CN106367516B - Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni - Google Patents
Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni Download PDFInfo
- Publication number
- CN106367516B CN106367516B CN201610859054.2A CN201610859054A CN106367516B CN 106367516 B CN106367516 B CN 106367516B CN 201610859054 A CN201610859054 A CN 201610859054A CN 106367516 B CN106367516 B CN 106367516B
- Authority
- CN
- China
- Prior art keywords
- campylobacter jejuni
- kit
- detection
- mediated isothermal
- isothermal amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biological technology detection, and in particular to a kind of loop-mediated isothermal amplification kit and detection method for detecting campylobacter jejuni.Include in the kitcjaAGenetic test primer.Kit of the invention is easy to operate, and detection time is short, detects to the sample DNA extracted, it is only necessary to can go out testing result within about 1 hour or so；High specificity, high sensitivity；It is applied widely, it can be used for the detection of the jejunis such as food samples such as chicken, pork, lowest detection is limited to campylobacter jejuni 20CFU/ml；The detection method of the alternative traditional food jejuni of this method.
Description
Technical field
The invention belongs to field of biological technology detection, and in particular to a kind of ring mediated isothermal amplification for detecting campylobacter jejuni
Kit and detection method.
Background technique
Campylobacter jejuni (Campylobacter jejuni) is universally present in a kind of heavy in poultry enteron aisle
The zoonosis pathogenic bacteria wanted.The mankind mainly through eaten by its pollute poultry, food, dairy products with water infection morbidity.
People is cured clinical campylobacteriosis and is classified as most using acute, self limiting gastroenteritis as typical clinical symptom by the World Health Organization (WHO)
Common food origin disease.The important indicator that campylobacter jejuni detects as pathogenic bacteria, public health, food safety,
It is the project that must be detected in animal and veterinary and inspection and quarantining for import/export, there is important society, economic meaning.It is curved to detect jejunum
The national standard method that aspergillus uses is traditional cultivation, but due to the condition of culture of campylobacter jejuni harshness, so that traditional training
Feeding method there are it is cumbersome, specific not strong, time-consuming the disadvantages of.Therefore, a kind of the quick, sensitive, special of campylobacter jejuni is researched and developed
Different, accurate diagnostic method is significant for food safety detection, clinical diagnosis and epidemiological survey.
Loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) is a kind of
The new nucleic acid amplification technologies on the basis of chain replacement automatic cycle reaction are built on, reaction carries out under 60-65 DEG C of constant temperature.
It being compared with traditional polymerase chain reaction (polymerase chain reaction, PCR), LAMP has 4-6 primer, point
Not Shi Bie six to eight regions on target gene, this give LAMP to react higher specificity.Since LAMP reaction can generate
A large amount of by-product-white magnesium pyrophosphate precipitates, and amplified production can directly observe by the naked eye or turbidity without electrophoretic analysis
Meter can determine that, can also carry out more intuitive easy observation to amplification situation by dyestuffs such as addition SYBR Green I.
Summary of the invention
For the problems of in the prior art, the purpose of the present invention is to provide a kind of rings for detecting campylobacter jejuni
Mediated isothermal amplification kit and detection method.
To achieve the goals above and other related purposes, the present invention adopts the following technical scheme:
The first aspect of the present invention provides a kind of loop-mediated isothermal amplification kit for detecting campylobacter jejuni, the examination
It include cjaA genetic test primer in agent box.
Preferably, the cjaA genetic test primer includes:
FIP:GCTTGATCTTATCAAGAGAATTTCTTTGTTGCAGTAGTATTGGC (SEQ ID NO.1)；
BIP:AATGGAGTTGTTAGGATTGAGCCTTGATTGTTTCCTT (SEQ ID NO.2)；
F3:TCTAAGTGTTTTAACGGC (SEQ ID NO.3)；
B3:AGTTCTTTTGCTATGCGT (SEQ ID NO.4)；
LF:GTCAGAATTTCCTCCACAAGCA (SEQ ID NO.5)；
LB:GGGTATTTGGCGATAAACCACC (SEQ ID NO.6).
Kit of the invention carries out cjaA genetic test using loop-mediated isothermal amplification technique, according to amplification and detection feelings
Condition can analyze and determine whether test object contains campylobacter jejuni.Therefore, the design of primer is the key that kit of the present invention.
It is detected based on kit of the present invention using loop-mediated isothermal amplification technique, so in kit
Can also include some other loop-mediated isothermal amplification technique required for conventional reagent, such as: dNTPs, magnesium chloride, glycine betaine,
Bst archaeal dna polymerase large fragment, ThermoPol Buffer, ultrapure water, SYBER Green I, sample gene group DNA extract examination
One of common loop-mediated isothermal amplification technique reaction reagent such as agent is a variety of.Since such loop-mediated isothermal amplification technique is normal
It can individually be bought through market approach with reagent or voluntarily be configured, therefore specifically need which reagent being fitted into kit,
It can be actually needed and be configured according to client, for convenience, can also all be fitted into kit.
Kit of the invention can be the primer containing independent packaging, be also possible to containing configured containing primer
Ring mediated isothermal amplification detect liquid.
Ring mediated isothermal amplification detection liquid can be configured voluntarily, can also general ring Jie directly with commercially available without primer
It leads isothermal duplication detection liquid and primer acquisition is added.For example, in the kit can also containing dNTPs, magnesium chloride, glycine betaine,
Bst archaeal dna polymerase large fragment, ThermoPol Buffer, ultrapure water, SYBER Green I.Be added primer of the invention, to
Inspection sample genomic dna can be obtained loop-mediated isothermal amplification system.
Preferably, positive control can also be contained in the kit.The positive control is to contain campylobacter jejuni cjaA
The sample of gene expression.
Preferably, negative control can also be contained in the kit.Negative control can be for without containing campylobacter jejuni cjaA
The sample of gene expression.
The second aspect of the present invention provides the use of the loop-mediated isothermal amplification kit of aforementioned detection campylobacter jejuni
Method includes the following steps:
(1) sample gene group DNA is extracted；
(2) it is loaded: sample gene group DNA, positive control or negative control is separately added into equipped with ring mediated isothermal amplification
In the pipe of reaction system, corresponding example reaction pipe, positive reaction pipe or negative reaction pipe, the ring mediated isothermal amplification are obtained
Contain aforementioned cjaA genetic test primer in reaction system；
(3) loop-mediated isothermal amplification；
(4) result is analyzed.
Preferably, the method is the method for non-disease diagnostic purpose.
In step (1), extraction sample gene group DNA is the prior art.
Preferably, it in step (3), is reacted using water bath with thermostatic control when loop-mediated isothermal amplification.More specifically, 65 DEG C
After 30min, 80 DEG C of 3min terminate reaction.
The third aspect of the present invention provides aforementioned agents box and is preparing the purposes in cjaA genetic test product.
Preferably, the testing product is for detecting and screening campylobacter jejuni.
Compared with prior art, the invention has the following beneficial effects:
Kit of the invention is easy to operate, and detection time is short, detects to the sample DNA extracted, it is only necessary to which about 1 is small
When or so can go out testing result；High specificity, high sensitivity；It is applied widely, it can be used for food samples such as chicken, pork etc.
The detection of jejuni, lowest detection are limited to campylobacter jejuni 20CFU/ml；In the alternative traditional food of this method
The detection method of campylobacter jejuni.
Detailed description of the invention
Fig. 1: agarose (1.5%w/v) electrophoresis of the LAMP amplified production of campylobacter jejuni type strain NCTC11168 point
Analysis；Wherein, swimming lane 1:LAMP product；Swimming lane N: negative control；Swimming lane M:Maker DL2000 (precious biology).
Fig. 2: the solubility curve analysis of campylobacter jejuni type strain NCTC11168 amplified production；Wherein, lines A/B: yin
Property control；Lines C/D: empty curved LAMP product.
Fig. 3: the specificity of LAMP method is analyzed by detection campylobacter jejuni and non-campylobacter jejuni；Wherein, swimming lane M:
Maker DL2000；Swimming lane 1: campylobacter jejuni type strain NCTC11168；Swimming lane 2-11: the curved bacterium of non-empty；Swimming lane N: template is
The negative control of water.
The rflp analysis of Fig. 4: LAMP product；Swimming lane M:Maker DL2000；Swimming lane 1: curved by the jejunum of Sau3A I digestion
The LAMP product of aspergillus NCTC11168；Swimming lane 2: it is not produced by the LAMP of the campylobacter jejuni NCTC11168 of Sau3A I digestion
Object；Swimming lane N: template is the negative control of water.
The comparative analysis of agarose (1.5%w/v) electrophoresis sensitivity of Fig. 5: PCR reaction；Swimming lane M:Maker DL2000；
Swimming lane 1-7: 10 times of gradient dilution campylobacter jejuni NCTC11168 type strains 2.0 × 10 are corresponded respectively to7-2.0×101CFU/
ml；Swimming lane N: template is the negative control of water.
Agarose (1.5%w/v) electrophoretic analysis of Fig. 6: LAMP sensitivity；Swimming lane M:Maker DL2000；Swimming lane 1-7:
Correspond respectively to 10 times of 11168 type strains 2.0 × 10 of gradient dilution campylobacter jejuni NCTC6-2.0×100CFU/ml；Swimming lane N:
Template is the negative control of water.
Campylobacter jejuni NCTC11168 type strain LAMP reaction product naked eyes and purple after Fig. 7: SYBR Green I dyeing
Color change under outer lamp；PCR pipe NC: template is the negative control of water；PCR pipe 1-7: 10 times of gradient dilution skies are corresponded respectively to
Intestines Campylobacter spp NCTC11168 type strain 2.0 × 100-2.0×106CFU/ml。
Specific embodiment
Before further describing the specific embodiments of the present invention, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, rather than limiting the scope of protection of the present invention.
When embodiment provides numberical range, it should be appreciated that except non-present invention is otherwise noted, two ends of each numberical range
Any one numerical value can be selected between point and two endpoints.Unless otherwise defined, the present invention used in all technologies and
Scientific term is identical as the normally understood meaning of those skilled in the art of the present technique.Except specific method, equipment used in embodiment,
Outside material, grasp and record of the invention according to those skilled in the art to the prior art can also be used and this
Any method, equipment and the material of the similar or equivalent prior art of method described in inventive embodiments, equipment, material come real
The existing present invention.
The preparation of 1 kit of embodiment
Design of primers and synthesis:
CjaA is the conservative gene of campylobacter jejuni, and C-terminal amino acid is bound to inner membrance, and partial amino-acid is exposed to
Outer membrane is one of ABC type cysteine movement system ingredient.BLAST comparison, discovery are carried out by consulting literatures and on NCBI
CjaA gene specific is good, and conservative is high, homology is high, is a reliable target gene, can be used for the detection of campylobacter jejuni.
Referring to the cjaA gene order design primer of GenBank jejuni NCTC11168, the primer includes:
FIP, BIP, F3, B3, LF and LB.Using the PrimerExplorer V4 software of Japanese Rong Yan Chemical Co., Ltd. according to default
It is set for design (http://primerexplorer.jp/elamp4.0.0/index.html), and public by Jin Sirui biology
Department synthesizes according to PAGE purity grade.
The nucleotide sequence of the primer is as shown in table 1 below:
Table 1
Above-mentioned primer can be packed individually, and ring mediated isothermal amplification detection liquid can also be made into.The ring mediated isothermal amplification
It detects in liquid, the amount of above-mentioned primer uses the conventional amount used known to those skilled in the art known.
That is, kit of the invention, can be the primer containing above-mentioned independent packaging, it is also possible to containing configuration
The good ring mediated isothermal amplification containing primer pair detects liquid.
Further, the kit can also containing dNTPs, magnesium chloride, glycine betaine, Bst archaeal dna polymerase large fragment,
ThermoPol Buffer, ultrapure water, SYBER Green I, sample gene group DNA extract reagent etc..
Kit performance verification in 2 embodiment 1 of embodiment
One, when using the primer in kit described in embodiment 1, loop-mediated isothermal amplification system and response procedures
It establishes
Loop-mediated isothermal amplification system: each 0.2 μM of F3 and B3, LF and each 0.8 μM of LB, FIP and each 1.6 μM of BIP,
The dNTPs of 0.8mM, magnesium chloride 4mM, glycine betaine 0.8M, Bst archaeal dna polymerase large fragment 8U, 10 × ThermoPol Buffer
The sample gene group DNA of 2.5 μ l, 2 μ l, finally plus ultrapure water is to 25 μ l.
Loop-mediated isothermal amplification program: water bath with thermostatic control is reacted, i.e. after 65 DEG C of 30min, 80 DEG C of 3min terminate reaction.
As the result is shown: passing through the agarose (1.5%w/ of the LAMP amplified production of campylobacter jejuni type strain NCTC 11168
V) electrophoretic analysis, it can be observed that gradient band (as shown in Figure 1).
Two, kit described in embodiment 1 and the specificity identification of detection method
The specificity for carrying out the product that the solubility curve analysis verifying that real-time fluorescence LAMP method is reacted amplifies, that is, exist
1:3000 times of diluted SYBER Green I (invitrogen) is added in water bath with thermostatic control reaction system, passes through quantitative fluorescent PCR
Instrument ABI7500, the amplification situation of real-time detection DNA, and pass through the non-specific amplification situation of solubility curve detection primer.
Mediated using campylobacter jejuni and non-campylobacter jejuni (Tables 1 and 2) test based on the ring that cjaA is target gene etc.
The specificity of warm amplification technique detection campylobacter jejuni.
Campylobacter jejuni used in the experiment of table 1
Non- campylobacter jejuni used in the experiment of table 2
aNCTC, Chinese medicine Microbiological Culture Collection administrative center；
bCCTCC, Chinese Industrial Standards (CIS) strain collections；
cATCC, Unite States Standard strain collections；
In addition, also analyzing LAMP reaction by RFLP (Restriction Fragment Length Polymorphism)
Specificity.LAMP targeted target gene is that a segment length about 220bp of the cjaA gene of campylobacter jejuni NCTC11168 is left
Right segment has the restriction enzyme site of a Sau3A I in the target fragment, can be target gene digestion at 93bp and 124bp
Two segments.The specificity of system is judged by the rflp analysis to LAMP product.
The results show that being analyzed by solubility curve, LAMP Non-specific amplified production (Fig. 2) nothing but；Pass through campylobacter jejuni
It is tested with the LAMP of non-campylobacter jejuni, all 101 plants of campylobacter jejuni (including type strain and separation strains) detections are the positive,
12 plants of non-campylobacter jejunis determine to be negative (Fig. 3), pass through rflp analysis, the LAMP product of campylobacter jejuni NCTC11168
Two segments (Fig. 4) for meeting expected size are digested out, the specificity of the system is good.
Three, the sensitivity identification of kit described in embodiment 1 and detection method
The campylobacter jejuni mark strain NCTC11168 of recovery cryo-conservation, 10 times of bacterial suspension are incremented by and are diluted to 2.0 × 107
~2.0 × 100This 8 concentration of CFU/ml, extract DNA respectively, with the primer in kit of the invention, construct ring mediated isothermal
Augmentation detection system and program are detected, and Monitoring lower-cut is investigated.The primer sequence is FIP, BIP, F3, B3, LF, LB.
Reference is done with the PCR reaction of primers F 3 and B3 progress routine in the present invention simultaneously, sensitivity is evaluated.
When to be checked, the genomic DNA of sample is extracted using boiling cracking process, the specific steps are as follows: draw the culture shaken up
Bacterial suspension 1ml 8000 × g in 1.5ml microcentrifugal tube is centrifuged 5 minutes, and precipitating is suspended and washed using PBS.Then it uses again
8000 × g centrifugation, which obtains, to be precipitated and bacterium is resuspended using 70 μ l ultrapure waters.Bacterium is cracked using boiling method, i.e. bacterial suspension exists
100 DEG C are boiled 10min, and 12000 × g is centrifuged 3 minutes, draw supernatant as template (sample gene group DNA).
Loop-mediated isothermal amplification system: each 0.2 μM of F3 and B3, LF and each 0.8 μM of LB, FIP and each 1.6 μM of BIP,
The dNTPs of 0.8mM, magnesium chloride 4mM, glycine betaine 0.8M, Bst archaeal dna polymerase large fragment 8U, 10 × ThermoPol Buffer
The sample gene group DNA of 2.5 μ l, 2 μ l, finally plus ultrapure water is to 25 μ l.
Loop-mediated isothermal amplification program are as follows: mixed liquor is heated 3 minutes in 80 DEG C and terminated after 65 DEG C are incubated for 30 minutes
Reaction.Can be by the way that the 1/10 diluted SYBR green I stoste of 1.0 μ l be added in PCR pipe, the color for passing through reaction solution becomes
Change to determine whether containing campylobacter jejuni.When containing campylobacter jejuni DNA amplification product, solution becomes green from crocus
Color；When no campylobacter jejuni amplified production, color is still crocus；Under ultraviolet light, the DNA product of amplification is more,
The green fluorescence intensity that pipe issues is stronger.
The results show that loop-mediated isothermal amplification technique and Standard PCR sensitivity technique limit are respectively 2 × 101CFU/ml and 2
×102CFU/ml (Fig. 6 and Fig. 5).Detection loop-mediated isothermal amplification technique sensitivity (Fig. 7) and fine jade are dyed with SYBR Green I
The result of lipolysaccharide electrophoretic analysis is consistent.
Kit in 3 embodiment 1 of embodiment detects food jejuni
1. the extraction of sample acquisition and DNA
The chicken surface wipes sample (PBS wetting) in 200 parts of food markets is acquired, 8000 × g is centrifuged 5 minutes, and precipitating uses PBS
It suspends and washs.Then it is centrifuged to obtain with 8000 × g again and precipitates and bacterium is resuspended using 70 μ l ultrapure waters.It is cracked using boiling method
Bacterium, i.e., 100 DEG C of bacterial suspension are boiled 10min, and 12000 × g is centrifuged 3 minutes, draw supernatant as template (sample gene group
DNA)。
2. food samples jejuni detects
Referring to national standard detection method, campylobacter jejuni separation identification is made to 200 parts of chicken meat samples, detects jejunum campylobacter altogether
43 parts of bacterium positive sample.And it is curved to 200 portions of samples progress jejunums referring to the kit in the application embodiment of the present invention 1 of embodiment 2
Aspergillus detection, specifically:
Loop-mediated isothermal amplification system: each 0.2 μM of F3 and B3, LF and each 0.8 μM of LB, FIP and each 1.6 μM of BIP,
The dNTPs of 0.8mM, magnesium chloride 4mM, glycine betaine 0.8M, Bst archaeal dna polymerase large fragment 8U, 10 × ThermoPol Buffer
The sample gene group DNA of 2.5 μ l, 2 μ l, finally plus ultrapure water is to 25 μ l.
Loop-mediated isothermal amplification program are as follows: mixed liquor is heated 3 minutes in 80 DEG C and terminated after 65 DEG C are incubated for 30 minutes
Reaction.Can be by the way that the 1/10 diluted SYBR green I stoste of 1.0 μ l be added in PCR pipe, the color for passing through reaction solution becomes
Change to determine whether containing campylobacter jejuni.When containing campylobacter jejuni DNA amplification product, solution becomes green from crocus
Color；When no campylobacter jejuni amplified production, color is still crocus；Under ultraviolet light, the DNA product of amplification is more,
The green fluorescence intensity that pipe issues is stronger.
The results show that LAMP technology of the invention detects that 45 parts of sample campylobacter jejunis are positive, detected by National Standard Method
For positive sample, LAMP method is also the positive, show LAMP method it is sensitiveer with it is practical.
Those skilled in the art know that the campylobacter jejuni in National Standard Method detection food generally requires 1~2 week could be complete
At detection, and use kit and detection method of the invention, it is only necessary to which detection can be completed in the time within 1 day.To extracting
Sample DNA detected, it is only necessary to testing result can be gone out within about 1 hour or so.Kit of the invention is applied widely, can use
In the detection of the jejunis such as food samples such as chicken, pork, lowest detection is limited to campylobacter jejuni 20CFU/ml；This
Method can substitute the detection method of traditional food jejuni well.
The above-described embodiments merely illustrate the principles and effects of the present invention, and is not intended to limit the present invention.It is any ripe
The personage for knowing this technology all without departing from the spirit and scope of the present invention, carries out modifications and changes to above-described embodiment.Cause
This, institute is complete without departing from the spirit and technical ideas disclosed in the present invention by those of ordinary skill in the art such as
At all equivalent modifications or change, should be covered by the claims of the present invention.
Claims (3)
1. a kind of loop-mediated isothermal amplification kit for detecting campylobacter jejuni includes that cjaA genetic test is drawn in the kit
Object, the cjaA genetic test primer include:
FIP:
GCTTGATCTTATCAAGAGAATTTCTTTGTTGCAGTAGTATTGGC(SEQ ID NO.1)；
BIP:AATGGAGTTGTTAGGATTGAGCCTTGATTGTTTCCTT (SEQ ID NO.2)；
F3:TCTAAGTGTTTTAACGGC (SEQ ID NO.3)；
B3:AGTTCTTTTGCTATGCGT (SEQ ID NO.4)；
LF:GTCAGAATTTCCTCCACAAGCA (SEQ ID NO.5)；
LB:GGGTATTTGGCGATAAACCACC (SEQ ID NO.6).
2. detection kit according to claim 1, which is characterized in that further include dNTPs, chlorination in the kit
Magnesium, glycine betaine, Bst archaeal dna polymerase large fragment, ThermoPol Buffer, ultrapure water, SYBER Green I or sample gene
Group DNA extracts combination any one or more in reagent.
3. kit is preparing for detecting and screening campylobacter jejuni as described in any one of claim 1~2 claim
Purposes in cjaA genetic test product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610859054.2A CN106367516B (en) | 2016-09-28 | 2016-09-28 | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610859054.2A CN106367516B (en) | 2016-09-28 | 2016-09-28 | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106367516A CN106367516A (en) | 2017-02-01 |
| CN106367516B true CN106367516B (en) | 2019-08-23 |
Family
ID=57898215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610859054.2A Active CN106367516B (en) | 2016-09-28 | 2016-09-28 | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106367516B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080571B (en) * | 2020-09-22 | 2022-11-11 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121049A (en) * | 2010-01-08 | 2011-07-13 | 江苏省家禽科学研究所 | Loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and using method thereof |
| CN102534038A (en) * | 2012-02-27 | 2012-07-04 | 江南大学 | High-sensitivity rapid detection kit for campylobacter jejuni |
| CN102864229A (en) * | 2012-09-21 | 2013-01-09 | 武汉真福医药科技发展有限公司 | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni |
-
2016
- 2016-09-28 CN CN201610859054.2A patent/CN106367516B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121049A (en) * | 2010-01-08 | 2011-07-13 | 江苏省家禽科学研究所 | Loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and using method thereof |
| CN102534038A (en) * | 2012-02-27 | 2012-07-04 | 江南大学 | High-sensitivity rapid detection kit for campylobacter jejuni |
| CN102864229A (en) * | 2012-09-21 | 2013-01-09 | 武汉真福医药科技发展有限公司 | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni |
Non-Patent Citations (4)
| Title |
|---|
| Comparison of Loop-Mediated Isothermal Amplification Assay and Conventional Culture Methods for Detection of Campylobacter jejuni and Campylobacter coli in Naturally Contaminated Chicken Meat Samples;Wataru Yamazaki等;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20090331;摘要，第1598页表1和右栏第2-3段，第1599页右栏最后1段，第1600页图1 * |
| Development and evaluation of a loop-mediated isothermal amplification assay for rapid and simple detection of Camp ylobacter jejuni and Campylobacter coli;Wataru Yamazaki等;《Journal of Medical Microbiology》;20080401;第57卷;444–451 * |
| 基于CjaA蛋白检测鸡空肠弯曲菌抗体的间接ELISA方法建立及其单克隆抗体研制;尹衍新;《中国学位论文全文数据库》;20101123;第2页第2段，第26页第1.2.1节 * |
| 空肠弯曲菌LAMP快速检测方法的建立;林超 等;《微生物学通报》;20090620;第36卷(第6期);923-928 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106367516A (en) | 2017-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367492A (en) | Method for rapidly detecting listeria monocytogenes at constant temperature, primer and applications of primer | |
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| CN102146469B (en) | Vibrio parahemolyticus dual-real-time fluorescence PCR (Polymerase Chain Reaction) detecting primer, probe, detecting kit and detecting method | |
| CN102605055A (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN103898222B (en) | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN104263841B (en) | Real-time fluorescence LAMP (loop-mediated isothermal amplification) detection method and kit for phytophthora parasitica in potatoes | |
| CN110218806A (en) | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit | |
| CN102010913B (en) | Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof | |
| CN106148502A (en) | A kind of high throughput method directly detecting food source pathogenic bacteria | |
| CN104711365B (en) | The kit that detection of Salmonella and Escherichia coli O78 multiplex PCRs quickly detect | |
| CN102242216B (en) | Fluorescent PCR (polymerase chain reaction) detection kit for vibrio cholerae and systematic identification method thereof | |
| CN108504753A (en) | A method of detection staphylococcus aureus live bacteria in milk | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN102424861B (en) | Loop-mediated isothermal amplification method for detecting salmonella in food and reagent kit | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN106367516B (en) | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni | |
| CN106086206A (en) | Green Wei Si Salmonella loop-mediated isothermal gene amplification fast detecting kit and detection method | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN105543350B (en) | A kind of the LAMP detection primer group and detection method of gnathostoma siamense | |
| CN111057776B (en) | Listeria and 6 common Listeria specific novel molecular targets and rapid detection method thereof | |
| CN103981270A (en) | Photobacterium damsela rapid detection primer, kit and application | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN102925568B (en) | Primer and probe for detecting acidovorax citrulli and detection method for acidovorax citrulli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |