CN103409543B - Internal amplification control (IAC) multiple polymerase chain reaction (PCR) detection kit for bovine neosporosis and toxoplasmosis - Google Patents

Abstract

The invention discloses an internal amplification control (IAC) multiple polymerase chain reaction (PCR) detection kit for bovine neosporosis and toxoplasmosis. An IAC which indicates false negative is introduced into a double PCR system; primer design and PCR amplification are performed, and reaction conditions are optimized; the reaction conditions are that dNTP concentration is 2.0 mmol/L, Mg<2+> concentration is 1.0 mmol/L, the concentrations of upstream and downstream primers corresponding to three genes Nc-5, GRA6 and PRL are 0.125 mmol/L, 0.5 mmol/L and 0.25 mmol/L respectively, and Taq DNA polymerase is 1.5 U; the amplification is performed at 95 DEG C for 5 minutes, at 95 DEG C for 30 seconds, at 58 DEG C for 45 seconds and at 72 DEG C for 30 seconds, and 30 circulations is carried out; finally extension is performed at 72 DEG C for 10 minutes. The kit is applied to the field of synchronous detection of bovine neosporosis and toxoplasmosis.

Description

Multiple PCR detection kit is marked in a kind of ox neosporosis and toxoplasmosis

Technical field

The present invention relates to animal test Quarantine Techniques field, concrete, the present invention relates to a kind of technical field for marking multiple PCR detection kit in ox neosporosis and toxoplasmosis.

Background technology

Ox neosporosis ( neosporosis) be by Demodiosis canis ( neospora caninum, n.caninum) colonize in a kind of protozoal disease caused in host, the intermediate host of this disease is the warm-blooded animals such as ox, sheep, goat, dog, horse, deer mouse, ultimate host is dog, mainly cause pregnant domestic animal miscarriage, stillborn foetus and newborn animal motor nervous system disease, can vertical transmission, all fall ill throughout the year, this disease is particularly serious to the harm of ox, is that the one of the main reasons of milk cow miscarriage, weak tire, stillborn foetus, mummy tire is caused in many areas in the world.Ox toxoplasmosis ( toxoplasmosis) be by toxoplasma gondii ( toxoplasma gondii, T. gondii) a kind of parasitic zoonoses of causing, cat is final host, and people and animal are intermediate host, and the miscarriage caused can occur in each stage of milk cow gestation.These two kinds of diseases are worldwide distribution, cause huge financial loss to livestock industry.Efficient detection method fast, the morning for this disease finds, early control has vital role.

At present, the detection method that ox neosporosis and toxoplasmosis are commonly used has pathology tissue detection, pathogeny detection and Serum Antibody Detection.But because Demodiosis canis is similar to the morphological structure of toxoplasma gondii, the two can cause the miscarriage of milk cow, stillborn foetus and nervous system disorders, and the two exists cross-reacting antigen, and some Serology test there will be cross reaction; Often there is polyinfection in these two kinds of cause of diseases clinically, and symptom is close, is often difficult to distinguish detect.

PCR detection technique has the advantages such as quick, sensitive, special, and at present, existing a lot of employing PCR method detects these two kinds sick reports.Research shows, clinical samples is as contained a large amount of non-principal components in the samples such as serum, whole blood, tissue and secretory product, can cause the suppression to pcr amplification, in nucleic acid extraction process, the residual of reagent also can suppression PCR amplification, thus cause false negative result or quantitative values on the low side.On the other hand, the loss in nucleic acid extraction process, also can cause false negative result.So, quality monitoring is carried out to testing process most important.

Through retrieval, have no relevant detection sensitivity both at home and abroad high, specificity is good, easy to operate, and is added by interior target, indicates and calibrates false negative result, can detect the report of the interior mark multi-PCR detection method of ox neosporosis and toxoplasmosis simultaneously.Therefore; explore and research detection sensitivity high; specificity is good; easy to operate and can indicate and calibrate the method for false negative result; for promptly and accurately effectively detecting neosporosis and toxoplasmosis, all significant in protection livestock industry sound development, the outlet of promotion agricultural products in China and the protection China favorable image in international trade etc.

Summary of the invention

High for having no relevant detection sensitivity both at home and abroad at present, specificity is good, easy to operate and can indicate and correct false negative result, improve the accuracy rate of detected result, mark multiple PCR method in can detecting ox neosporosis and toxoplasmosis simultaneously, the invention provides in a kind of ox neosporosis and toxoplasmosis and mark multiple PCR detection kit, pass through design of primers, use substance pcr amplification, obtain neospora, the pcr template of toxoplasma gondii and amplification interior label, and reaction conditions is optimized, establish the multiplex PCR detection system containing internal standard substance, detection sensitivity is high, specificity is good, test period is short, and can indicate and correct false negative result, achieve and ox neosporosis and toxoplasmosis are detected separately or synchronous detection, and quality monitoring can be carried out to detected result, thus it is sensitive to realize ox neosporosis and toxoplasmosis, efficiently, fast, accurate detection.

Main technical schemes of the present invention: mark multiple PCR detection kit by providing in a kind of ox neosporosis and toxoplasmosis, establish the detection method of a kind of ox neosporosis and toxoplasmosis, adopt in double PCR reaction system introduce instruction false-negative interior mark ( internal amplification control, IAC), by design of primers and pcr amplification, through reaction condition optimization, successfully establish containing interior target multi-PRC reaction system, can monitor nucleic acid extraction and pcr amplification process, display suppresses the existence of composition, and the generation of instruction false negative result, guarantees Detection job.

The present invention specifically provides in a kind of ox neosporosis and toxoplasmosis and marks multiple PCR detection kit, described test kit consists of the following composition by 50 secondary response system assemblings: test kit reaction system is, 0.5mL pcr amplification reagent mixed liquor, comprise Tris-HCl pH8.4,40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L); 5U/ μ L taqenzyme 75U; Deionized water 1.0mL; Detection primer used is:

(1) neospora detects primer:

Upstream primer ( nc-F): gTTGCTCTGCTGACGTGTCGTTG

Downstream primer ( nc-R): cTCAACACAGAACACTGAACTCTCG

The GeneBank accession number that can increase is X84238.1, 469-690position Demodiosis canis nc-5gene specific nucleotide sequence, as SEQ ID NO.1;

(2) toxoplasma gondii detects primer:

Upstream primer ( gRA-F): aTGATACAACCTCCGAAGCG

Downstream primer ( gRA-R): cGTCTTGTGCCCTGTTCTTC

The GeneBank accession number that can increase is HM776942.1, 265-388the GRA6 gene specific nucleotide sequence of position toxoplasma gondii, as SEQ ID NO.2;

(3) in monitoring, mark detects primer:

Upstream primer ( pRL-F): tCAGCAAAGTATAAACCGATAGC

Downstream primer ( pRL-R): cAATCTCTATGGCCCTCGA

The GeneBank accession number that can increase is AF426315.1, 8142-8449position cow-prolactin PRL gene specific nucleotide sequence, as SEQ ID NO.3.

Meanwhile, the present invention specifically provides in a kind of ox neosporosis and toxoplasmosis and marks multiple PCR detection kit, and described interior mark multiple PCR detection kit is obtained by following concrete grammar:

(1) Design and synthesis of primer: according to GenBank accession number be the Demodiosis canis Nc-5 gene of X84238.1, the cow-prolactin PRL gene of GenBank accession number to be the toxoplasma gondii GRA6 gene of HM776942.1 and GenBank accession number be AF426315.1, each design a pair Auele Specific Primer, the object fragment length of amplification is respectively 222 bp, 124 bp and 308 bp.

(2) preparation of template DNA and the structure of positive recombinant plasmid: carry out operation according to anticoagulated whole blood poba gene group DNA extraction system and extract nucleic acid, the tissue such as liver, kidney, aborted fetus extracts nucleic acid with DNAZol after grinding, cell culture DNAZol extracts nucleic acid, and the nucleic acid of extraction saves backup in-20 DEG C.

With the structure of positive recombinant plasmid with Demodiosis canis nucleic acid for template, amplify with primer Nc-F and Nc-R the fragment that length is 222 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-Nc5; The structure of positive recombinant plasmid is with toxoplasma gondii nucleic acid for template, and amplify with primer GRA-F and GRA-R the fragment that length is 124 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-GRA6; The structure of positive recombinant plasmid is with cow-prolactin PRL nucleic acid for template, and amplify with primer PRL-F and PRL-R the fragment that length is 308 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-PRL.

(3) foundation of mark multiplexed PCR amplification system in:

Adopt 20 μ L reaction systems: 10 × buffer 2.0 uL, dNTP concentration is respectively 2.5,2.0,1.5 and 1.0 mmol/L, and primer concentration is respectively 0.75,0.50,0.25 and 0.125 μm of ol/L, Mg ²⁺concentration is respectively 2,1.5,1.0 and 0.5 mmol/L, taqarchaeal dna polymerase is respectively 1.75,1.5,1.25,1.0,0.75 and 0.5U, and annealing temperature is respectively 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C and 60 DEG C, and cycle number is respectively 30,35 and 40; Other parameter constants during through optimizing one, carry out the optimization of Nc-5, GRA6 and PRL gene substance PCR reaction conditions, respectively on the basis of substance PCR reaction conditions, carry out multiplex PCR optimization, determine that condition of answering is: 10 × buffer 2.0 uL, dNTP concentration is 2.0 mmol/L, Mg ²⁺concentration is 1.0 mmol/L, and the upstream and downstream primer concentration corresponding to Nc-5, GRA6 and PRL tri-genes is respectively 0.125 μm of ol/L, 0.5 μm of ol/L and 0.25 μm ol/L, taqarchaeal dna polymerase 1.5 U, DNA 2 μ L, mends deionized water to 20 μ L; Amplification condition is 95 DEG C of 5 min; 95 DEG C of 30 s, 58 DEG C of 45s, 72 DEG C of 30 s, 30 circulations; 10 min are extended finally by 72 DEG C; After testing inspection terminates, be the agarose gel electrophoresis of 25g/L by concentration, 80 V-100V 60min, observations, amplifies the electrophoretic band that size is 222 bp, 124 bp and 308bp respectively, conforms to aim sequence fragment in same reaction tubes.

(4) composition of test kit: can carry out 50 parts of sample amplification amount assembling detection kit, test kit is composed as follows: 0.5 mL pcr amplification reagent mixed liquor, comprises Tris-HCl (pH8.4) 40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L; 5U/uL taqarchaeal dna polymerase 75U; Deionized water 1.0mL.

Test kit reaction conditions is: pcr amplification reagent mixed liquor 10 μ L, taqarchaeal dna polymerase 0.3 μ L, DNA 2 μ L, mends deionized water to 20uL; The same above-mentioned steps of amplification condition (3).

Further, the invention provides and mark the concrete detection method of multiple PCR detection kit in ox neosporosis and toxoplasmosis and be:

(1) extraction of nucleic acid: carry out operation according to anticoagulated whole blood poba gene group DNA extraction system and extract nucleic acid, tissue sample extracts nucleic acid with DNAZol after grinding, and cell culture DNAZol extracts nucleic acid, and the nucleic acid of extraction saves backup in-20 DEG C.

(2) mark multiplexed PCR amplification in: multi-PRC reaction condition is: pcr amplification reagent 10 μ L, DNA 2 μ L, taqarchaeal dna polymerase 0.3 μ L, mends deionized water to 20uL; Amplification condition is: 95 DEG C of 5 min; 95 DEG C of 30 s, 58 DEG C of 45s, 72 DEG C of 30 s, 30 circulations; 72 DEG C extend 10 min; After testing inspection terminates, be the agarose gel electrophoresis of 25 g/L by concentration, 80 V-100V, 60min, observations.

(3) Analysis of test results: test sample amplifies the object band that size is 222 bp, 124 bp and 308bp simultaneously, shows that this sample neosporosis and toxoplasmosis are the positive; It is 308bp electrophoretic band that test sample amplifies size, and has any electrophoretic band of 222 bp or 124 bp, amplifies 222 bp bands, shows this sample neosporosis, amplify 124 bp bands, show this sample toxoplasmosis, be the positive; It is 308bp electrophoretic band that test sample only amplifies size, shows that this sample neosporosis and toxoplasmosis are feminine gender; It is any electrophoretic band in 222 bp, 124 bp and 308bp that test sample can not expand size, shows to exist in reaction to suppress composition, need re-start detection.

The present invention passes through to confirm the specificity marking multiple PCR detection kit in ox neosporosis and toxoplasmosis, sensitivity and repeatability, by monitoring template extraction and pcr amplification process, the interior mark multiple PCR detection kit demonstrating ox neosporosis prepared by above-mentioned steps and toxoplasmosis has that detection sensitivity is high, specificity good, the test period is short, and can indicate and correct false negative result, guarantee the accuracy of detected result.

Further; the invention provides the application of the interior mark multiple PCR detection kit of a kind of ox neosporosis and toxoplasmosis; increased with this test kit the positive cattle tissue nucleic acid samples such as infection infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansi respectively; sample is except the band amplifying interior mark PRL gene 308bp; there is not other band, show that the method has good specificity.

The present invention increases to three kinds of positive recombinant plasmid mixtures of 10 times of gradient dilutions dilutions respectively with marking multiple PCR detection kit in providing, and the lowest detection of interior mark multiple PCR method to two kinds of genes is limited to 7 × 10 ³copy/reaction.And the lowest detectable limit of substance PCR to often kind of gene of correspondence is 7 × 10 ²copy/reaction, the lowest detection of dual-PCR method to two kinds of genes is limited to 7 × 10 ³copy/reaction, in illustrating, the sensitivity of the interior mark multiplex PCR detection system that this institute of mark PRL gene pairs sets up almost does not affect, and shows that the method has higher sensitivity.

The present invention marks multiple PCR detection kit in providing, and mark multiplexed PCR amplification system in utilizing, to 7 × 10 ⁷the positive recombinant plasmid mixture of pMD-Nc5, pMD-GRA6 and pMD-PRL of copy/μ L is that template carries out 3 duplicate detection, all can amplify the specific fragment of 222bp, 124 bp, 308bp, show that the method has good repeatability.

By implementing the concrete summary of the invention of the present invention, following beneficial effect can be reached:

(1) detection time is short: adopt at least need 5 the detection time of traditional method in the sky, conventional substance PCR detects at least needing 6 days two kinds of sick detection times, adopting test kit provided by the invention to comprise sample pre-treatments to obtaining detected result within 3 hours detection time, greatly shortening compared with the detection time of other method.

(2) detection sensitivity is high: the present invention can detect 7 × 10 ³the recombinant plasmid of individual copy, with unsuitable containing the sensitivity of interior target double PCR.

(3) specificity is good: by detecting assaypositive tissue nucleic acid samples such as infection infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansis; detected result is feminine gender, and only the positive nucleic acid sample detection of neospora, toxoplasma gondii is positive.

(4) reproducible: by 7 × 10 ⁷the positive recombinant plasmid mixture of copy/μ L pMD-Nc5, pMD-GRA6 and pMD-PRL is that template carries out 3 repeatability detections, all can amplify 222bp, 124 bp, 308bp specific fragments.

(5) pollute less: compared with detecting with conventional substance PCR, whole reaction provided by the invention is carried out in same closed pipe, only needs an experimental implementation, decreases the pollution that too much operating process causes.

(7) generation of false negative result can be indicated: increasing along with the carrying out of reaction because marking template in this reaction system, if sample and interior mark template all do not increase, illustrating that this detected result is false negative result.

(8) flow process is simple: strong operability, is easy to grasp, as long as possess molecular biology mechanism knowledge, just can complete very well without the need to good special training.

(9) cost is low: the reagent of use is molecular biology common agents, low price, and be easy to buying, consumption is few.

(10) in, mark is reasonable in design: cow-prolactin PRL gene is positioned at No. 23 euchromosome, its expression product is prolactin, mainly express in the lactotroph of ox adenohypophysis, the target organ of effect is entered with circulation of blood, a lot of organs outside hypophysis such as decidua tissue, uterus muscle, placenta, amniotic fluid, hypothalamus, thymus gland, lachrymal gland and Lymphoid tissue etc. have it to synthesize, and this gene genetic marker that to be ox milk production trait potential, interior Quality Control (IAC) can be it can be used as.Designed primer has good specificity, through the optimization of reaction conditions, can ensure the carrying out of interior tap section and two goal gene coamplifications, and the amplification of internal standard gene does not affect the sensitivity of detection, thus can be monitored the whole process of template extraction and pcr amplification by interior target amplification.

(11) practical value is high: the present invention realizes implementing monitoring to process of the test, effectively solves the false negative result existed in prior art traditional detection method, can carry out quality monitoring, guarantee the accuracy of detected result to laboratory.

(12) effect is good: adopt the present invention's 157 these systems of increment product to clinical collection to detect, all obtain expected results.

(13) reference is large: adopt the present invention, for the research of the sick inspection and quarantine technology of relevant animal provides good reference, and instructs reference for specification detection reagent has to the development of standardization.

(14) have a extensive future: the present invention can be widely used in inspection and quarantining for import/export department, animal and veterinary department and cultivation unit, for effective prevention and control of epidemic disease are significant.

Accompanying drawing explanation

Figure 1 shows that the amplification test-results of different primers to three kinds of positive plasmid mixtures, wherein, 1 is negative control, 2 is the amplification (124bp) of primer GRA-F/GRA-R to three kinds of positive plasmid mixtures, 3 is the amplification (222bp) of primer Nc-F/Nc-R to three kinds of positive plasmid mixtures, 4 is the coamplification result (308bp) of primer PRL-F/PRL-R to three kinds of positive plasmid mixtures, 5 is Nc-F/Nc-R, GRA-F/GRA-R, PRL-F/PRL-R tri-kinds of primer pairs three kinds of positive plasmid mixture pMD-Nc5, coamplification result (the 222bp of pMD-GRA6 and pMD-PRL, 124 bp, 308bp), M is 100bp DNA Ladder.

Figure 2 shows that the specific test result of interior mark multiplex PCR, wherein, 1 is negative control; 2 is the coamplification result (222bp, 124 bp, 308bp) of Nc-F/Nc-R, GRA-F/GRA-R, PRL-F/PRL-R tri-kinds of primer pairs three kinds of positive plasmid mixtures pMD-Nc5, pMD-GRA6 and pMD-PRL; 3-7 is that Nc-F/Nc-R, GRA-F/GRA-R, PRL-F/PRL-R tri-kinds of primer pairs infect the positive cattle tissue nucleic acid samples amplifications such as infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansi, and M is 100bp DNA Ladder.

Figure 3 shows that PCR susceptibility test-results, wherein, A is that primer GRA-F/GRA-R is to 7 × 10 ⁹-7 × 10 ¹positive plasmid pMD-GRA6 substance pcr amplification result (124bp) of copy/μ L serial dilution, B is that primer GRA-F/GRA-R, Nc-F/Nc-R are to 7 × 10 ⁹-7 × 10 ¹the positive plasmid pMD-GRA6 of copy/μ L serial dilution and pMD-Nc5 double PCR amplification (124bp, 222bp), C is Nc-F/Nc-R, GRA-F/GRA-R, PRL-F/PRL-R tri-kinds of primer pairs 7 × 10 ⁹-7 × 10 ¹the coamplification result (222bp, 124 bp, 308bp) of positive plasmid pMD-Nc5, pMD-GRA6 and pMD-PRL of copy/μ L serial dilution, wherein, M is 100bp DNA Ladder, 1-9 is 7 × 10 ⁹-7 × 10 ¹three kinds of positive plasmid mixtures of copy/μ L serial dilution, 10 is negative control.

Figure 4 shows that interior target inhibition test-results, wherein, 1-9. 7 × 10 ⁹-7 × 10 ¹pMD-Nc5, pMD-GRA6 of copy/μ L serial dilution are respectively with 7 × 10 ⁷the coamplification result (222bp, 124 bp, 308bp) of the positive plasmid mixture of copy/μ L pMD-PRL, 10. negative control, M is DL2000 marker.

Fig. 5 is depicted as interior mark multiplex PCR replica test result, wherein, 1 is negative control, 2-4 is the repeated coamplification result (222bp, 124 bp, 308bp) of Nc-F/Nc-R, GRA-F/GRA-R, PRL-F/PRL-R tri-kinds of primer pair positive plasmids pMD-Nc5, pMD-GRA6 and pMD-PRL, and M is 100bp DNA Ladder.

Embodiment

, for embodiment, the present invention is described below, but the present invention is not limited to following enforcement.

In the present invention in reference gene storehouse GenBank accession number be the neospora Nc-5 gene of X84238.1, the cow-prolactin PRL gene order design primer of GenBank accession number to be the toxoplasma gondii GRA6 gene of HM776942.1 and GenBank accession number be AF426315.1, those of ordinary skill in the art can be known by the channel of the public.

Positive nucleic acid, the sample selected in the present invention: Demodiosis canis and the positive nucleic acid of toxoplasma gondii, obtained by animal medicine institute of China Agricultural University, the samples such as ox anticoagulated whole blood and liver, kidney, aborted fetus pick up from different areas, Xinjiang; Infect the assaypositive tissue nucleic acid samples such as infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansi to be preserved by Xinjiang Entry-Exit Inspection and Quarantine Bureau technique center; Obtain in the ox whole blood that cow-prolactin PRL gene is preserved by Xinjiang Entry-Exit Inspection and Quarantine Bureau technique center.Above sample copy exercising ordinary skill also obtains by public's channel approach.

The main agents selected in the present invention: taqarchaeal dna polymerase (5 U/ μ L), 10 × buffer(comprise Tris-HCl (pH8.4) 200mmoL/L, KCl200mmol/L, (NH ₄) SO ₄100mmol/L), dNTP, Mg ²⁺, sepharose DNA reclaims test kit, high-purity Plasmid Miniprep Kit, poba gene group DNA extraction system and DNAZol, purchased from sky root biotechnology (Beijing) company limited; DL 2000 DNA Maker, 100bp DNA Ladder are purchased from prosperous biotechnology (Beijing) limited liability company of ancient cooking vessel state; Restriction enzyme ecoRi, pMD18-T carriers etc., purchased from precious biotechnology (Dalian) company limited; The present invention adopts anticoagulated whole blood to carry out operation according to poba gene group DNA extraction system specification and extracts nucleic acid, and this is this area common practice.

The key instrument selected in the present invention: high speed freezing centrifuge (HITACHI CF16RX II), micro sample adding appliance (Eppendorf), grads PCR instrument (Biometra), electrophoresis apparatus (Bio-RAD MODEL200), gel imaging system (INTASUXDT-40SM-15K), trace dna Protein Detection instrument (Nano Drop ND1000) etc.

The all reagent selected in the present invention and instrument are all well known selecting, but do not limit enforcement of the present invention, and other reagent more well known in the art and equipment are all applicable to the enforcement of the following embodiment of the present invention.

embodiment one: the preparation of the interior mark multiple PCR detection kit of ox neosporosis and toxoplasmosis

The interior mark multiple PCR detection kit of ox neosporosis and toxoplasmosis, described interior mark multiple PCR detection kit is obtained by following concrete grammar.

(1) Design and synthesis of primer

According to GenBank accession number be the neospora Nc-5 gene of X84238.1, the cow-prolactin PRL gene of GenBank accession number to be the toxoplasma gondii GRA6 gene of HM776942.1 and GenBank accession number be AF426315.1, each design a pair Auele Specific Primer, the object fragment length of amplification is respectively 222 bp, 124 bp and 308 bp.

(2) preparation of template DNA and the structure of positive recombinant plasmid

Carry out operation according to anticoagulated whole blood poba gene group DNA extraction system and extract nucleic acid, the tissue such as liver, kidney, aborted fetus extracts nucleic acid with DNAZol after grinding, and cell culture DNAZol extracts nucleic acid, and the nucleic acid of extraction saves backup in-20 DEG C.

In the present invention, the structure of positive recombinant plasmid is with the positive nucleic acid of Demodiosis canis for template, and amplify with primer Nc-F and Nc-R the fragment that length is 222 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-Nc5.

In the present invention, the structure of positive recombinant plasmid is with the positive nucleic acid of toxoplasma gondii for template, and amplify with primer GRA-F and GRA-R the fragment that length is 124 bp, this fragment is cloned into pMD-18T carrier, obtains To Template pMD-GRA6.

In the present invention, the structure of positive recombinant plasmid is with the positive nucleic acid of cow-prolactin PRL for template, and amplify with primer PRL-F and PRL-R the fragment that length is 308 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-PRL.

(3) foundation of mark multiplexed PCR amplification system in

The present invention adopts 20 μ L reaction systems: 10 × buffer 2.0 uL, and dNTP concentration is respectively 2.5,2.0,1.5 and 1.0 mmol/L, and primer concentration is respectively 0.75,0.50,0.25 and 0.125 μm of ol/L, Mg ²⁺concentration is respectively 2,1.5,1.0 and 0.5 mmol/L, taqarchaeal dna polymerase is respectively 1.75,1.5,1.25,1.0,0.75 and 0.5U, and annealing temperature is respectively 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C and 60 DEG C, and loop parameter is respectively 30,35 and 40; Other parameter constants during through optimizing one, carry out the optimization of Nc-5, GRA6, PRL gene substance PCR reaction conditions respectively, interior mark multi-PRC reaction condition after optimization is: 10 × buffer 2.0 uL, dNTP concentration is 2.0 mmol/L, upstream and downstream primer concentration corresponding to Nc-5, GRA6 and PRL tri-genes is respectively 0.125 μm of ol/L, 0.5 μm of ol/L and 0.25 μm ol/L, Mg ²⁺concentration is 1.0 mmol/L, taqarchaeal dna polymerase 1.5 U, DNA 2 μ L, mends deionized water to 20 μ L system; Amplification condition is 95 DEG C of 5 min; 95 DEG C, 30 s 58 DEG C, 45s 72 DEG C, 30 s 30 circulations; 10 min are extended finally by 72 DEG C; After testing inspection terminates, be the agarose gel electrophoresis of 25 g/L by concentration, 100V, 60min, observations, amplifies the electrophoretic band that size is 222 bp, 124 bp and 308bp respectively, conforms to aim sequence fragment in same reaction tubes.

(4) composition of test kit

According to this professional common practice, the present invention is by carrying out 50 parts of sample amplification amount assembling detection kit, according to the concentration of an each composition of reaction system in above-mentioned 3, as calculated, the test kit reaction system of assembling comprises: 0.5 mL pcr amplification reagent, comprises Tris-HCl (pH8.4) 40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L; 5U/uL taqarchaeal dna polymerase 75U; Deionized water 1.0mL.

(5) test kit reaction conditions and amplification condition

According to above-mentioned steps (3), test kit reaction conditions is: pcr amplification reagent 10 μ L, DNA 2 μ L, taqarchaeal dna polymerase 0.3 μ L, mends deionized water to 25uL; The same above-mentioned steps of amplification condition (3).

Multiple PCR detection kit is marked in the ox neosporosis provided by aforesaid method and toxoplasmosis, described test kit consists of the following composition by 50 secondary response system assemblings: test kit reaction system is, 0.5mL pcr amplification reagent mixed liquor, comprise Tris-HCl pH8.4,40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L); 5U/ μ L taqenzyme 75U; Deionized water 1.0mL; Detection primer used is:

(1) neospora detects primer:

Upstream primer ( nc-F): gTTGCTCTGCTGACGTGTCGTTG

Downstream primer ( nc-R): cTCAACACAGAACACTGAACTCTCG

The GeneBank accession number that can increase is X84238.1, 469-690position Demodiosis canis nc-5gene specific nucleotide sequence, as SEQ ID NO.1;

(2) toxoplasma gondii detects primer:

Upstream primer ( gRA-F): aTGATACAACCTCCGAAGCG

Downstream primer ( gRA-R): cGTCTTGTGCCCTGTTCTTC

The GeneBank accession number that can increase is HM776942.1, 265-388the GRA6 gene specific nucleotide sequence of position toxoplasma gondii, as SEQ ID NO.2;

(3) in monitoring, mark detects primer:

Upstream primer ( pRL-F): tCAGCAAAGTATAAACCGATAGC

Downstream primer ( pRL-R): cAATCTCTATGGCCCTCGA

The GeneBank accession number that can increase is AF426315.1, 8142-8449position cow-prolactin PRL gene specific nucleotide sequence, as SEQ ID NO.3.

embodiment two: the preparation of template and the structure of positive recombinant plasmid

1. the Design and synthesis of primer and probe

Primer code name of the present invention, sequence, position are in table 1, wherein, neospora Nc-5 gene (GenBank accession number: X84238.1), toxoplasma gondii GRA6 gene (GenBank accession number: HM776942.1) and cow-prolactin PRL gene (GenBank accession number: AF426315.1) primers in reference gene storehouse, the object fragment length of amplification is respectively 222 bp, 124 bp and 308 bp, specifically see attached gene order table; Those of ordinary skill in the art can be known by the channel of the public.

mark multiple PCR primer design result in table 1

2. the preparation of template DNA and the structure of positive recombinant plasmid

The preparation of 2.1 template DNAs

Anticoagulated whole blood carries out operation according to poba gene group DNA extraction system specification and extracts nucleic acid, the tissue such as liver, kidney, aborted fetus extracts nucleic acid with DNAZol after grinding, cell culture DNAZol extracts nucleic acid, and the nucleic acid of extraction saves backup in-20 DEG C.

The structure of 2.2 positive recombinant plasmids

With the positive nucleic acid of Demodiosis canis for template, amplify with primer Nc-F/Nc-R the fragment that length is 222 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-Nc5; With the positive nucleic acid of toxoplasma gondii for template, amplify with primer GRA-F/GRA-R the fragment that length is 124 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-GRA6; With the positive nucleic acid of cow-prolactin PRL for template, amplify with primer PRL-F/PRL-R the fragment that length is 308 bp, this fragment is cloned into pMD18-T carrier, obtains To Template pMD-PRL.

2.3 each primer pair template position and pcr amplification partial sequence as follows:

Neospora Nc-5 gene amplification sequence, as SEQ ID NO.1:

GTTGCTCTGCTGACGTGTCGTTGTTGGGCGCAGCCTGCGGCAGCAAGGCTCCTTTTTGTTTGTGACTATAGTGTGTGAACGGGTGAACCGAGGGAGTTGGTAGCGGTGAGAGGTGGGATACGTGGTTTGTGGTTAGTCATTCGTCACGTTGAAATCAGCCTGCGTCAGGGTGAGGACAGTGTGTCAATGATACTTAT CGAGAGTTCAGTGTTCTGTGTTGAG

Toxoplasma gondii GRA6 gene amplification sequence, as SEQ ID NO.2:

ATGATACAACCTCCGAAGCGGCGGAGGGCGACGTTGACCCTTTTCCCGTGCTGGCGAATGAGGGGAAGTCGGAGGCGCGTGGCCCGTCGCTCGAGGAAAGAATC GAAGAACAGGGCACAAGACG

Cow-prolactin PRL gene amplification sequence, as SEQ ID NO.3:

TCAGCAAAGTATAAACCGATAGCTTACATTTTATAATTTTGCAACCTTCAAAAAATTTTCAATACATATAGGAAAAACCAGGAGTTTTTTAGGTCAATCACTCTGAGCAAAAATCACATGTTACCAAATCCACTGAATTATGCTTATTTTAATGAGATTGTTTCTTGTGGTCGTTCAGCATGAAGTCCTTATGAGCTTGATTCTTGGGTTGCTGCGCTCTTGGAATGACCCTCTGTATCACCTAGTCACCGAGGTACGGGGTATGAAAGGAGCCCCAGATGCTATCCTA TCGAGGGCCATAGAGATTG

Above dashed part is primer binding sites.

embodiment three: the foundation of interior mark multiplexed PCR amplification system

1. the optimization of substance PCR reaction

Adopt 20 μ L reaction systems: 10 × buffer 2.0 uL, dNTP concentration is respectively 2.5,2.0,1.5 and 1.0 mmol/L, and primer concentration is respectively 0.75,0.5,0.25 and 0.125 μm of ol/L, Mg ²⁺concentration is respectively 2,1.5,1.0 and 0.5 mmol/L, Taq archaeal dna polymerase is respectively 1.75,1.5,1.25,1.0,0.75 and 0.5U, annealing temperature is respectively 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C and 60 DEG C, and loop parameter is respectively 30,35 and 40.Other parameter constants when optimizing one.Substance PCR reaction conditions after optimization: 10 × buffer 2.0 uL, dNTP concentration is 1.5 mmol/L, and Nc-5, GRA6 and PRL primer concentration is 0.5 μm of ol/L, Mg ²⁺concentration is 0.5 mmol/L, taqtaq archaeal dna polymerase 1.0 U, DNA 2 μ L, mends deionized water to 20 μ L system; Amplification condition is: 95 DEG C, 5 min; 95 DEG C, 30 s, 58 DEG C, 45 s, 72 DEG C, 30s, 35 circulations; 10 min are extended finally by 72 DEG C.Amplify the electrophoretic band that size is 124 bp, 222 bp and 308 bp in different reaction tubess respectively, conform to object fragment.

2. the optimization of double PCR reaction conditions

Under substance PCR optimum reaction condition prerequisite, in a reaction tubes, carry out double PCR amplification with the upstream and downstream primer of Nc-5, GRA6 gene simultaneously, carry out optimization and the observations of reaction conditions with 1.2.3.Double PCR reaction conditions after optimization is: 1 × buffer, dNTP 1.5 mmol/L, Nc-5, GRA6 primer concentration is 0.25 μm of ol/L, Mg ²⁺concentration is 1.0 mmol/L, Taq archaeal dna polymerase 1.25 U, DNA 2 μ L, and deionized water supplies 20 μ L systems; Amplification condition is: 95 DEG C, 5 min; 95 DEG C, 30 s, 58 DEG C, 45s, 72 DEG C, 30 s, 35 circulations; 10 min are extended finally by 72 DEG C.In same reaction tubes, amplify the electrophoretic band that size is 222 bp and 124 bp respectively, conform to object fragment.

3. the optimization of mark multiplex PCR reaction in

Under double PCR optimum reaction condition prerequisite, in same reaction tubes, carry out interior mark multiplexed PCR amplification with three pairs of primers of Nc-5, GRA6 and PRL tri-genes, carry out optimization and the observations of reaction conditions with 2.1,2.2.

Interior mark multi-PRC reaction condition after optimization is: 10 × buffer 2.0 uL, dNTP concentration is 2.0 mmol/L, upstream and downstream primer concentration corresponding to Nc-5, GRA6 and PRL tri-genes is respectively 0.125 μm of ol/L, 0.5 μm of ol/L and 0.25 μm ol/L, Mg ²⁺concentration is 1.0 mmol/L, taqarchaeal dna polymerase 1.5 U, DNA 2 μ L, deionized water supplies 20 μ L systems; Amplification condition is the same.In same reaction tubes, amplify the electrophoretic band that size is 222 bp, 124 bp and 308bp respectively, conform to object fragment.

See accompanying drawing 1, in same reaction system, with pMD-Nc5, pMD-GRA6 and pMD-PRL isocyatic positive mixing plasmid for template, substance PCR and interior mark multiplexed PCR amplification is carried out respectively with corresponding primer, all obtain respective object band, and each primer pair separately gene there is good specificity.

embodiment four: specific detection

Increased with the multiple reaction system in embodiment one and amplification condition the positive cattle tissue nucleic acid samples such as infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansi respectively; sample is feminine gender; illustration method has good specificity, see accompanying drawing 2.

The multiple PCR method that application the present invention sets up increases to the positive recombinant plasmid that three kinds of isoconcentrations mix; result amplifies the specific band that size is respectively 222 bp, 124 bp and 308bp; and the positive nucleic acid samples of the cattle tissue such as infectious bovine rhinotrachetis virus, ox annular loop detector, Theileria sergenti, ox two-pressure humidity generator and ox Trypanosoma evansi preserved testing laboratory is except the band amplifying interior mark PRL gene 308bp; there is not other band, illustrate that the method has stronger specificity.

embodiment five: sensitivity technique

When pMD-Nc5, pMD-GRA6 and pMD-PRL tri-kinds of templates increase simultaneously, enzyme, primer and dNTP can be competed, amplification is had an impact, reaction conditions and the detect and track of coamplification system should be restudied.

PMD-Nc5, pMD-GRA6 and pMD-PRL of concentration known are carried out 7 × 10 ⁹-7 × 10 ¹balanced mix after copy/μ L gradient dilution, increases with interior mark multiple PCR method, carries out synchronous detection, to determine the sensitivity of the method with the substance PCR method in embodiment one and dual-PCR method simultaneously.Reaction system and amplification condition are with implementing one.Result shows, and the lowest detection of interior mark multiple PCR method to two kinds of genes is limited to 7 × 10 ³copy/reaction.And the lowest detectable limit of substance PCR to often kind of gene is 7 × 10 ²copy/reaction, the lowest detection of dual-PCR method to two kinds of genes is limited to 7 × 10 ³copy/reaction.Result shows, the sensitivity of the interior mark multiplex PCR detection system that interior this institute of mark PRL gene pairs sets up almost does not affect.See accompanying drawing 3.

embodiment six: interior target inhibition test

The concentration of fixing pMD-PRL is 7 × 10 ⁷copy/μ L is constant, and pMD-Nc5, pMD-GRA6 of concentration known are carried out 7 × 10 ⁹-10 ¹respectively balanced mix with it after copy/μ L gradient dilution, increases with marking multiplex PCR method in enforcement one, and carries out synchronous detection with the dual-PCR method in enforcement three, to verify interior target inhibition.Reaction system and amplification condition are with implementing one and three.Result shows, interior mark multiple PCR method to Nc-5, GRA6 two the lowest detection of gene be limited to 7 × 10 ³copy/reaction, this is identical with the lowest detectable limit of the dual-PCR method synchronously carried out, and shows that the interior mark multiplex PCR detection system that interior this institute of mark PRL gene pairs sets up almost does not suppress.See accompanying drawing 4.

embodiment seven: repeatability detects

With the reaction system in embodiment one and amplification condition respectively to 7 × 10 ⁷copy/μ L pMD-Nc5, pMD-GRA6 and pMD-PRL are positive, and recombinant plasmid is template, carries out 3 duplicate detection, verifies its stability.Result shows that the method has well repeatability and stability.See accompanying drawing 5.

embodiment eight: the assembling of test kit

After the reaction system provided through above-described embodiment and amplified conditions optimization, assembling detection kit, according to this professional common practice, the present invention is by carrying out 50 parts of sample amplification amount assembling detection kit, according to the concentration of a reaction system in embodiment three, the test kit reaction system of assembling comprises: 0.5 mL pcr amplification reagent, comprises Tris-HCl (pH8.4) 40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L; 5U/uL taqarchaeal dna polymerase 75U; Deionized water 1.0mL.

According to embodiment three, test kit reaction conditions is: pcr amplification reagent 12.5 μ L, DNA 2 μ L, taqenzyme 0.3 μ L, mends deionized water to 25uL; Amplification condition is with above-described embodiment three.

Respectively test kit specificity, sensitivity and repeatability are verified by embodiment four, example five and example seven, all come to the same thing with embodiment four, example five and example seven.

embodiment nine: to the detection of clinical sample

Detection kit of the present invention is utilized to detect 157 parts of samples such as ox whole blood, serum and liver, kidney, aborted fetus cattle tissue of miscarrying of five the cattle farm random acquisitions picking up from five different areas, Xinjiang respectively.Result shows, and in the sample that each department gather, has four cattle farms to there is arch insect infection, has two cattle farms to there is neospora infections.Utilize dual-PCR method ox neosporosis positive 9 parts to be detected, positive rate is 5.7 %, ox toxoplasmosis positive 20 parts, and positive rate is 12.7 %, 8 parts, polyinfection sample, positive rate 5.1%.Utilize this test kit ox neosporosis positive 10 parts to be detected, positive rate is 6.4 %, ox toxoplasmosis positive 20 parts, and positive rate is 12.7 %, 9 parts, polyinfection sample, positive rate 5.7 %.Find simultaneously, 4 increment product are had without any amplified band in above-mentioned sample, show that there is gene loses or have the existence suppressing composition in amplification procedure, after again extracting detection of nucleic acids, all obtain expected results, and have a sample neosporosis test positive, further demonstrate this interior target supervisory function bit.

sequence table

<110> Inspection and Quarantine Center of Xinjiang Entry-Exit Inspection and Quarantin

Multiple PCR detection kit is marked in <120> ox neosporosis and toxoplasmosis

Multiple PCR detection kit is marked in <130> ox neosporosis and toxoplasmosis

<160> 3

SEQ ID NO.1

<210> 1

<211> 222

<212> DNA

<213> Neosporacaninum

<400> 1

gttgctctgc tgacgtgtcg ttgttgggcg cagcctgcgg cagcaaggct cctttttgtt 60

tgtgactata gtgtgtgaac gggtgaaccg agggagttgg tagcggtgag aggtgggata 120

cgtggtttgt ggttagtcat tcgtcacgtt gaaatcagcc tgcgtcaggg tgaggacagt 180

gtgtcaatga tacttatcga gagttcagtg ttctgtgttg ag 222

SEQ ID NO.2

<210> 2

<211> 124

<212> DNA

<213> Toxoplasma

<400> 2

atgatacaac ctccgaagcg gcggagggcg acgttgaccc ttttcccgtg ctggcgaatg 60

aggggaagtc ggaggcgcgt ggcccgtcgc tcgaggaaag aatcgaagaa cagggcacaa 120

gacg 124

SEQ ID NO.3

<210> 3

<211> 308

<212> DNA

<213> Bovine

<400> 3

tcagcaaagt ataaaccgat agcttacatt ttataatttt gcaaccttca aaaaattttc 60

aatacatata ggaaaaacca ggagtttttt aggtcaatca ctctgagcaa aaatcacatg 120

ttaccaaatc cactgaatta tgcttatttt aatgagattg tttcttgtgg tcgttcagca 180

tgaagtcctt atgagcttga ttcttgggtt gctgcgctct tggaatgacc ctctgtatca 240

cctagtcacc gaggtacggg gtatgaaagg agccccagat gctatcctat cgagggccat 300

agagattg 308

 

Claims (2)

1. mark multiple PCR detection kit in an ox neosporosis and toxoplasmosis, it is characterized in that, described test kit consists of the following composition by 50 secondary response system assemblings: test kit reaction system is, 0.5mL pcr amplification reagent mixed liquor, comprise Tris-HCl pH8.4,40mmoL/L, KCl40mmol/L, (NH ₄) SO ₄20mmol/L, Mg ²⁺4.0 mmol/L, dNTP4.0 mmol/L, primer Nc-F/Nc-R, GRA-F/ GRA-R and PRL-F/ PRL-R are respectively 0.25 μm of ol/L, 1 μm of ol/L and 0.5 μm ol/L; 5U/ μ L taqenzyme 75U; Deionized water 1.0mL; Detection primer used is:

(1) neospora detects primer:

Upstream primer ( nc-F): gTTGCTCTGCTGACGTGTCGTTG

Downstream primer ( nc-R): cTCAACACAGAACACTGAACTCTCG

The GeneBank accession number that can increase is X84238.1, 469-690position Demodiosis canis nc-5gene specific nucleotide sequence, as SEQ ID NO.1;

(2) toxoplasma gondii detects primer:

Upstream primer ( gRA-F): aTGATACAACCTCCGAAGCG

Downstream primer ( gRA-R): cGTCTTGTGCCCTGTTCTTC

The GeneBank accession number that can increase is HM776942.1, 265-388the GRA6 gene specific nucleotide sequence of position toxoplasma gondii, as SEQ ID NO.2;

(3) in monitoring, mark detects primer:

Upstream primer ( pRL-F): tCAGCAAAGTATAAACCGATAGC

Downstream primer ( pRL-R): cAATCTCTATGGCCCTCGA

The GeneBank accession number that can increase is AF426315.1, 8142-8449position cow-prolactin PRL gene specific nucleotide sequence, as SEQ ID NO.3.

2. mark multiple PCR detection kit in ox neosporosis and toxoplasmosis as claimed in claim 1, it is characterized in that, described ox neosporosis and toxoplasmosis is interior marks the concrete detection method of multiple PCR detection kit and be:

(1) extraction of nucleic acid: carry out operation according to anticoagulated whole blood poba gene group DNA extraction system and extract nucleic acid, tissue sample extracts nucleic acid with DNAZol after grinding, and cell culture DNAZol extracts nucleic acid, and the nucleic acid of extraction saves backup in-20 DEG C;

(2) mark multiplexed PCR amplification in: multi-PRC reaction condition is: pcr amplification reagent 10 μ L, DNA 2 μ L, taqarchaeal dna polymerase 0.3 μ L, mends deionized water to 20uL; Amplification condition is: 95 DEG C of 5 min; 95 DEG C of 30 s, 58 DEG C of 45s, 72 DEG C of 30 s, 30 circulations; 72 DEG C extend 10 min; After testing inspection terminates, be the agarose gel electrophoresis of 25 g/L by concentration, 80 V-100V, 60min, observations;

(3) Analysis of test results: test sample amplifies the object band that size is 222 bp, 124 bp and 308bp simultaneously, shows that this sample neosporosis and toxoplasmosis are the positive; It is 308bp electrophoretic band that test sample amplifies size, and has any electrophoretic band of 222 bp or 124 bp, amplifies 222 bp bands, shows this sample neosporosis, amplify 124 bp bands, show this sample toxoplasmosis, be the positive; It is 308bp electrophoretic band that test sample only amplifies size, shows that this sample neosporosis and toxoplasmosis are feminine gender; It is any electrophoretic band in 222 bp, 124 bp and 308bp that test sample can not expand size, shows to exist in reaction to suppress composition, need re-start detection.