to provide one and detect rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a simultaneously
The multi-fluorescence of strain analyzes primer.
Another object of the present invention is to provide one detect simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and
The multi-fluorescence assay kit of RPV-1a strain.
It is still another object of the present invention to provide one detect simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and
The multi-fluorescence of RPV-1a strain analyzes method.
The technical solution used in the present invention is:
The multi-fluorescence of a kind of detection simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain analyzes primer, described
Primer nucleotide sequences is as follows:
Primer M1:ACACCATGCCAACTGCAGATG(SEQ ID NO:1),
Primer M2:ATTGTTCACTCCCTGTGTTTGTGTT (SEQ ID NO:2);
Primer K1:AACCAGACGCTGGAATCGCTAA(SEQ ID NO:3),
Primer K2:TGTAGCAGTCTAGATGCATGA(SEQ ID NO:4);
Primer H1:CTCTAGCAACTCTGCTGAAG(SEQ ID NO:5),
Primer H2:CAGTTATTCCTTGGAGGCAT(SEQ ID NO:6);
Primer P1:GATGATAAGCGGTTCAGGG(SEQ ID NO:7),
Primer P2:AAGAGCTCCGGTATCTCTGTC(SEQ ID NO:8).
Further, 5 ' ends of a described primer M1 and M2 wherein primer are biotinylated;
5 ' ends of a described primer K1 and K2 wherein primer are biotinylated;
5 ' ends of a described primer H1 and H2 wherein primer are biotinylated;
5 ' ends of a described primer P1 and P2 wherein primer are biotinylated.
Further, the 5 ' of the primer not being biotinylated in described primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
End connection have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in anti-tag complementary pairing.
Further, the tag sequence that described primer M1 and M2, K1 and K2, these 4 groups of primer centerings of H1 and H2, P1 and P2 connect
Column selection is from the tag sequence shown in SEQ ID NO:9 ~ 12, and the tag sequence that these 4 groups of primer centerings connect is different.
A kind of multi-fluorescence analytical reagent simultaneously detecting rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain
Box, containing primer described above in this test kit.
Further, possibly together with SA-PE complex, 4 kinds of different fluorescence of coding in mentioned reagent box
The fluorescence-encoded micro-beads of color.
Further, possibly together with the anti-tag sequence matched with tag complementary in primer in described fluorescence-encoded micro-beads
Row, the anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding is different.
The multi-fluorescence of a kind of detection simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain analyzes method,
Comprise the steps:
1) from sample, viral DNA is extracted;
2) with the viral DNA that extracts as template, PCR amplification is carried out with any of the above-described described primer;
3) upper step amplified production, 4 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization;
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its virus;
Said method is used for diagnosis and the treatment of non-diseases.
Further, step 2) in PCR amplification reaction system be:
Premix Ex Taq™ Hot Start Version 7.5µL
Primer mixed liquor 2 L
DNA profiling 1 L
ddH2O 4.5µL
Total 15µL;
Step 2) in PCR amplification response procedures be: 95 DEG C of denaturations 5min;95 DEG C of degeneration 30s, 60 DEG C of annealing 25s, 72 DEG C are prolonged
Stretch 15s;Circulate 35 times;72 DEG C extend 7min eventually.
Further, reaction system and the program of hybridization described in step 3) is:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L;42 DEG C of reaction 25min.
The invention has the beneficial effects as follows:
1) present invention achieves and rat 4 strain parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain are detected simultaneously, this
Invent and obtain target amplification fragment by specific PCR, then by red to amplified production, fluorescence-encoded micro-beads and Streptavidin-algae
Albumen (SA-PE) hybridizes, and when then reading MFI value by detector, differentiates the rat parvovirus of different plant type.
2) rat 4 strain parvovirus can accurately be detected by the inventive method simultaneously, and high specificity, sensitivity
Height, reproducible.Compared with traditional detection method, the inventive method achieves the multiple different molecules of interest in same sample
Detecting, sample consumption is few simultaneously, simple to operate, quick, can be substantially reduced testing cost.The present invention can guarantee that identical answering
Degree warm in nature and hybridization efficiency, and it is prevented effectively from crisscrossing between the microsphere of different testing sample labelling.
Accompanying drawing explanation
Fig. 1 is the PCR electrophoretogram of 4 strain rat parvovirus RMV, KRV, H-1 and PRV-1a strains;
Fig. 2 is that the multi-fluorescence of 4 strain rat parvoviruses analyzes method test experience result figure;
Fig. 3 is that the multi-fluorescence of 4 strain rat parvoviruses analyzes method detection specificity experiments result figure;
Fig. 4 is that the multi-fluorescence of 4 strain rat parvoviruses analyzes method detection sensitivity experimental result picture;
Fig. 5 is that the multi-fluorescence of 4 strain rat parvoviruses analyzes method Clinical detection experimental result picture.
Detailed description of the invention
The multi-fluorescence of a kind of detection simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain analyzes primer,
Described primer nucleotide sequences is as follows:
Primer M1:ACACCATGCCAACTGCAGATG(SEQ ID NO:1),
Primer M2:ATTGTTCACTCCCTGTGTTTGTGTT (SEQ ID NO:2);
Primer K1:AACCAGACGCTGGAATCGCTAA(SEQ ID NO:3),
Primer K2:TGTAGCAGTCTAGATGCATGA(SEQ ID NO:4);
Primer H1:CTCTAGCAACTCTGCTGAAG(SEQ ID NO:5),
Primer H2:CAGTTATTCCTTGGAGGCAT(SEQ ID NO:6);
Primer P1:GATGATAAGCGGTTCAGGG(SEQ ID NO:7),
Primer P2:AAGAGCTCCGGTATCTCTGTC(SEQ ID NO:8).
Preferably, 5 ' ends of a described primer M1 and M2 wherein primer are biotinylated;
5 ' ends of a described primer K1 and K2 wherein primer are biotinylated;
5 ' ends of a described primer H1 and H2 wherein primer are biotinylated;
5 ' ends of a described primer P1 and P2 wherein primer are biotinylated.
Preferably, 5 ' ends of the primer not being biotinylated in described primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
Connect have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in anti-tag complementary pairing.
Preferably, the tag sequence that described primer M1 and M2, K1 and K2, these 4 groups of primer centerings of H1 and H2, P1 and P2 connect
Selected from the tag sequence shown in SEQ ID NO:9 ~ 12, and the tag sequence that these 4 groups of primer centerings connect is different.
A kind of multi-fluorescence analytical reagent simultaneously detecting rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain
Box, containing any of the above-described described primer in this test kit.
Preferably, possibly together with SA-PE complex, 4 kinds of different iridescent of coding in mentioned reagent box
Fluorescence-encoded micro-beads.
Preferably, possibly together with the anti-tag sequence matched with tag complementary in primer in described fluorescence-encoded micro-beads,
The anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding is different.
The multi-fluorescence of a kind of detection simultaneously rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain analyzes method,
Comprise the steps:
1) from sample, viral DNA is extracted;
2) with the viral DNA that extracts as template, PCR amplification is carried out with any of the above-described described primer;
3) upper step amplified production, 4 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization;
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its virus;
Said method is used for diagnosis and the treatment of non-diseases.
Preferably, step 2) in PCR amplification reaction system be:
Premix Ex Taq™ Hot Start Version 7.5µL
Primer mixed liquor 2 L
DNA profiling 1 L
ddH2O 4.5µL
Total 15µL;
Step 2) in PCR amplification response procedures be: 95 DEG C of denaturations 5min;95 DEG C of degeneration 30s, 60 DEG C of annealing 25s, 72 DEG C are prolonged
Stretch 15s;Circulate 35 times;72 DEG C extend 7min eventually.
Preferably, reaction system and the program of hybridization described in step 3) is:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L;42 DEG C of reaction 25min.
Preferably, in step 3) in the fluorescence-encoded micro-beads of 4 kinds of different iridescent of coding possibly together with tag sequence in primer
The anti-tag sequence of complementary pairing, the anti-tag sequence contained in 4 kinds of fluorescence-encoded micro-beads is different.
Below in conjunction with specific embodiment, the present invention is further illustrated, but is not limited thereto.
Embodiment 1 design of primers
After designed a large amount of primers are screened, find primer to M1 and M2, K1 and K2, H1 and H2, P1 and P2 pair
Multi-fluorescence detect simultaneously 4 strain rat parvovirus RMV strains, KRV strain, H1 strain and RPV-1a strain effect best, its base sequence
Arrange as follows.
Primer M1:ACACCATGCCAACTGCAGATG(SEQ ID NO:1),
Primer M2:ATTGTTCACTCCCTGTGTTTGTGTT (SEQ ID NO:2);
Primer K1:AACCAGACGCTGGAATCGCTAA(SEQ ID NO:3),
Primer K2:TGTAGCAGTCTAGATGCATGA(SEQ ID NO:4);
Primer H1:CTCTAGCAACTCTGCTGAAG(SEQ ID NO:5),
Primer H2:CAGTTATTCCTTGGAGGCAT(SEQ ID NO:6);
Primer P1:GATGATAAGCGGTTCAGGG(SEQ ID NO:7),
Primer P2:AAGAGCTCCGGTATCTCTGTC(SEQ ID NO:8).
The present invention uses method that multi-fluorescence analyzes to rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain
Make a distinction, therefore make above-mentioned primer further to modify, operate requirement accordingly to meet.Wherein primer M1, K1, H1 and P1
5 ' end connections have tag sequence, the tag sequence connected is respectively as follows:
The tag sequence of primer M1 is: TACTTCTTTACTACAATTTACAAC(SEQ ID NO:9);
The tag sequence of primer K1 is: ATTAAACAACTCTTAACTACACAA(SEQ ID NO:10);
The tag sequence of primer H1 is: CTAAACATACAAATACACATTTCA(SEQ ID NO:11);
The tag sequence of primer P1 is: AATAACAACTCACTATATCATAAC(SEQ ID NO:12).
It addition, the 5 ' ends of primer M2, K2, H2, P2 have been also added with biotin labeling.
Embodiment 2: simultaneously detect the multi-fluorescence assay kit of 4 strain rat parvoviruses
Test kit includes following components:
(1) primer analyzed for multi-fluorescence designed by embodiment 1;
The fluorescence-encoded micro-beads including anti-tag sequence of (2) 4 kinds of different iridescent of coding, described anti-tag sequence energy
The tag complementary pairing in primer is correspondingly analyzed with multi-fluorescence;4 kinds of microspheres are purchased from luminex company, wherein RMV,
The fluorescence-encoded micro-beads number that KRV, H-1 are the most corresponding with PRV-1a is MTAG-A015, MTAG-A036, MTAG-A062 and MTAG-
077。
(3) SA-PE complex.
Embodiment 3 detects the foundation of the multi-fluorescence analysis method detection method of 4 strain rat parvoviruses simultaneously
(1) structure of plasmid
Automatically extract instrument with the nucleic acid of sky root and extract 4 strain parvovirus RMV strains, KRV strain, H1 strain and the DNA of RPV-1a strain respectively,
Primer carries out PCR amplification to M1 and M2, K1 and K2, H1 and H2, P1 and P2 respectively, and amplified production carries out agarose gel respectively
Electrophoresis detection also cuts glue purification.With the test kit of sky root, cDNA after purification is connected in pMD-19T carrier again, connection is produced
Thing converts to DH5a competent cell, selects monoclonal, carries out the qualification of bacterium solution PCR, the bacterium colony being accredited as positive bacteria is carried out matter
Grain extracting, send order-checking.
(2) plasmid PCR amplification
Respectively RMV, KRV, H-1 and PRV-1a primer is carried out substance, Quadruple-PCR amplification with the primer described in embodiment 1.
The preparation of forward primer mixed liquor: M1, K1, H1 and P1 are mixed with mol ratio 1:1:1:1 ratio;Downstream is drawn
The preparation of thing mixed liquor: M2, K2, H2 and P2 are mixed with mol ratio 1:1:1:1 ratio.Be utilized respectively 4 kinds of cause of diseases RMV,
The specific template of KRV, H-1 or PRV-1a, and RMV, KRV, H-1 and PRV-1a quadruple template, should to the spy of above-mentioned cause of disease
Property region expands.The wherein preparation of quadruple template: four kinds of plasmids are mixed with the ratio of volume ratio 1:1:1:1.
Pcr amplification reaction system is as follows:
Premix Ex Taq™ Hot Start Version 7.5ul
Forward primer mixed liquor 1ul
Downstream primer mixed liquor 1ul
Template 1ul
ddH2O 4.5ul
Total 15ul。
Wherein the final concentration of upstream and downstream primer is between 0.15-0.3 μM.
The response procedures of amplification is: 95 DEG C of denaturations 5min;95 DEG C of degeneration 30s, 60 DEG C of annealing 25s, 72 DEG C extend 15s;
Circulate 35 times;72 DEG C extend 7min eventually.
PCR primer carries out agarose gel electrophoresis analysis, and its electrophoretogram is as shown in Figure 1.1:RMV, 2:KRV, 3:H-1,4:
RPV-1a, 5: the Quadruple-PCR that RMV+KRV+H-1+RPV-1a is carried out, 6:PCR blank(PCR blank), M:DL500
DNA marker,
(3) by miscellaneous to the PCR primer of gained and fluorescence-encoded micro-beads working solution, Streptavidin phycoerythrin (SA-PE) working solution
Hand over, comprise the following steps:
Be coated with 4 kinds of microspheres of special anti-tag sequence respectively, wherein anti-tag sequence can correspondingly with RMV, KRV,
Tag complementary pairing on tetra-kinds of cause of disease primers of H-1 and PRV-1a.4 kinds of microspheres are purchased from luminex company, concrete
The fluorescence-encoded micro-beads number that RMV, KRV, H-1 and PRV-1a are the most corresponding be MTAG-A015, MTAG-A036, MTAG-A062 and
MTAG-077。
The preparation of fluorescence-encoded micro-beads working solution: by 2500/μ l fluorescence-encoded micro-beads with 1.1 × Tm
Hybrdization Buffer is diluted to 1 μ l and about contains 125/kind fluorescence-encoded micro-beads.
Prepared by SA-PE working solution: 1mg/ml SA-PE 1 × Tm Hybrdization Buffer is diluted to 10 μ g/ μ
l。
Abundant resuspended fluorescence-encoded micro-beads working solution, each sample well and background hole add microsphere working solution 20 μ l, sample
Hole adds 5 μ l PCR primer, background hole adds 5 μ l PCR blank products, adds the SA-PE working solution of 75 μ l, fill
Divide mixing, in metal heater, hatch 25min for 42 DEG C.
According to the explanation of detector Luminex 200 instrument, the 50 above-mentioned reactant liquors of μ l after hybridization are detected, result
As shown in Figure 2.When detector Luminex 200 instrument reads MFI value, can substantially offer an explanation different types of cause of disease.
Result criterion (result criterion also can be adjusted by note: this criterion is only for reference) is as follows:
The determination of lowest detection threshold value (cutoff value): choose 20 rat tissue's sample (each samples without parvovirus infections
Product are parallel to be repeated 3 times), read MFI value respectively and calculate its meansigma methods and standard deviation.The MIF value of 3 times of standard deviations is added with meansigma methods
Set it as cutoff value.The present invention obtained RMV, KRV, H-1 and PRV-1a cutoff value be respectively 531.5,234.9,
405.6,433.9, therefore the cutoff value of RMV, KRV, H-1 and PRV-1a of the present invention is set to respectively 550,300,450,
450.When only detecting the MFI value of sample higher than the cutoff value set, this experimental data just can effectively be analyzed.
The analysis of sample to be tested judges: 1) when the MFI value > cutoff value of sample to be tested, it is judged that for positive sample;2)
During the MFI value≤cutoff value of sample to be tested, it is judged that for feminine gender, need to carry out repeating experiment or taking other detection methods to enter one
Step is demonstrate,proved.
Embodiment 4 detects the multi-fluorescence analysis detection specificity experiments of 4 strain rat parvoviruses simultaneously
Respectively by rat parvovirus RMV, KRV, H-1 and PRV-1a, mouse cytomegalovirus MCMV, reovirus type III
Reo-3, mouse adenovirus MAD, minute parvovirus of mice MVM strain MVM, polyoma virus POLY, Sendai virus SV, mice hepatitis
Poison MHV carries out multi-fluorescence analysis detection as template.Experimental result as it is shown on figure 3, only rat parvovirus RMV, KRV,
H-1 and PRV-1a is positive, other be feminine gender, illustrate that detection system specificity is good.
Embodiment 5: the multi-fluorescence of rat parvovirus analyzes detection sensitivity experiment
The plasmid of preparation is carried out quantitatively, use 10 times of dilution methods to be diluted, be diluted to 101Copies/ μ l, uses above-mentioned foundation
Multi-fluorescence analyze method detect.The multi-fluorescence of rat parvovirus analyzes detection sensitivity experimental result such as Fig. 4
Shown in, test result indicate that, the sensitivity detection limit of RMV, H-1 and PRV-1a is 102The sensitivity inspection of copies/ul, KRV
Rising limit is 103copies/ul。
Embodiment 6: the detection of sample
The regular grade rat that the field rodent caught outside and two units provide, its spleen of aseptic collection, caecum, with sky root nucleic acid certainly
Dynamic extraction instrument extracts DNA, uses the Premix Ex Taq Hot Start Version of TAKARA to expand, makees with DNA
For template, using the multi-fluorescence analyzing detecting method of above-mentioned rat parvovirus to detect, amplified production is with fluorescence-encoded
Microsphere and SA-PE hybridization, reading on Luminex 200 detector.Concrete steps with reference to embodiment 3, experimental result such as Fig. 5 institute
Show.
Showing through test experience result of the present invention, sample 1,2,3,4,5,7,8,9,11,13,14,15,19,20 is negative
Sample;10,12,16,17,18 is RMV positive;6,17 is KRV positive;10,18 is H-1 positive;12 are
RPV-1a positive.By sequencing analysis, result is consistent.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment
Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify,
All should be the substitute mode of equivalence, within being included in protection scope of the present invention.
<110>Experimental Animals Supervising Station, Guangdong Prov.
<120>a kind of multi-fluorescence simultaneously detecting 4 strain rat parvoviruses analyzes method and test kit
<130>
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>artificial sequence
<400> 1
acaccatgcc aactgcagat g 21
<210> 2
<211> 25
<212> DNA
<213>artificial sequence
<400> 2
attgttcact ccctgtgttt gtgtt 25
<210> 3
<211> 22
<212> DNA
<213>artificial sequence
<400> 3
aaccagacgc tggaatcgct aa 22
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
tgtagcagtc tagatgcatg a 21
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ctctagcaac tctgctgaag 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
cagttattcc ttggaggcat 20
<210> 7
<211> 19
<212> DNA
<213>artificial sequence
<400> 7
gatgataagc ggttcaggg 19
<210> 8
<211> 21
<212> DNA
<213>artificial sequence
<400> 8
aagagctccg gtatctctgt c 21
<210> 9
<211> 24
<212> DNA
<213>artificial sequence
<400> 9
tacttcttta ctacaattta caac 24
<210> 10
<211> 24
<212> DNA
<213>artificial sequence
<400> 10
attaaacaac tcttaactac acaa 24
<210> 11
<211> 24
<212> DNA
<213>artificial sequence
<400> 11
ctaaacatac aaatacacat ttca 24
<210> 12
<211> 24
<212> DNA
<213>artificial sequence
<400> 12
aataacaact cactatatca taac 24
Claims (10)
1. the multi-fluorescence of detection rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain simultaneously analyzes a primer, institute
State primer nucleotide sequences as follows:
Primer M1:ACACCATGCCAACTGCAGATG(SEQ ID NO:1),
Primer M2:ATTGTTCACTCCCTGTGTTTGTGTT (SEQ ID NO:2);
Primer K1:AACCAGACGCTGGAATCGCTAA(SEQ ID NO:3),
Primer K2:TGTAGCAGTCTAGATGCATGA(SEQ ID NO:4);
Primer H1:CTCTAGCAACTCTGCTGAAG(SEQ ID NO:5),
Primer H2:CAGTTATTCCTTGGAGGCAT(SEQ ID NO:6);
Primer P1:GATGATAAGCGGTTCAGGG(SEQ ID NO:7),
Primer P2:AAGAGCTCCGGTATCTCTGTC(SEQ ID NO:8).
Primer the most according to claim 1, it is characterised in that:
5 ' ends of a described primer M1 and M2 wherein primer are biotinylated;
5 ' ends of a described primer K1 and K2 wherein primer are biotinylated;
5 ' ends of a described primer H1 and H2 wherein primer are biotinylated;
5 ' ends of a described primer P1 and P2 wherein primer are biotinylated.
3. require the primer described in 1 according to profit, it is characterised in that in described primer M1 and M2, K1 and K2, H1 and H2, P1 and P2
The primer not being biotinylated 5 ' end connections have tag sequence, described tag sequence can with fluorescence-encoded micro-beads in
Anti-tag complementary matches.
4. according to the primer described in claim 1 or 3, it is characterised in that described primer M1 and M2, K1 and K2, H1 and H2, P1 and
The tag sequence that these 4 groups of primer centerings of P2 connect is selected from the tag sequence shown in SEQ ID NO:9 ~ 12, and these 4 groups of primer centerings are even
The tag sequence connect is different.
5. detect a multi-fluorescence assay kit for rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain simultaneously,
It is characterized in that, containing the arbitrary described primer of claim 1 ~ 4 in this test kit.
Test kit the most according to claim 5, it is characterised in that possibly together with Streptavidin-algae red eggs in this test kit
White complex, the fluorescence-encoded micro-beads of 4 kinds of different iridescent of coding.
Test kit the most according to claim 5, it is characterised in that in described fluorescence-encoded micro-beads possibly together with in primer
The anti-tag sequence of tag complementary pairing, the anti-tag sequence contained in the fluorescence-encoded micro-beads of the different iridescent of coding
Arrange different.
8. the multi-fluorescence of detection rat parvovirus RMV strain, KRV strain, H1 strain and RPV-1a strain simultaneously analyzes a method, its
It is characterised by, comprises the steps:
1) from sample, viral DNA is extracted;
2) with the viral DNA that extracts as template, PCR amplification is carried out with the arbitrary described primer of claim 1 ~ 4;
3) upper step amplified production, 4 kinds of different fluorescence-encoded micro-beads of iridescent of coding, SA-PEs are carried out
Hybridization;
4), after hybridization terminates, by Luminex system, hybrid product is carried out detection and analyze, determine the type of its virus;
Said method is used for diagnosis and the treatment of non-diseases.
Method the most according to claim 8, it is characterised in that: step 2) in PCR amplification reaction system be:
Premix Ex Taq™ Hot Start Version 7.5µL
Primer mixed liquor 2 L
DNA profiling 1 L
ddH2O 4.5µL
Total 15µL;
Step 2) in PCR amplification response procedures be: 95 DEG C of denaturations 5min;95 DEG C of degeneration 30s, 60 DEG C of annealing 25s, 72 DEG C are prolonged
Stretch 15s;Circulate 35 times;72 DEG C extend 7min eventually.
Method the most according to claim 8, it is characterised in that: described in step 3) hybridization reaction system and program be:
3 kinds of fluorescence-encoded micro-beads 20 L
SA-PE 75 L
Amplified production 5 L
Cumulative volume 100 L;42 DEG C of reaction 25min.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610767983.0A CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610767983.0A CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106167836A true CN106167836A (en) | 2016-11-30 |
CN106167836B CN106167836B (en) | 2018-07-06 |
Family
ID=57376800
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610767983.0A Active CN106167836B (en) | 2016-08-30 | 2016-08-30 | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106167836B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106893786A (en) * | 2017-03-22 | 2017-06-27 | 中国农业科学院上海兽医研究所 | Differentiate primer pair, probe, kit and the method for detection rat piconavirus and rat parvovirus |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
-
2016
- 2016-08-30 CN CN201610767983.0A patent/CN106167836B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105154589A (en) * | 2015-09-18 | 2015-12-16 | 广东省实验动物监测所 | Multi-fluorescence immunity analysis method for quickly distinguishing PEDV, TGEV and PoRV |
CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
Non-Patent Citations (3)
Title |
---|
HOFLER D ET AL.: "A Bead-Based Multiplex Assay for the Detection of DNA Viruses Infecting Laboratory Rodents", 《PLOS ONE》 * |
WAN CH ET AL.: "Molecular characterization of three newly recognized rat parvoviruses", 《JOURNAL OF GENERAL VIROLOGY》 * |
李晓波等: "大鼠细小病毒H-1株和KRV株双重PCR检测方法的建立及应用", 《中国比较医学杂志》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106893786A (en) * | 2017-03-22 | 2017-06-27 | 中国农业科学院上海兽医研究所 | Differentiate primer pair, probe, kit and the method for detection rat piconavirus and rat parvovirus |
Also Published As
Publication number | Publication date |
---|---|
CN106167836B (en) | 2018-07-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107916303A (en) | Quick HRM detection primers, kit and the method for differentiating 1 type of pig circular ring virus, 2 types and 3 types | |
CN106834549A (en) | The cross primer amplification immune chromatography test paper of detection pseudorabies virus street strain is combined the primer and probe groups and kit of method | |
CN106282416A (en) | Multi-fluorescence immunoassay primer, test kit and the method for 5 kinds of fowl immunosuppressant cause of diseases of a kind of quick differentiation | |
CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
CN107012260A (en) | Neospora, Brucella and infectious bovine rhinotrachetis virus multiplex-nested PCR detection primer, kit and detection method | |
CN103866048B (en) | The HRM discrimination method of Muscovy duck parvovirus and goose parvovirus, test kit and primer sets | |
CN106222256A (en) | A kind of Multiple immunizations fluorescence analysis method detecting chicken virus mycoplasma and chicken Mycoplasma synoviae | |
CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
CN105349700B (en) | A kind of MVM plants of quick discriminating minute parvovirus of mice and MPV plants of HRM detection methods and primer | |
CN106167836A (en) | A kind of multi-fluorescence simultaneously detecting 4 strain rat parvoviruses analyzes method and test kit | |
CN106191319A (en) | A kind of multi-fluorescence immune analysis method of 6 kinds of fowl respiratory pathogenses of quick differentiation | |
CN104195265A (en) | PCR-HRM primer and method for rapidly distinguishing wild strain and vaccine strain of canine parvovirus | |
WO2015020671A1 (en) | Multiplex amplification reaction method for determination of campylobacter jejuni penner/capsule type | |
CN106011313A (en) | Multiple fluoroimmunoassay method capable of quickly differentiating infectious laryngotracheitis virus (ILTV), infectious bronchitis virus (IBV), myeoplasma gallisepticum (MG) and mycoplasma synoviae (MS) and reagent | |
CN102864229A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni | |
CN106367530B (en) | A kind of primer sets and detection method of four kinds of rat parvovirus strains of quick discriminating | |
CN106319091A (en) | Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus) | |
CN106521030A (en) | Dual fluorescent quantitation RT-PCR detection method for classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV) | |
CN105331740A (en) | PCR-HRM primer and method for quickly distinguishing DHAV-1 from DHAV-3 | |
CN106191312A (en) | The multi-fluorescence immune analysis method of a kind of quick differentiation AIV, NDV, MG and MS and reagent | |
CN104131106B (en) | The primer that the special quantitative PCR of transgenic corns 98140 structure precisely detects and probe and method | |
CN109517929A (en) | Primer sets and kit for pig circular ring virus detection and 2 type partings | |
CN103409543B (en) | Internal amplification control (IAC) multiple polymerase chain reaction (PCR) detection kit for bovine neosporosis and toxoplasmosis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |