CN105200044A - Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides - Google Patents
Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides Download PDFInfo
- Publication number
- CN105200044A CN105200044A CN201510466718.4A CN201510466718A CN105200044A CN 105200044 A CN105200044 A CN 105200044A CN 201510466718 A CN201510466718 A CN 201510466718A CN 105200044 A CN105200044 A CN 105200044A
- Authority
- CN
- China
- Prior art keywords
- vibrio fluvialis
- serotype
- nucleotide
- nucleotides
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of the nucleotides. The nucleotides comprise one or more of nucleotides shown in SEQ ID NO.1-10. The nucleotides can be used for preparation of a PCR kit and a gene chip which are used for detecting vibrio fluvialis. The inventor has applied for a patent on nucleotides specific to vibrio fluvialis O2, O4, O13, O15 and O18 serotypes, wherein the application number is CN201410158813. The nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 serotypes, as well as the PCR kit and the gene chip comprising the nucleotides have the advantages that the detection sensitivity and efficiency are improved as the length of the product is greatly shortened; the practicability is higher; the preparation method of the PCR kit is simple and convenient; the detection period is short; the speed is high; the operability is strong; the industrial production is easy; the detection cost is relatively low; the accuracy as well as the sensitivity is high.
Description
Technical field
The present invention relates to vibrio fluvialis O1, the Nucleotide that O6, O7, O8 and O9 serotype is special, particularly relate to vibrio fluvialis O1, the Nucleotide that in O6, O7, O8 and O9 serotype O antigen gene cluster, individual gene is special and application thereof.
Background technology
Vibrio fluvialis is Gram-negative bacteria, be ocean environment mainly perch one of bacterium, extensively be present in river and environment waters, marine outfall, also be one of main bacterial pathogen of the mankind and hydrobiont, the disease of the multiple cultivated animals such as fish, shrimp, shellfish can be played, carry out serious financial loss to cultivation industrial belt.The epidemic diarrhea that vibrio fluvialis can also cause the mankind serious by various food is the kinds of pathogenic vibrio being only second to vibrio cholerae and Vibrio parahaemolyticus in Vibrio, is considered to a kind of novel pathogenic bacteria of global Zoonosis.Its somatotype and qualification are one of important prerequisites of setting up of ocean strain library.
Typing of bacteria and authentication method mainly contain traditional phenotypic approach, serological method and molecular assay method.But along with molecular biological development, traditional serotype and authentication method also exist certain problem, diagnostic method as this in serotype needs a large amount of antiserum(antisera)s, and antiserum(antisera) general classes is incomplete, quantity not sufficient, a large amount of antiserum(antisera)s is in preparation and also there are some difficulties in storing.On the other hand serotype method length consuming time, sensitivity is low, loss is high, poor accuracy, often there is cross reaction between the antiserum(antisera) that different O antigen produces.Therefore, the serological diagnosis method set up based on Protocols in Molecular Biology becomes developing direction.
The Molecular Identification of vibrio fluvialis is more and more subject to people's attention, and becomes the important evidence that vibrio fluvialis bacterial classification and plant type are identified, therefore many new bacterium also produce.For vibrios, the performance of biochemical reaction mainly various zymogram, belongs to the content of formalness, and the similarity of nucleic acid is only the defining the most at all of vibrios kind, the most direct feature.Therefore, somatotype and the qualification of vibrio fluvialis are the most effectively, the most direct mode should trigger from the research of nucleic acid, by comparing the ownership of the similarity determination vibrio fluvialis of nucleic acid (comprising genome and nucleic acid fragment).
In recent years, increasing molecular engineering is used for the somatotype of pathogenic bacteria, qualification, detection and disease screening, comprises transcribed spacer (ITS) sequential analysis, random amplification length polymorphism (RAPD) is analyzed, rDNA restriction fragment length polymorphism (RFLP) is analyzed.Molecular biology method not only can be used for the rapid serum somatotype examination of vibrio fluvialis, and stable qualification result can make up the deficiency of phenotypic characteristic authentication method.Compare with traditional sensing techniques, these are based on the molecular detection technology of polymerase chain reaction (PCR), do not need the process such as separation, pure culture through pathogenic bacteria, and have the advantages such as quick, sensitive, high specificity.
Polymerase chain reaction technology (Polymerasechainreaction, be called for short round pcr) admitted at present as microorganism detection technology and promoted, this technology has relative to traditional method that high-throughput, detection speed are fast, high specificity, sensitivity advantages of higher, only need carry out simple pre-increasing bacterium to sample or increase bacterium process, again by the centrifugal and detailed bacterium DNA profiling of cracking, just can to increase target sequence in the PCR process under the mediation of high specific primer, reach the object detected in sample whether containing invasive organism to be measured.The amplification procedure of PCR only needs 1 and a half hours.This greatly improves working speed undoubtedly to inspection and quarantine department and Clinical Laboratory and reduces job costs.
No matter from internal and international angle, identify serum type quickly and accurately, it is very important that the prevention and control for vibrio fluvialis provide effect technique support.
Summary of the invention
The object of the present invention is to provide and the present invention relates to vibrio fluvialis O1, the Nucleotide that O6, O7, O8 and O9 serotype is special, it is characterized in that described Nucleotide has:
At least one in Nucleotide shown in SEQIDNO:1-10; Described SEQIDNO:1-10 is as follows:
Present invention also offers a kind of PCR kit, comprise PCR primer, dNTP, damping fluid and archaeal dna polymerase, described PCR primer is at least one in the Nucleotide such as shown in SEQIDNO:1-10.Described test kit, also comprises following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; Primer mixture 10 μ l; Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o5ml.
Wherein said PCR primer is preferably at least one in described Nucleotide as shown in SEQIDNO:1-10.
The present invention further discloses vibrio fluvialis O1, O6, O7, the special SEQIDNO:1-10 Nucleotide of O8 and O9 serotype is for the preparation of detection vibrio fluvialis vibrio fluvialis O1, the application of the PCR kit of O6, O7, O8 and O9 serotype, gene chip or microarray aspect.
Vibrio fluvialis of the present invention can sample the crude extract of the culture in tap water, river water, seawater, or the crude extract etc. of the pure growth of vibrio fluvialis.
Collecting vibrio fluvialis extraction genome is adopt ordinary method to prepare.
For the PCR kit of vibrio fluvialis, whole detecting step comprises sample pretreatment-amplification-electrophoresis detection result.Primer and the reagent required for PCR reaction system add in amplification pipe in advance, and pretreated sample only need be added amplification pipe and start amplified reaction by user, and simple and quick completes testing.
The present invention also provides a kind of gene chip, and comprise solid phase carrier and be fixed on the oligonucleotide probe on solid phase carrier, wherein said oligonucleotide probe comprises above-mentioned Nucleotide; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-10.
The present invention also provides a kind of micro-array, and it comprises above-mentioned Nucleotide; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-10.
The present invention further discloses vibrio fluvialis O1, the special Nucleotide of O6, O7, O8 and O9 serotype is for the preparation of the application detected in vibrio fluvialis PCR kit.Application in the gene chip for the preparation of detection vibrio fluvialis.For the preparation of the application detected in vibrio fluvialis microarray.Described detection vibrio fluvialis refers to detection and causes severe diarrhea, septicemia, enterocolitis, meningitis, endophthalmitis, the bacterium that marine organisms infect.
Disclosed by the invention to vibrio fluvialis O1, compared with prior art, tool of the present invention has the following advantages the special Nucleotide of O6, O7, O8 and O9 serotype:
(1) practical
A kind of PCR reaction system that the present invention sets up, can detect vibrio fluvialis, provides the special primer used by serotype detection, utilizes this PCR method can detect clinical samples.
(2) accuracy is high
The present invention passes through the PCR reaction to the special gene of each serotype of vibrio fluvialis, and each sample obtains the band of an entry, will obtain object fragment compared with known length, just can obtain the serotype belonging to vibrio fluvialis.
(3) testing cost is relatively low
The field such as Food Hygiene Surveillance, environmental monitoring, the still quarantine of product supervision and inspection can be applied to, and provide technology mode for other different pathogenic microbes detects combine.
Accompanying drawing illustrates:
Fig. 1 represents that O1 serotype special primer of the present invention detects other serotype reference cultures of vibrio fluvialis electrophoresis result figure,
wzythe screening of gene P1 and P2 primer, object band is 105bp, and remaining serotype is without any band, and concrete bacterial strain information is in table 2;
Fig. 2 represents the species specific qualification electrophoresis result figure of O1 serotype special primer of the present invention, and wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 3 represents O6 serotype of the present invention
wZYgene P3 and P4 primer detect other serotype reference cultures of vibrio fluvialis electrophoresis result figure,
wZYthe screening of gene P3 and P4 primer, object band is 114bp, and remaining serotype is without any band.Concrete bacterial strain information is in table 2;
Fig. 4 represents O6 serotype WZY gene the P3 of the present invention and species specific qualification electrophoresis result figure of P4 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band.Concrete bacterial strain information is in table 2.
Fig. 5 represents O7 serotype of the present invention
wZYgene P5 and P6 primer detect other serotype reference cultures of vibrio fluvialis electrophoresis result figure,
wZYthe screening of gene P5 and P6 primer, object band is 118bp, and remaining serotype is without any band, and concrete bacterial strain information is in table 2;
Fig. 6 represents O7 serotype of the present invention
wZYgene P5 and the species specific qualification electrophoresis result figure of P6 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 7 represents O8 serotype of the present invention
wZYgene P7 and P8 primer detect other serotype reference cultures of vibrio fluvialis electrophoresis result figure,
wZY gene P7 and P8the screening of primer, object band is 101bp, and remaining serotype is without any band.Concrete bacterial strain information is in table 2;
Fig. 8 represents O8 serotype of the present invention
wZYgene P7 and the species specific qualification electrophoresis result figure of P8 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band.Concrete bacterial strain information is in table 2;
Fig. 9 represents O9 serotype of the present invention
wZYgene P9 and P10 primer detect other serotype reference cultures of vibrio fluvialis electrophoresis result figure,
wZY gene P9 and P10the screening of primer, object band is 100bp, and remaining serotype is without any band, and concrete bacterial strain information is in table 2;
Figure 10 represents O9 serotype of the present invention
wZY gene P9 and P10primer species specific qualification electrophoresis result figure, Qi Zhongyong
wZY gene P9 and P10primer have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, and all without any band, concrete bacterial strain information is in table 2;
Figure 11 represents and uses O1 respectively, the electrophoresis result figure of the corresponding serotype of O6, O7, O8 and O9 specific primers amplify, and concrete bacterial strain information is in table 2;
Wherein: O1, O6, O7, O8 and O9 and negative contrast (-) represent corresponding serotype primer amplification result, and first swimming lane H and last swimming lane are 2000bpladdermarker.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments should be understood only be not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition as people such as Sambrook, molecular cloning: the condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989).Wherein vibrio fluvialis derives from JapanCollectionofMicroorganisms(JCM).
embodiment 1: genomic extraction
37 DEG C of nutrient broth mediums cultivate vibrio fluvialis, collect bacterium, extract genome concrete steps as follows:
With 500ul50mMTris-HCl (pH8.0) and 10ul0.4MEDTA re-suspended cell, 37 DEG C of incubations 20 minutes, the N,O-Diacetylmuramidase then adding 10ul10mg/ml continues insulation 20 minutes.Add the Proteinase K of 3ul20mg/ml, 15ul10%SDS afterwards, 50 DEG C of incubations 2 hours, then add the RNase of 3ul10mg/ml, 65 DEG C of incubations 30 minutes.Add equal-volume phenol extracting mixture, get supernatant liquor, then use isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) solution extracting twice, get supernatant liquor, then with isopyknic ether extraction to remove remaining phenol.Supernatant liquor 2 times of volume ethanol precipitation DNA, roll out DNA with glass yarn and wash DNA with 70% ethanol, being finally resuspended in 30ulTE by DNA.Genomic dna is detected by the agarose gel electrophoresis of 0.4%.
embodiment 2:sequence is decoded
Extract vibrio fluvialis O1, O6, O7, the genome of O8 and O9 serotype reference culture, by Solexapair-end sequencing technologies, the sequence that genome sequencing obtains this serotype is carried out to each serotype genome of vibrio fluvialis, Blast and PSI-Blast is used to carry out sequence alignment, TMHMM2.0program is adopted to carry out transmembrane structure prediction, ClustalWprogram is used to carry out sequence alignment and screen conservative and specific gene fragment, final O antigen gene cluster sequence and the decoding result obtaining each serotype of vibrio fluvialis.
embodiment 3: design of primers
Vibrio fluvialis O1, the O antigen gene cluster sequence of each serotype of O6, O7, O8 and O9 is tested oneself in this laboratory, and by compare of analysis, we choose Blast comparison result identity and the relatively low gene specific section design primer of similarity value.Wherein O1 serotype
wzygene comparison result identity value and similarity value are 29% and 46%; O6 serotype
wzygene comparison result identity value and similarity value are 22% and 42%; O7 serotype
wzygene comparison result identity value and similarity value are 30% and 45%; O8 serotype
wzygene comparison result identity value and similarity value are 31% and 56%; O9 serotype
wzygene comparison result identity value and similarity value are 28% and 48%.So each serotype chooses the specific target gene of gene as this serotype of above-mentioned correspondence respectively, the gene specific section for each serotype designs special primer respectively.
Design of primers is the core of this invention.Said gene is imported PrimerPremier5 and carry out design of primers, each gene design pair of primers, has single purpose band.
In Genbank, BLAST is carried out after design of primers, the primer of design can not be too high with the sequence similarity of other nearly edge bacterium, so just can guarantee that this primer only increases in the predetermined position of oneself, and not produce positive reaction with the nearly edge bacterium in the environment of other nearly edge bacterium or collect specimen.This point is very important for the success or failure of the generation and experiment of avoiding non-specific band.
The primer designed is as shown in table 1.
Table 1 is for the primer sequence of PCR
embodiment 4: the screening of special primer
Have collected vibrio fluvialis O1, O6, O7, the reference culture of O8 and O9 serotype and each strain of the reference culture of other 14 kinds of serotypes, the vibrio fluvialis of the non-somatotype of 11 strain, 6 other bacterial strains of strain Vibrio, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source are in table 2.
Table 2 is for the bacterial strain of specific detection
The PCR system that gene identification primer screening is used be 5 μMs of primer 0.4 μ l, 10 × enzyme spcificity reaction buffer 2.5 μ l, 10mMdNTP0.25 μ l, 5U/ μ l hot resistant DNA polymerase 0.2 μ l and 3 μ l testing sample template in the thin-walled PCR pipe of 0.2ml, last ddH
2o supplies 25 μ l.All primers all obtain positive findings in serotype corresponding separately, do not obtain any PCR primer band in other groups.
Reaction cycle parameter in PCR instrument in this step comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 55 DEG C/68 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes
Wherein, O2 uses 68 DEG C of amplifications, and O4 uses 61 DEG C of amplifications, and O13 uses 55-65 DEG C of amplification, and O15 uses 55-58 DEG C of amplification, and O18 uses 65 DEG C of amplifications.
Above-mentioned steps is electrophoresis amplified production in electrophoresis equipment, and the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 1:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 20 minutes, contrast with DL2000Marker;
observe and record result.
Substantially terminated by the work of primer screening after basic PC R reaction, necessary length adjustment is little on the impact of W-response condition, and the primer sequence used in the present invention is all summed up in Table 1.
Table 1 is for the primer sequence of PCR
embodiment 5:the preparations and applicatio of PCR detection kit
It should be noted that: in this patent, the mixing of all primers all refers to detect the mixing of the upstream and downstream primer of a certain specific serovar.What namely P1 and P2 mixing PCR product was out O1.P3 and P4 hybrid detection is that O6, P5 and P6 hybrid detection goes out O7, P7 and P8 hybrid detection goes out O8, P9 and P10 hybrid detection goes out O9;
1, the composition of PCR kit:
dNTP(10mM)30μl;
10 × Buffer (10 × enzyme spcificity reaction buffer) 50 μ l;
Taq polysaccharase (5U/ μ l hot resistant DNA polymerase) 5 μ l;
PCR primer mixture (5 μMs) 10 μ l;
Positive reference substance (KP) 10 μ l;
Negative controls (KN) 10 μ l;
ddH
2O5ml;
Each test kit can be used for detection 10 samples.
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by precious biotechnology company limited; Primer mixture is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH
2o is prepared voluntarily by us.
2, plant and instrument
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by the raw work in Shanghai; Primer mixture is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH2O are prepared voluntarily by us.The equipment PCR instrument (having another name called DNA thermal cycling amplification instrument) of experiment, electrophoresis equipment (comprising electrophoresis apparatus and electrophoresis chamber), gel imaging instrument ,-20 DEG C of refrigerators, supercentrifuge, micropipet and 0.2mlPCR thin-walled tubes.
3, the use specific examples of PCR kit
The PCR detection method using above-mentioned PCR kit to detect vibrio fluvialis comprises the steps:
(1) environmental sample template to be measured is extracted;
(2) add in PCR thin-walled tube, dNTP, 10 × Buffer, Taq polysaccharase, primer, testing sample template and ddH
2o mixes;
(3) mixture mixed in thin-walled PCR pipe is increased in PCR instrument;
(4) electrophoresis amplified production in electrophoresis equipment, record result;
(5) analyze and carry out result judgement.
Environmental sample template in above-mentioned steps (1) is the crude extract of the culture of tap water, river water, seawater etc., or the crude extract of the pure growth of vibrio fluvialis or pure dna, or positive reference substance and negative controls.
The extracting method of the environmental sample template in above-mentioned steps (1) is:
get 1.5ml culture, under 12000rpm condition centrifugal 1 minute, remove supernatant liquor;
get the ddH of 500 μ l
2the resuspended precipitation of O, under 8000rpm condition centrifugal 5 minutes, removes supernatant liquor, dries;
get 100 μ lddH
2the resuspended precipitation of O, water-bath 10 minutes in 100 DEG C of boiling water;
be placed on ice after 10 minutes again, under 12000rpm condition centrifugal 2 minutes;
5. 3 μ l middle layer supernatant are got as pcr template
Reaction cycle parameter in PCR instrument in above-mentioned steps (3) comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 55 DEG C/68 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes.
Above-mentioned steps (4) electrophoresis amplified production in electrophoresis equipment, the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 5:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 20 minutes, contrast with DL2000Marker;
observe and record result.
The present invention by configuration a kind of detect vibrio fluvialis can industrialization produce PCR kit, PCR detection method is needed the combination of components of use together, during use, extract testing sample, just quick, sensitive, easy detection can be carried out through comparatively simple operation sequence simultaneously, in test kit, the consumption of each component and concentration are test gained, and detect with this test kit the testing installation that vibrio fluvialis uses simple, testing cost is low.
Use object that is positive and negative controls to be for the whole operating process of Quality Control, judge accurately to draw.If containing vibrio fluvialis object O antigenic type, then can observe the band with positive reference substance same position from electrophoresis result; If not containing vibrio fluvialis object O antigenic type, then the same with negative controls do not have this band.
The amount of reagent that one-time detection of the present invention is tested in the test kit used sees the following form shown in 3, and DNA profiling amount is 3 μ l:
Table 3 one-time detection tests the amount of reagent in the test kit used
Hot resistant DNA polymerase in the present invention is Taq enzyme.
Above-mentioned positive reference substance is determined it is the sample of each O antigenic type of vibrio fluvialis, and negative controls is then for determining it is not the sample of vibrio fluvialis through laboratory.
If this PCR kit bacteria suspension of vibrio fluvialis carries out pcr amplification, and through extracting the DNA that obtains as template acquired results always.Susceptibility and specificity indifference, like this, can save the extraction step of template DNA, working method is simplified.Meanwhile, compare routine biochemistry detection method, the testing sample that present method adopts can be directly clinical sample nutrient solution, or to detection sample carry out simple separation cultivate just can detect, thus save manpower and materials.
4, the providing of testing sample
Have collected vibrio fluvialis O1, O6, O7, O8 and O9 serotype reference culture, 6 other bacterial strains of strain Vibrio, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source are in table 2.
SEQUENCELISTING
<110> Nankai University
<120> to vibrio fluvialis O1, the Nucleotide that O6, O7, O8 and O9 are special and application thereof
<160>10
<170>PatentInversion3.5
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
aatccaatcggagtagggta20
<210>2
<211>20
<212>DNA
<213> artificial sequence
<400>2
gaaacatctctccgtaagaa20
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
agtatttaattgagggtgta20
<210>4
<211>19
<212>DNA
<213> artificial sequence
<400>4
agtatcgaaatcgccattg19
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
tcgtaattcctgcaacatta20
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
atcaagtctcttggaagaaa20
<210>7
<211>20
<212>DNA
<213> artificial sequence
<400>7
ttctcagttttagttgtggc20
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
aagtcctgatacaactagag20
<210>9
<211>19
<212>DNA
<213> artificial sequence
<400>9
attggctgggtgttgtgat19
<210>10
<211>20
<212>DNA
<213> artificial sequence
<400>10
aaaccgtaaaccttcacaaa20
Claims (7)
1. couple vibrio fluvialis O1, the Nucleotide that O6, O7, O8 and O9 serotype is special, is characterized in that described Nucleotide has: at least one in the Nucleotide shown in SEQIDNO:1-10.
2. vibrio fluvialis O1 according to claim 1, the Nucleotide that O6, O7, O8 and O9 serotype is special, wherein above-mentioned Nucleotide may be used for preparation detection vibrio fluvialis O1, O6, O7, O8 and O9 serotype PCR kit, gene chip or microarray; Described vibrio fluvialis can sample the crude extract of the culture in tap water, river water, seawater, or the crude extract of the pure growth of vibrio fluvialis.
3. one kind according to claim 1 to vibrio fluvialis O1, the PCR kit of the Nucleotide that O6, O7, O8 and O9 serotype is special, comprise PCR primer, dNTP, damping fluid and archaeal dna polymerase, described PCR primer is at least one in the Nucleotide such as shown in SEQIDNO:1-10.
4. test kit according to claim 3, also comprises following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; Primer mixture 10 μ l; Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o1ml.
5. according to claim 1 to vibrio fluvialis O1, the special Nucleotide of O6, O7, O8 and O9 serotype, for the preparation of detection vibrio fluvialis PCR kit, detects the application of the gene chip aspect of vibrio fluvialis.
6. described in claim 1 to vibrio fluvialis O1, the special Nucleotide of O6, O7, O8 and O9 serotype is for the preparation of the application detected in vibrio fluvialis microarray.
7. the application described in claim 5-6, wherein said detection vibrio fluvialis refers to detection and causes severe diarrhea, septicemia, enterocolitis, meningitis, endophthalmitis, the bacterium that marine organisms infect.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510466718.4A CN105200044B (en) | 2015-08-03 | 2015-08-03 | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510466718.4A CN105200044B (en) | 2015-08-03 | 2015-08-03 | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105200044A true CN105200044A (en) | 2015-12-30 |
CN105200044B CN105200044B (en) | 2018-02-27 |
Family
ID=54948006
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510466718.4A Active CN105200044B (en) | 2015-08-03 | 2015-08-03 | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105200044B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110684825A (en) * | 2019-10-30 | 2020-01-14 | 南开大学 | LAMP detection method for molecular typing of serotype O antigen of vibrio parahaemolyticus O9 |
CN112375835A (en) * | 2020-11-30 | 2021-02-19 | 南开大学 | Loop-mediated isothermal amplification detection method for 4O antigen serotypes of vibrio fluvialis and application |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101558168A (en) * | 2006-10-03 | 2009-10-14 | 国立大学法人岐阜大学 | Detection of bacterium by utilizing DnaJ gene and use thereof |
CN103898108A (en) * | 2014-04-21 | 2014-07-02 | 南开大学 | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof |
-
2015
- 2015-08-03 CN CN201510466718.4A patent/CN105200044B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101558168A (en) * | 2006-10-03 | 2009-10-14 | 国立大学法人岐阜大学 | Detection of bacterium by utilizing DnaJ gene and use thereof |
CN103898108A (en) * | 2014-04-21 | 2014-07-02 | 南开大学 | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof |
Non-Patent Citations (2)
Title |
---|
文万侥 等: "基于toxR 基因的河流弧菌PCR快速检测方法的建立", 《水产科学》 * |
郭丹: "两种重要食源性致病菌0血清型分子分型系统的建立、两株不同宿主来源的大肠杆菌比较基因组学和转录组学研究", 《中国博士学位论文全文数据库(电子期刊)医药卫生科技辑》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110684825A (en) * | 2019-10-30 | 2020-01-14 | 南开大学 | LAMP detection method for molecular typing of serotype O antigen of vibrio parahaemolyticus O9 |
CN112375835A (en) * | 2020-11-30 | 2021-02-19 | 南开大学 | Loop-mediated isothermal amplification detection method for 4O antigen serotypes of vibrio fluvialis and application |
Also Published As
Publication number | Publication date |
---|---|
CN105200044B (en) | 2018-02-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
CN104862393A (en) | Nucleotide specific to Cronobacter O antigen and application thereof | |
CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
CN105200044A (en) | Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides | |
CN105200045A (en) | Nucleotides specific to vibrio fluvialis O11, O14, O16 and O17 as well as application of nucleotides | |
CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
CN105063228B (en) | The detection kit and detection method of a kind of flavobacterium columnare | |
CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
Jiang et al. | Rapid on-the-spot detection of Edwardsiella piscicida using recombinase polymerase amplification with lateral flow | |
CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
CN105256042A (en) | Nucleotide specific to Aeromonas hydrophila O13, O36, O16 and O19 and application | |
CN106399512A (en) | Detecting kit for aeromonas hydrophila and detecting method of detecting kit | |
CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
CN105925683B (en) | The detection kit and its application of Edwardsiella tarda | |
CN105087569B (en) | To vibrio cholerae O 18, O19, O23 and the special nucleotides of O12 and its application | |
CN105177133A (en) | Nucleotide specific to vibrio cholerae O6, O4, O7 and O15 and application of nucleotide | |
CN105256028A (en) | Specific nucleotides for citrobacter 017 and 039 and application of special nucleotides | |
CN105255871A (en) | Specific nucleotide for aeromonas hydrophila O7, O8, O9 and O10 and application thereof | |
CN113621719B (en) | Rapid detection method and application of Edwardsiella tarda | |
CN105256043A (en) | Nucleotide specific to Aeromonas hydrophila O29, O30, O33 and O35 and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |